Báo cáo khoa học: Coexpression, purification and characterization of the E and S subunits of coenzyme B12 and B6 dependent Clostridium sticklandii D-ornithine aminomutase in Escherichia coli potx

Coexpression, purification and characterization of the E and S subunits of coenzyme B 12 and B 6 dependent Clostridium sticklandii D -ornithine aminomutase in Escherichia coli Hao-Ping Chen 1 , Fang-Ciao Hsui 1 , Li-Ying Lin 1 , Chien-Tai Ren 2 and Shih-Hsiung Wu 2 1 Institute of Biotechnology and Department of Chemical Engineering, National Taipei University of Technology, Taipei, Taiwan; 2 Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei, Taiwan D -Ornithine aminomutase from Clostridium sticklandii comprises two strongly associating subunits, OraS and OraE, with molecular masses of 12 800 and 82 900 Da. Previous studies have shown that in Escherichia coli the recombinant OraS protein is synthesized in the s oluble form and OraE a s inclusion bodies. Refolding experiments also indicate that the interactions between OraS and OraE and the binding of either pyridoxal phosphate (PLP) or aden- osylcobalamin (AdoCbl) p lay i mportant roles in the refolding process. In this study, the DNA fragment con- taining both genes was cloned into the same expression vector an d coexpression of the oraE and oraS genes was carried out in E. coli . The solubility of the coexpressed OraS and O raE increases with decreasing isopropyl thio- b- D -galactoside induction temperature. Among substrate analogues tested, only 2,4-diamino-n-butyric acid displays competitive inhibition of the enzyme with a K i of 96 ± 14 l M . Lys629 is responsible for the binding of PLP. The apparent K d for coenzyme B 6 binding to D -ornithine aminomutase is 224 ± 41 n M as measured by equilibrium dialysis. T he m utant protein, OraSE–K629M, i s s uccessfully expressed. It is catalytically inactive and unable to bind PLP. Because no coenzyme is involved i n protein folding during in vivo translation of OraSE–K629M in E. coli, in vitro re- folding of the enzyme employs a different folding mechan- ism. In both c ases, the association of the S a nd E subunit is important for D -ornithine aminomutase to maintain an active conformation. Keywords: adenosylcobalamin; B 12 ; D -ornithine amino- mutase. D -Ornithine aminomutase from Clostridium sticklandii catalyzes the r eversible interconversion of D -ornithine into 2,4-diaminopentanoic acid [1]. It comprises two strongly associating sub units, O raS a nd OraE , w ith m olecular masses of 1 2 800 and 82 900 Da. Two diff erent coenzymes, pyridoxal phosphate (PLP) and adenosylcobalamin ( Ado- Cbl), are involved in this enzymatic reaction. The genes encoding D -ornithine aminomutase, oraE and oraS,have been cloned, sequenced, and expressed in Escherichia coli [2]. The recombinant OraS protein was synthesized in a soluble homogeneous form, but the majority of OraE protein was produced in the form of inclusion bodies. T he enzymatic a ctivity could be restored after a refolding step. However, OraE could not be properly folded in the absence of OraS and coenzyme. These observations indicate that the binding of AdoCbl or PLP and the interactions between OraS an d OraE play important roles i n t he OraE refolding process. The strong interaction between the E and S subunits of the enzyme was first reported by Barker & Stadtman [3]; Barker discovered glutamate mutase, which is also composed of weakly interacting E and S components. The correlation between these interactions and protein folding is not clear. As protein refolding is labor intensive and time consu- ming, an efficient expression system to produce large amounts of soluble proteins in a short time is required. Instead of expressing the oraE and oraS genes separately, the DNA fragment containing both genes was cloned i nto the same expression vector under the control of the T7 promoter, and coexpression of oraE and oraS genes was carried out in E. co li. Meanwhile, the extent of the involvement of AdoCbl or PLP in the in vivo folding process w as also investigated. We now describe the construction, coexpression, and purification of the apo- enzyme of D -ornithine aminomutase, together with the temperature effect o n p rotein expression and characteriza- tion of the recombinant proteins. Materials and methods Materials AdoCbl was obtained from Sigma. Micro Dialysis tube, Q-Sepharose High Performance anion-exchange medium and Phenyl-Sepharose High Performance hydrophobic interaction g el medium were from Amersham Biosciences. Restriction endonucleases, BamHI, SpeI, an d NcoI, Correspondence to H P. Chen, Institute of Biotechnology and Department of Chemical Engineering, National Taipei University of Technology, 1, Sec 3, Chung-Hsiao East Road, Taipei 106, Taiwan. Fax: +886 2 27317117, Tel.: +886 2 27712171 ext. 2528, E-mail: hpchen@ntut.edu.tw Abbreviations: AdoCbl, adenosylcobalamin; IPTG, isopropyl thio-b- D -galactoside; PLP, pyridoxal phosphate. (Received 3 0 June 200 4, revised 26 August 2004 , accepted 17 September 2004) Eur. J. Biochem. 271, 4293–4297 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04369.x DNA-modifying enzymes, and Ex Taq DNA polymerase were purchased from TaKaRa (Otsu, Japan). The E. coli strain BL21(DE3) codon plus was from Stratagene. 1,4-Diaminobutane and (R,S)-2,4-diamino-n-butyric acid were from Sigma. 4-Am inopentanoic acid, and 2,5-diamino- pentanol were the k ind gift from T L. Shih ( Department of Chemistry, Tamkang University, Taiwan). All c hemicals used were of molecular biology grade o r higher. Construction of expression vector poraSE A pair of oligonucleotides, 75 and 44 (Table 1), was designed using the nucleotide sequence of the ora genes in order to f acilitate t he amplication by PCR. An NcoIsitewas introduced into the start of the oraS gene and a BamHI site into t he e nd o f the oraE gene. Genomic DN A w as purified from C. sticklandii by phenol/chloroform extraction m eth- ods [4]. The coding regions for the S and E subunits of D -ornithine aminomutase were then amplified by PCR using c lostridial genomic DNA as template. Amplification was achieved using 30 cycles at the f ollowing temperatures: 95 °C for 30 sec, 50 °C for 1 min, and 72 °Cfor4min. Finally, the reaction was maintained at 72 °Cfor5min. The PCR products were gel-purified, restricted with NcoI and BamHI, and ligated with NcoI/BamHI restricted pET- 28a vector. The ligation mixture was used to transform E. coli DH5a. The plasmid that carried the oraS and oraE genes in the correct orientation was designated poraSE. Isopropyl thio-b- D -galactoside induction temperature and small-scale expression To facilitate the over-expression of the ora genes, poraSE wasusedtotransformE. coli BL21(DE3) codon plus. Cultures were first grown at various temperatures in 500 m L L uria–Bertani medium containing kanamycin (30 mgÆL )1 ). After isopropyl thio-b- D -galactoside (IPTG) induction and expression, the cells were harvested by centrifugation and resuspend ed in 1 5 mL of 50 m M phos- phate buffer, pH 7.0. The cells were ruptured by sonication and cell debris was removed by centrifugation at 25 0 00 g for 1 5 min at 4 °C. To examine the solubility of th e over- expressed proteins, 20 lL o f supernatant was taken for analysis by SDS/PAGE. The insoluble f raction and cell debris from 1 mL overnight culture were collected by microcentrifugation at 13 000 rpm f or 5 min and dissolved in 100 lL SDS/PAGE loading buffer; 10 lLwastakento analyse by SDS/PAGE. Large-scale protein expression and purification Cultures were grown at 25 °C by inoculating a 5 mL overnight c ulture into 4 L of Luria–Bertani m edium containing kanamycin (30 mgÆL )1 ). Incub ation was contin- ued until the culture reached an attenuance of 0.6–0.8 at 600 n m, at which point the temperature was lowered to 20 °C and expression was induced by the addition of 200 mgÆL )1 IPTG. After overnight incubation, cells were harvested by centrifugation at 4000 g for 10 min. The cells were then stored at )20 °C. All purifi cation steps were performed on ice or at 4 °C. In a typical purification, 15 g of cells (wet weight) were resuspended in 3 0 mL of 5 0 m M Tris/Cl buffer, pH 9.0. The cells were ruptured in a v olume o f 3 0 mL by s onication. Cell debris was removed by centrifugation at 25 000 g for 15 min. The supernatant was applied directly to a 2.6 · 20 cm Q-Sepharose Fast Flow anion-exchange col- umn equilibrated with 10 m M Tris/Cl buffer, pH 9.0. Protein was eluted with a 600 mL gradient from 0 to 0.5 M KCl. The flow rate was 1 mLÆmin )1 ; 5 mL fractions were collected. A ctive fractions were pooled and brou ght to 25% saturation i n ammonium sulfate by slow addition of solid. The precipitate was removed by centrifugation at 25 000 g for 30 min and the supernatant was applied directly to a Phenyl-Sepharose High Performance hydro- phobic interaction column (2.6 · 25 cm) equilibrated w ith 10 m M Tris/Cl buffer, pH 9.0, co ntaining 1 M (NH 4 ) 2 SO 4 . After w ashing the column with 100 mL of the same buffer, the e nzyme was eluted with a linear, descending gradient of ammonium sulfate in 1000 mL o f buffer. The flow rate was 1mLÆmin )1 ; 10 mL fractions were collected. Active frac- tions were pooled and concentrated to 15 mL by ultrafil- tration in a stirred cell fitted with a YM-3 membrane. The protein solution was stored at )80 °C in the presence of 50% (v/v) glycerol. Mutant construction The construction of mutant poraSE-K629M was carried out using r ecombinant P CR [5]. Two overlapping, comple- mentary oligonucleotides were designed to introduce the mutagenic sequence. A 1.8 kb and 700 base pair region of the oraE gene were PCR amplified using poraEX as template and oligonucleotide pairs 40/66 and 41/67 as primers. Both PCR products were gel-purified and assem- bled in a second round of PCR using oligonucleotides 40 and 41 as primers and cotemplates. The PCR product was purified, restricted with SpeIandBamHI, and ligated with SpeI/BamHI-restricted poraSE vector. The resulting p las- mid was designated poraSE-K629M. The DNA fragment amplified by PCR was resequenced by automated methods (Mission Biotech Co. L td., Nankang, T aipei, Taiwan; A BI 3730 XL DNA A nalyzer, Applied Biosystems, CA, USA) to confirm that no unwanted mutation h ad been introduced. The procedures for production and purification of the mutant protein were the same as those of the wild-type. Protein determination and enzyme assay Protein concentrations were determined by the method of Bradford using bovine serum albumin as standard [6]. The Table 1. PCR primer names and seq uences. Primer name Sequence 21 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA 33 CCGGAATTCTTATTTCCCTTCTCTCATCTC 40 GCGCGCCATGGAAAAAGATCTACAGTTAAGA 41 GGGGGATCCCCATAATCCACTCCACCTGCTAAA 44 GGGGGGGATCCT CATTATTTCCCTTCT 66 AATACCGCCATGTATAATATCTATTACTTC 67 GTAATAGATATTATACATGGCGGTATTGAA 75 GGGGGGGCCATGGAAAGAGCAGACGATTT 4294 H P. Chen et al.(Eur. J. Biochem. 271) Ó FEBS 2004 assay k it was obtained f rom B io-Rad, H ercules, CA, USA. A rapid spectrophotometric method was used to assay D -ornithine aminomutase activity [7]. The assay couples the reduction of NADP + to form 2,4-diaminopentanoic acid through the action of NAD + /NADP + -dependent 2,4-diaminopentanoic acid dehydrogenase. The K i value of the competitive inhibitor, 2,4-diamino-n-butyric acid, was determined by measuring the apparent K m value of D -ornithine at 25 , 50, 100, 200 and 400 l M of the inhibitor. For the measurement of the activity of the substrate analogues, an HPLC and NMR-based method was devel- oped. A 1.0 mL solution in a septum-sealed vial containing 6 l MD -ornithine aminomutase, 0.4 m M PLP, an d 0.14 m M AdoCbl in 100 m M potassium phosphate buffer, pH 7.8, was made anaerobic by purging with ar gon. A c oncentrated anaerobic 0 .1 mL solution of substrate analog (0.5 M )inthe same buffer was introduced into the vial by syringe to initiate the reaction. After overnight incubation at room temperature in the dark, the reactions were stopped by freeze-drying. The reaction products were separated by HPLC on a C 18 reverse phase column with a linear g radient of acetonitrile containing 0.1% (v/v) trifluoroacetic acid. The substrate analogues, presumed products, and phos- phate ion were eluted at the beginning of the run and collected by hand. The mixture was dried by evaporation under vacuum and redissolved in 0.4 mL D 2 Othreetimes. The solution was transferred to an NMR tube and the spectra were recorded at 400 MHz. Measurement of the binding of PLP to proteins The binding of coenzyme B 6 to D -ornithine aminomutase was measured by equilibrium dialysis. About 250 lLof 30 l M purified proteins were loaded i nto the Micro Dialysis tube. The protein s olutions were dialyzed against 4 00 mL of 10 m M Tris buffer, pH 9 .0, in the presence o f 6000, 1500, 960, 480, 300 and 150 n M coenzyme B 6 at 4 °Cfor4h. Absorbance was recorded at 420 nm using an Amersham Bioscience Ultrospec 2100 spectrophotometer; a sample of the c orresponding dialysis buffer was used to s ubtract out the c ontribution of unbound PLP from the absorbance of the e nzyme. A computer program ( KALEIDA GRAPH , Synergy Software, Reading, PA, USA) was used to fit the data in order to estimate the dissociation constant. Ultraviolet–visible protein spectrum About 16 mgÆmL )1 proteins (wild-type or mutant OraSE- K629M) and 3 l M PLP in 10 m M Tris/Cl buffer, pH 9.0, were dialyzed in the dark at 4 °C, against 10 m M Tris/Cl buffer, pH 9.0, containing 3 l M PLP for 24 h, by which time equilibrium had been reached. Sepctra were recorded using an Amersham Bioscience U2100 spectrophotometer; a sample o f t he dialysis buffer was used to subtract out the contribution of unbound P LP from the s pectra of proteins. Results The expression of poraSE was first carried out at 37 °Cwith a shaking speed of 180 r.p.m. It is w orth noting t hat, alone, OraS protein can be express ed i n a soluble form. However, the OraE and OraS proteins were coexpressed in an insoluble form under t he same conditions. The codon usage difference between C. sticklandii and E. coli does not seem to be responsible for t his result, because the E. coli strain, Epicarian ColiÒ-Codon Plus TM (DE3)-RIL, contains extra copies of the argU, ileY ,andleuW tRNA genes. The coprecipitation of OraS and O raE might imply that (a) the apoenzyme or O raE is not properly folded; and (b) the noncovalent interaction between these two subunits is strong enough to result i n the coprecipitation of OraS. In many instances, t he folding of the desired e xpressed protein can be improved at lower induction temperatur es [8–10]. As shown in Fig. 1 , the solubility of the overexpressed OraS and O raE i ncreases with decreasing IPTG ind uction temperature. When the incubator shaking speed reduced from 180 to 50 r .p.m., no significant difference in the expressed protein solubility can be observed (data not shown). The protocol described above gave good expression of the ora S and oraE genes. Approximately 1 5 mg of purified protein was obtained per litre of culture. A purification method based on chromatography on Q-Sepharose ion- Fig. 1. The over-expres sion o f or aS and oraE at diffe rent temperatures. (A) Supernatant fraction. (B) Prec ipitation fraction . L ane 1, marker; lane 2, 37 °C; lane 3, 30 °C; lane 4, 25 °C; lane 5, 20 °C. Ó FEBS 2004 D -Ornithine aminomutase from C. sticklandii (Eur. J. Biochem. 271) 4295 exchange and P henyl-Sepharose hydrophobic interaction matrixes was developed. In both purification steps, OraS and OraE eluted during t he end of t he run in a well-resolved broad peak, resulting i n protein that was nearly homogen- eous (Fig. 2). This method of preparation proved very reproducible, and purified enzyme could be stored in concentrated solution in the presence of 50% glycerol for several months, frozen at )80 °C. A lysine residue is thought to be involved in PLP-binding through a Schiff base linkage. Comparison of t he deduced amino acid sequence of oraE to those of known PLP- dependent aminomutases reveals the presence of a con- served PLP-binding site, a lysine residue at position 629, at the C -terminus of the OraE p rotein [11]. The binding of PLP to D -ornithine aminomutase was investigated by equilib- rium dialysis. The proteins in the Micro Dialysis tube were equilibrated in various concentrations of PLP, and the binding of coenzyme was measured. PLP w as bound with an apparent K d of 227 ± 41 n M (Fig. 3). The production and purification methods for mutant protein, OraSE-K629M, were as described above. No significant difference in protein solubility could be found between wild-type and mutant protein at various IPTG induction and expression temperatures. Perhaps not sur- prisingly t he m utation of the L ys629 residue to Met c aused a complete loss of catalytic activity. Meanwhile the bin ding of PLP by mutant OraE-K629M was too weak to allow binding constants to be determined with any accuracy, as shown by the equilibrium dialysis experiment. The ultra- violet–visible spectrum of wild-type and mutant enzyme is shown in F ig. 4. The presence of an absorption maximum at 420 nm suggests that D -ornithine aminomutase, as is the case with other pyridoxal 5 ¢-phosphate dependent enzymes, binds pyridoxal 5 ¢-phosphate via an azomethine link between the formyl group of the c ofactor and the amino group of a protein residue. In contrast, the absence of absorption maximum at 420 nm of the mutant enzyme spectrum directly demonstrates that the Lys629 residue is responsible for the binding of PLP in D -ornithine amino- mutase (Fig. 4). High substrate specificity i s a common f eature for most AdoCbl-dependent mutases. However, alternative s ub- strates exit in the case of B 12 -dependent glutamate mutase and lysine aminomutase [12,13]. The e nzymatic activity of D -ornithine aminomutase to four substrate analogues, 1,4-diaminobutane, 2,4-diamino-n-butyric acid, 4-amino- pentanoic acid, and 2,5-diaminopentanol, was als o exami- ned i n this study. Our results show that n one of them could be catalyzed by the enzyme. Moreover, only 2,4-diamino- n-butyric acid is able to behave as a competitive inhibitor o f theenzymewithaK i of 96 ± 14 l M as measured by photometric assay. The other three analogues showed neither inhibitory potential nor suggestion of cleavage of the cobalt–carbon bond of AdoCbl (H P. Chen, unpub- lished results). These results suggest that the substrate specificity of D -ornithine aminomutase is strict. Discussion The genes encoding D -ornithine aminomutase, oraE and oraS, are adjacent on the clostridial chromosome. They Fig. 2. SDS/PAGE results of samples taken after each step in the purification of t he recombinant enzyme. Purification of OraSE (20% gel). Lane 1, m arker; lane 2, c rude ce ll e xtract b efore I PTG i nduction; lane 3, crude cel l extract after IPTG i nduction; lane 4, supernatant after cell disruption by sonication; lane 5, pooled fractions after Q-Sepharose HP chromatography; lane 6, p ooled fractions after Phenyl-Sepharose HP hydrophobic interaction chromatography. Fig. 3. Binding of PLP to recombinant D -ornithine aminomutase measured by equilibrium dialysis. Fig. 4. UV–visible spe ctrum of wild-type and mutant D -ornithine amino- mutase. The maximal absorption at 420 nm of indic ated that pyridoxal 5¢-phosphate is bo und to the wild-type en zyme. 4296 H P. Chen et al.(Eur. J. Biochem. 271) Ó FEBS 2004 share overlapping start and stop codons which m ight lead to transcription coupling so as to produce equal amounts of the two proteins [2]. In the open reading frames for the oraS and oraE genes, an E. coli ribosome-binding site is located upstream of the initiation codon of oraS and a clostridial ribosome-binding site on oraE. Although the different prokaryotic Shine–Dalgarno s equences might have differ ent affinities for ribosomes, both oraS and oraE genes are successfully overexpressed (Fig. 5). The strong interaction between OraS and OraE was first reported by Barker & Stadtman [3]. OraS shows no significant homology to other proteins in the SWISS- PROT database. The sequence alignment results indicate that the coenzyme-binding and catalytic domains are located in the E subunit [2]. Unfortunately, varying the induction temperature a nd inducer concentration had little effect on the solubility of OraE, and any attempt to refold OraE by itself was not successful. Although the role of the S subunit remains obscure, it seems likely t hat OraS somehow interacts with OraE t o s tabilize the protein in an active conformation. Moreover, the calcu- lated isoelectric point of the E component is 9.2, whereas the S component is 5.1. This result might provide an explanation for the strong interaction between the S and E components. Previous studies have shown that it is n ecessary to include coenzyme B 12 or B 6 during the re folding of O raE and OraS in vitro [2]. Both B 12 and B 6 -binding motifs are l ocated at the C-terminal of OraE and only separated from each other by about 10 am ino a cid residues. It seems likely that i nclusion of AdoCbl or PLP during refolding might facilitate the correct folding of OraE. The d issociation constant, K d ,for PLP in D -ornithine aminomutase is 224 ± 41 n M , indica- ting that the a poenzyme can bind it with high affinity. It is not clear whether coenzyme B 12 or B 6 plays a role in pro tein folding during in vivo translation. To examine this, a m utant protein, OraSE-K629M, which is unable to bind P LP, was constructed and produced in E. coli. As the bacterial strain used to express protein is unable to synthesize cobalamin by itself, neither AdoCbl nor PLP could be involved in the mutant protein folding process during in vivo translation. However, no significant difference in protein solubility could be found between wild-type a nd mutant protein. This result indicates that (a) the recombinant protein folding pathway during in vivo transl ation i n E. coli is different from the in vitro refolding process, and (b) the a ssociation o f the S and E s ubunit is importan t for D -ornithine aminomutase to maintain an active conformation in both cases. In summary, we have successfully constructed, overexpressed, and purified the recombinant D -ornithine aminomutase. Future work in our group will focus on the determination o f the quaternary structure of the holoenzyme and th e catalytic mechanism of this 1,2-rearrangement reaction. Acknowledgements This work was supported by grant NSC 91-2320-B032-001 from the National Science Council, Taiwan, Republic of China (to H P. Chen). References 1. Somack, R . & Costilow, R.N. ( 1973) Puri fication a nd properties of a pyridoxal phosphate and coenzyme B12 dependent D -ornithine 5,4-aminomutase. Bi ochemistry 12, 2 597–2604. 2. Chen, H.P., Wu, S.H., Lin, Y.L., Chen, C.M. & Tsay, S.S. (2001) Cloning, sequencing, heterologous expression, purification, and characterization of adenosylcobalamin-dependent D -ornithine aminomutase from Clostridium sticklandii. J. Biol. Chem. 276, 44744–44750. 3. Baker, J.J. & Stadtm an, T.C. ( 1984) Aminomu tase. In B 12 (Dolphin, D ., ed.), Vol. 2, pp. 203–231. J o hn Wiley & Sons, Inc, New York. 4. Saito, H. & Miura, K. (1963) Preparation of t ransforming deoxy- ribonucleic acid b y phenol treatment. Bi ochem. Biophys. A cta 72, 619–626. 5. Higuchi, R. (1990) Recombinant PCR. In PCR protocols. A Guide to Methods and Application (Innis, M .A., Gelfand, D.H., Sninsky, J.J. & W hite, T .J., eds), pp. 177–183. Academic Press I nc, S an Diego, CA, USA. 6. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing t he principle of p rotein-dye binding. Anal. B iochem. 72, 248–254. 7. Tsuda, Y. & F riedmann, H.C. ( 1970) Ornithine metabolism b y Clostridium sticklandii. Oxidation of ornithine to 2-amino-4- ketopentanoic acid via 2,4-diaminopentanoic acid; participation of B12 coenzyme, pyridoxal phosphate, and p yridine nucleotide. J. Bi ol. Chem. 245, 5914–5926. 8. Schein, C .H. (1989) Production of soluble recombinant pr oteins in bacteria. Biotechnology ( N.Y.) 7, 1141–1149. 9. Cabilly, S. (1989) Growth at sub-optimal temperatures allows the production of functional, antigen-binding Fab fragments in Escherichia coli. Gene 85, 553–557. 10. Totsuka, A. & Fukazawa, C. (1993) Expre ssion and m utation of soybean beta-amylase in Escherichia coli. Eur. J. Biochem. 214, 787–794. 11. Tang, K.H., Harms, A. & Frey, P.A. (2002) Identification of a novel pyridoxal 5¢-phosphate binding site i n a denosylcobalamin- dependent lysin e 5,6-amin omutase f ro m Porphyromonas gingiva- lis. Biochemistry 41 , 8767–8776. 12. Roymoulik, I., Moon, M., Dunham, W.R., Ballou, D.P. & Marsh, E.N.G. (2000) Rearrangement of L -2-hydroxyglutarate to L -threo-3-methylmalate catalyzed by adenosylcob alamin-depen - dent glutamate m utase. Biochemistry 39 , 10340–10346. 13. Tang, K.H., Casarez, A.D., W u, W. & Frey, P.A. (2003) Kinetic and biochemical analysis of the mechanism of action of lysine 5,6-aminomutase. Arch. Biochem. B iophys. 418, 4 9–54. Fig. 5. The plasmid construction map of poraSE. RBS, Ribosome binding site. Ó FEBS 2004 D -Ornithine aminomutase from C. sticklandii (Eur. J. Biochem. 271) 4297 . time is required. Instead of expressing the oraE and oraS genes separately, the DNA fragment containing both genes was cloned i nto the same expression vector under the control of the T7 promoter,. Comparison of t he deduced amino acid sequence of oraE to those of known PLP- dependent aminomutases reveals the presence of a con- served PLP-binding site, a lysine residue at position 629, at the. the mutant protein were the same as those of the wild-type. Protein determination and enzyme assay Protein concentrations were determined by the method of Bradford using bovine serum albumin as standard