isolation of mrnas encoding peroxisomal proteins from yeast using a combined cell fractionation and affinity purification procedure

Báo cáo khoa học: Molecular cloning, expression and characterization of cDNA encoding cis-prenyltransferases from Hevea brasiliensis A key factor participating in natural rubber biosynthesis pdf

Ngày tải lên : 07/03/2014, 21:20

... (5¢-GCAAATGCAACTGGA AGCGG-3¢) and A1 (5¢-ACAGCCTGCTAGCAAAGA GG-3¢) for ampliﬁcation of HRT1, and primers S2 (5¢-GAAGAATCCTCTAAGGATAA-3¢) and A2 (5¢-TA CAAGGATTAATCCCTTGC-3¢) for ampliﬁcation of ... template and then sequenced Finally, two cDNAs were obtained and designated HRT1 and HRT2, respectively DNA sequencing analysis Materials and methods Plant materials and RNA isolation Latex and various ... AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), BAB92024 and AAM92882 (AAM92886) (submitted to GenbankTM and DDBJ by Coldren et al and Sando et al respectively)...

10
516
0

Báo cáo khoa học: Comparison of functional properties of two fungal antifreeze proteins from Antarctomyces psychrotrophicus and Typhula ishikariensis ppt

Ngày tải lên : 22/03/2014, 21:20

... compilation ª 2009 FEBS N Xiao et al A Antifreeze protein from ascomycetous fungus AnpAFP TisAFP AnpAFP B A. Acid Asx 10 20 AGLDLGAASX FGALAFEGVA AGPSAVPLGT AGNYVI LAST AGPTAVPLGT AGNYAI LAST AGPTAVPLGT ... Japan) The internal transcribed spacer (ITS) region of genomic recombinant DNA was ampliﬁed using the primer pairs ITS1-F (5¢-CTTGGTCATTTAGAGGAAGTAA) and ITS4-B (5¢-CAGGAGACTTGTACACGGTCCAG), according ... indicative of the binding of these hyperactive AFPs to both pyramidal and basal planes of a seed hexagonal ice crystal Comparison of TH activity between AnpAFP and TisAFP8 Figure 5A shows the results of...

10
433
0

Báo cáo y học: " Rapid isolation of mycoviral double-stranded RNA from Botrytis cinerea and Saccharomyces cerevisiae" pot

Ngày tải lên : 11/08/2014, 21:21

... and a yeast, Saccharomyces cerevisiae Besides being a rapid method, it allows the use of small amounts of yeasts or micelia as initial material to obtain a sufficient quantity of dsRNA that can ... high quality dsRNA, free of DNA and ssRNA, and it can be applied to isolate dsRNA from any type of fungus or any biological sample that contains dsRNA Methods Fungal strains and culture conditions ... Three sharp bands that correspond to Figure Agarose gel electrophoresis of dsRNA from Saccharomyces cerevisiae 1743 (A) Lane St, Lambda DNA/EcoRI + HindIII marker; lane 1, dsRNAs from Saccharomyces...

7
319
0

Báo cáo khoa học: "Optimization of the Agar-gel Method for Isolation of Migrating Ascaris suum Larvae From the Liver and Lungs of Pigs" pptx

Ngày tải lên : 12/08/2014, 15:20

... present study was to optimize and standardize the agar-gel method for fast and reliable isolation of migrating A suum larvae from pig livers and lungs Materials and methods Experimental pigs Twenty-four ... compare the sedimentations of lung larvae in 250 Table Impact of sedimentation time in conical beakers and cylinder glasses, and of addition of gentamycin on numbers of A suum larvae (mean±SD) ... Furthermore, repeated examinations of aspirated supernatants of both the incubation jars and the conical beakers only revealed a loss of 0-2% of the total numbers of recovered larvae, indicating that the...

8
337
0

Identification of Publications on Disordered Proteins from PubMed

Ngày tải lên : 24/08/2014, 11:31

... beyond the scope of the law I agree to indemnify and save harmless Purdue University from any and all claims that may be asserted or that may arise from any copyright violation Sirisha Peyyeti ... idea on a set of 100 abstracts from DisProt and we could identify the abstracts related to disordered proteins with 87% accuracy We repeated the test on a set of 100 abstracts from PubMed and had ... consuming and resource intensive manual task to be abreast w i t h the publications and to read them to identify the most relevant abstracts Having an automated method to estimate relevance of a PubMed...

61
280
0

Báo cáo khoa học: DNA-binding and transcription characteristics of three cloned sigma factors from mustard (Sinapis alba L.) suggest overlapping and distinct roles in plastid gene expression doc

Ngày tải lên : 31/03/2014, 07:20

... the PCR primers 5¢-CACA CAAGGGGTTACAAGTTCTCCACG-3¢ and 5¢-ACCA GCCAATTGGTTCCAAAAATCTATCT-3¢ and ligation into pQE31 (Qiagen) Following transformation of M15, the recombinant proteins were puriﬁed ... H., Kanamaru, K., Fujiwara, M., Tanaka, K., Takahashi, H., Unno, K., Sato, S., Tabata, S., Hayashi, H., Miyake, C., Yokota, A & Shibata, D (2000) Chloroplast development in Arabidopsis thaliana ... putative plastid RNA polymerase o factors in Arabidopsis thaliana FEBS Lett 481, 47–52 37 Tanaka, K., Tozawa, Y., Mochizuki, N., Shinozaki, K., Nagatani, A. , Wakasa, K & Takahashi, H (1997) Characterization...

13
304
0

Báo cáo y học: "Rapid generation of an anthrax immunotherapeutic from goats using a novel non-toxic muramyl dipeptide adjuvant." docx

Ngày tải lên : 11/08/2014, 10:23

... Journal of Immune Based Therapies and Vaccines 2007, 5:11 Background Bacillus anthracis, the causative agent of anthrax, has been the focus of much research and attention following the release of ... Kit, an MTT-based assay Briefly, 10 µl of MTT dye was added to cells and incubated for 15 h at 37°C and 5% CO2 100 µl of solubilization solution was added to each well after removal of media, and ... cytotoxicity J77 4A. 1 cells were treated with 50 ng (~2.9 nM) LeTx and varying concentrations of goat anti-sera Cell viability determined by an MTT-based assay A Anti-PA83 IgG Data shown are the average ±...

8
312
0

Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

Ngày tải lên : 11/08/2014, 21:21

... ("mink/84”) and A/ chicken/Germany/N/49 ("chicken/49”) were amplified using the primers NS1Kpn 5’ (5’-ATTCGGTACCAGCAAAAGCAGGGTGACAAAG-3’) and NS1XhoI 3’ (5’TACCCTCGATAGAAACAAGGGTGTTTTTTAT-3’) Twenty-five ... RNA was DNAse-treated and quantified and purity measured at OD260/280 using a Nanodrop ND1000 (Nanodrop Tec., Wilmington, DA, USA) All RNA samples had an OD260/280 ratio in water between 1.9 and ... was performed using the following primer pairs specific to human IFN-b and b-actin mRNA: IFN-b forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’, resulting a...

8
348
0

Báo cáo y học: " Isolation of suppressor genes that restore retrovirus susceptibility to a virus-resistant cell line" potx

Ngày tải lên : 13/08/2014, 13:20

... RC-2 mRNA preparations by standard RT-PCR methods using primers spanning the entire ORF (sequences: 5'ATATAGCTTAAGGCCACCATGGCAGACGATATTGATAT3' and 5'-ATATAGGCGGCCGCTCATCGTCTACTTGGAAC-3'), and cloned ... Ra t2 R4 -7 Northern blot of CAPER mRNAs 5.0 kb CAPER 2.0 kb Figure mutant R4-7 cell lines Northern blot analysis of mRNAs in parental Rat2 and Northern blot analysis of mRNAs in parental Rat2 ... independently of any of the cDNAs they carried, or as a result of a cDNA that was not recovered from the PCR amplified DNA products Characterization of biologically active suppressor cDNAs The pB1-11 and...

10
211
0

Influence of Birth Weight on Mortality From Infectious Diseases: A Case-Control Study

Ngày tải lên : 23/05/2016, 10:05

... maternal age and smoking habits, housing, crowding, water and sanitation vanables, antenatal cane, and type of delivery Initial tabulations were conducted to assess which variables were associated ... infections, availability model, interval, sex, of piped in addition availability maternal age water ARTICLES Downloaded from pediatrics.aappublications.org at Viet Nam:AAP Sponsored on March 3, 2013 ... weight and infectious disease mortality POPULATION AND METHODS The study was carried out in the metropolitan areas of Porto Alegre and Pelotas These cities have a total population of 2.5 million and...

7
116
0

Insights into solid phase characteristics and release of heavy metals and arsenic from industrial sludge via combined chemical, mineralogical, and microanalysis

Ngày tải lên : 18/08/2016, 15:47

... 3.0±0.5 NA NA NA NA IR (%) 8.5±0.9 9.2±0.7 14.0±1.3 NA NA NA NA pH (H2O) 7.7±0.3 7.16±0.3 7.82±0.3 NA NA NA NA Table Chemical characteristics of samples SI1, SI2, and SE (mean±standard deviation of ... Leaching characteristics of solid earthy and stony building and waste materials—leaching tests—determination of the leaching of components from powder and granular materials with the cascade leaching ... (Table 2) Chemical data related to samples SI1, SI2, and SE and a comparison with published data from electroplating sludges (Sophia and Swaminathan 2005; Le 2007; Wu et al 2012; Huang et al...

14
339
0

Báo cáo khoa học: Identiﬁcation of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Ngày tải lên : 17/03/2014, 10:20

... that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase of thermoresistance of cells Thus, SA may ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata,...

8
470
0

báo cáo hóa học:" An in vivo evaluation of bone response to three implant surfaces using a rabbit intramedullary rod model" doc

Ngày tải lên : 20/06/2014, 04:20

... osseointegration of greater than 15% among groups with a power greater than 80% and an alpha of 0.05, assuming a standard deviation of up to 11% Results from four quadrants were averaged to obtain the ... unrestricted cage activity, and food and water ad libitum Temperature was maintained at 24°C and humidity at 70% All rabbits tolerated the anesthesia and surgical procedure uneventfully Recovery was quick ... implant surfaces P = plasma-sprayed titanium (mean Ra = 27 microns); PHA = plasma-sprayed titanium with plasma-sprayed hydroxyapatite coating (mean Ra = 17 microns); CHA = chemical-textured titanium...

8
413
0

Báo cáo toán học: " Measurement of beta amyloid peptides in specific cells using a photo thin-film transistor" pot

Ngày tải lên : 20/06/2014, 20:20

... idea of the whole experiment and supported the mathematical approach and the organization of this article All authors read and approved the final manuscript Acknowledgements This research was ... phosphate-buffered saline, laminin as an extracellular matrix was coated on the channel, and the channel was kept overnight in an incubator at 37°C We prepared HeLa cells for the expression of A ... risk of AD According to the established hypotheses on AD during the past decade, the extracellular deposits of beta-amyloid [A ] peptides forming plaques and the intracellular neurofibrillary tangles...

12
690
0

Báo cáo hóa học: " Fabrication of functional micro- and nanoneedle electrodes using a carbon nanotube template and electrodeposition" ppt

Ngày tải lên : 21/06/2014, 04:20

... nanoneedle (a) Carbon nanotube nanoneedle before Au nanoparticle coating and (b) after Au nanoparticle coating (scale bar: μm) (c) Magnified view of Au nanoparticle-coated nanoneedle (scale bar: ... interest factors to most biologists because changes in intracellular pH affect the ionization state of all weak acids and weak bases and thus potentially affect a wide array of biological processes ... real applications of micro- and nanoneedles, the needle must be attached to a supporting structure such as an AFM tip or a metal tip CNT can be easily attached to the end of a metal tip or an AFM...

6
360
0

Báo cáo hóa học: " On the Chemical Origin of the Gap Bowing in (GaAs)12xGe2x Alloys: A Combined DFT–QSGW Stud" pptx

Ngày tải lên : 22/06/2014, 00:20

... the lattice parameter of the alloys, the Vegard’s law: a GaAsÞ1ÀxGe2x ¼xaGe þð1ÀxÞaGaAs ð2Þ where a( GaAs)12xGe2x, aGe, aGaAs are the lattice parameters of the ﬁnal alloy and its components, respectively, ... thermodynamic stability of these alloys was calculated as the DE products–reactants of the equation: GaAs þ 2xGe ! ðGaAsÞ1Àx Ge2x þ xGaAs: ð1Þ It is expected that LDA and GGA predict reasonable heats ... have also made a preliminary calculation of the stability of isolated Ga acceptors (GaGe) and As donors (AsGe) versus that of the substitutional molecular GaAsGe2 in Ge pure host (a supercell of...

9
324
0

Báo cáo hóa học: " Analysis of a Combined Antenna Arrays and Reverse-Link Synchronous DS-CDMA System over Multipath Rician Fading Channels" doc

Ngày tải lên : 23/06/2014, 00:20

... paper, we consider that the array geometry, which is the parameter of the antenna aperture gain, is a uniform linear array (ULA) of M identical sensors All signals from MS arrive at the BS AA ... , θl(k) , and τl(k) are phase shift, mean angle of l arrival (AOA), and the propagation delay, respectively, of the lth faded path of the kth user Assuming Rayleigh fading, the probability density ... and are the average received power and the phase, respectively, of the lth path associated of the kth user n(t) is an M ×1 spatially and temporally white Gaussian noise vector with a zero mean...

10
236
0

Báo cáo khoa học: "The study of tree fine root distribution and dynamics using a combined trench and observation window method" doc

Ngày tải lên : 09/08/2014, 02:21

... growth began in March and reached a peak in early July Growth ceased in August and a second growth flush appeared from September to December squares and showed a pattern similar to that observed ... ramifications has been referred to as &dquo;root growth capacity&dquo; by This suggests that elongation of the primary axes was followed by ramification and elongation of several secondary axes, and ... physical variables (Goulard et al., 1987) F(X) is considered as a random intrinsic function, thus, for any vector h, the mathematical expectancy and variance of the increment F(X + h) - F(X) are of...

8
266
0

Báo cáo lâm nghiệp: "Hourly and daily variations of xylem sapflow in sweet chestnut coppices using a thermal measurement method" ppsx

Ngày tải lên : 09/08/2014, 04:20

... reveals an apparent limit to forest transpiration Daily variations of sapflow F and Ep are shown in Fig Because of a particularly wet season, no water stress was found during 1987 The maximum transpiration ... Figs and show an influence of net radiation on sapflow variations With a daily time step, transpiration T is about equal to sapflow, as was shown by mea- were a = = = = surements of weight loss and ... here enabled continuous measurements of forest transpiration throughout the entire growing season These results will be compared to a soilwater balance approach using a neutron probe and rainfall...

3
198
0