identification of selective functional signaling pathways in transformed cells and identification of a new splice variant with growth survival activity

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Ngày tải lên : 07/03/2014, 21:20
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... Carroll PM, Allard JD & Simon MA (2000) MASK, a large ankyrin repeat and KH domain-containing protein involved in Drosophila receptor tyrosine kinase signaling Development 129, 71–82 Mahalingam...
  • 12
  • 561
  • 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Ngày tải lên : 22/02/2014, 07:20
... with RNAse A/ H protected fragments were separated by PAGE and visualized by autoradiography RACE The cDNA for CYP11B2 of the guinea pig was amplified and cloned using a MarathonÒ cDNA Amplification ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit ... NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific...
  • 9
  • 671
  • 0
Feasibility investigation and combustion enhancement of a new burner functioning with pulverized solid olive waste

Feasibility investigation and combustion enhancement of a new burner functioning with pulverized solid olive waste

Ngày tải lên : 09/09/2015, 10:32
... main flame in ambient air, two types of pilot flame are used: a central premixed flame of methane/oxygen and an annular diffusion flame of methane A preheater is inserted in the inlet air line ... primary excess air of 70% and a secondary air mass flow of 40L/min Abu-Qudais and Okasha [5] have realized an important experimental study of the direct combustion of a diesel and olive cake ... et al [14] and Gani and Naruse [15] the behavior of pyrolysis and the combustion of biomass have a large similarity Moreover, kinetic parameters during devolatilization step and char oxidation...
  • 10
  • 245
  • 0
Báo cáo khoa học: Role of Ca2+/calmodulin regulated signaling pathways in chemoattractant induced neutrophil effector functions Comparison with the role of phosphotidylinositol-3 kinase ppt

Báo cáo khoa học: Role of Ca2+/calmodulin regulated signaling pathways in chemoattractant induced neutrophil effector functions Comparison with the role of phosphotidylinositol-3 kinase ppt

Ngày tải lên : 08/03/2014, 10:20
... demonstrated a dependence on both calmodulin and PtdIns3K activity These data demonstrate critical roles for changes in [Ca2+]i and calmodulin regulated signaling pathways in chemoattractant induced ... apoptotic cells, was detected by FACS analysis (FACSvantage, Becton Dickinson) RESULTS Comparison of intracellular signaling pathways activated by chemoattractants and elevated [Ca2+]i Stimulation of ... are also indications that phosphorylation of GSK- 3a can be mediated by protein kinase A or by a pathway that involves the mammalian target of rapamycin [43,44] In guinea pig neutrophils it has...
  • 10
  • 537
  • 0
Báo cáo sinh học: " The involvement of survival signaling pathways in rubella-virus induced apoptosis" ppt

Báo cáo sinh học: " The involvement of survival signaling pathways in rubella-virus induced apoptosis" ppt

Ngày tải lên : 18/06/2014, 22:20
... JL, Yin P, Otterness DM, Karnitz LM, Abraham RT: A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed ... signaling events that control the balance between cell death and cell survival Eukaryotic cells contain a large number of mitogen activated protein kinase (MAPK) signaling cascades that are activated ... http://www.virologyj.com/content/2/1/1 induction of apoptosis Apoptosis was measured in RVinfected cells by caspase activity and cell viability assays, DNA fragmentation analysis, and trypan blue exclusion staining Involvement of...
  • 12
  • 357
  • 0
Báo cáo y học: "Participation of the PI-3K/Akt-NF-κB signaling pathways in hypoxia-induced mitogenic factor-stimulated Flk-1 " pot

Báo cáo y học: "Participation of the PI-3K/Akt-NF-κB signaling pathways in hypoxia-induced mitogenic factor-stimulated Flk-1 " pot

Ngày tải lên : 12/08/2014, 16:20
... 3095 and 3421; for mouse VEGF 5'-TGGAT GTCTACCAGCGAAGC-3' and 5'-ACAAGGCTCACAGTGATTTT-3' amplifying a 308-bp fragment between positions 522 and 829; for mouse GAPDH, 5'GCCAAGGTCATCCATGA CAACTTTGG-3' ... as follows: forward mutation 5'-TATCGATAGGTACCGGACGCACCGAGTCCCCACCCCT, forward deletion 5'-TATCGATAGGTACCGGACGCACCCCACCCCT, reverse 5'TGCGTC CGGTACCTATCGATAGAG AAATGTT The DNA constructs were ... co-transfected with pNFκB-luc, dominant-negative mutants of NF-κB pathway and pRL-TK, with or without stimulation of HIMF protein for various periods as indicated ( 6A) Dual-luciferase assay indicated...
  • 14
  • 221
  • 0
Báo cáo y học: "Singular value decomposition-based regression identifies activation of endogenous signaling pathways in vivo" ppsx

Báo cáo y học: "Singular value decomposition-based regression identifies activation of endogenous signaling pathways in vivo" ppsx

Ngày tải lên : 14/08/2014, 21:20
... mammary gland A TGFβ2 A TGFβ signature detects TGFβ pathway activation following short-term Ras induction in the mammary gland (a) Mapping of mammary glands expressing activated Ras for increasing ... Ras signature accurately and quantitatively predicts Ras An in vivo-derived Ras signature accurately and quantitatively predicts Ras pathway activation (a) PCA demonstrating separation of mammary ... pathway activation in a complex system, such as a tumor Chronic Ras activation in the mammary gland leads to the formation of adenocarcinomas with a latency of 14 weeks Given our finding that...
  • 11
  • 262
  • 0
Trends in Cell Signaling Pathways in Neuronal Fate Decision Edited by Sabine Wislet-Gendebien potx

Trends in Cell Signaling Pathways in Neuronal Fate Decision Edited by Sabine Wislet-Gendebien potx

Ngày tải lên : 16/03/2014, 20:21
... in Cell Signaling Pathways in Neuronal Fate Decision Figure Confocal images of the TGF-β ligands, receptors and signaling proteins in the SVZ and DG in the in jured adult mice brain Double and ... receptor I (TβRI/ALK5) Activation of TβRI by transphosphorylation activates it, initiating downstream signaling [21] Canonical signaling Trends in Cell Signaling Pathways in Neuronal Fate Decision ... Regions After Brain Injury Sonia Villapol, Trevor T Logan and Aviva J Symes Chapter Insulin/IGF-Signalling in Embryonic and Adult Neural Proliferation and Differentiation in the Mammalian Central...
  • 366
  • 413
  • 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

Ngày tải lên : 20/06/2014, 04:20
... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of ... fracture site, allowing vascular regeneration and eliminating further damage to the peripheral and intramedullary blood supply which occurs during plate and screw fixation and intramedullary nailing ... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and...
  • 4
  • 402
  • 0
Báo cáo khoa học: "Identification and characterization of a new E3 ubiquitin ligase in white spot syndrome virus involved in virus latency" pot

Báo cáo khoa học: "Identification and characterization of a new E3 ubiquitin ligase in white spot syndrome virus involved in virus latency" pot

Ngày tải lên : 12/08/2014, 04:21
... SD plates (A) and -Leu-Trp-His-Ade plates with x-α-gal (B) 1, yeast cotransformed with pGBK-403 and pGAD-PPs; 2, yeast cotransformed with pGBK-403 and pGAD; 3, yeast cotransformed with pGBK and ... signaling pathways involved in latency regulation [25] As a RINGcontaining E3 ubiquitin ligase, WSSV403 is able to interact with its substrates besides E2 conjugating enzymes and to mediate degradation ... can interact with a shrimp protein phosphatase WSSV403 can interact with a shrimp protein phosphatase WSSV403 was found to interact with shrimp PPs in yeast two hybrid Cotransformed yeast was...
  • 8
  • 387
  • 0
Báo cáo y học: " Distinct expression profiles of TGF-β1 signaling mediators in pathogenic SIVmac and non-pathogenic SIVagm infections" pot

Báo cáo y học: " Distinct expression profiles of TGF-β1 signaling mediators in pathogenic SIVmac and non-pathogenic SIVagm infections" pot

Ngày tải lên : 13/08/2014, 09:20
... Animals at Institut Pasteur, Paris, France and the Committee for Ethics and Animal Experimentation at the International School of Science and Veterinary Medicine in Dakar, Senegal, reviewed and ... Kasper LH, Rachinel N, Minns LA, Luangsay S, Vandewalle A, Buzoni-Gatel D: Intestinal intraepithelial lymphocytes prevent pathogen-driven inflammation and regulate the Smad/T-bet pathway of lamina ... chronic infection [8] Our recent data indicate that AGMs are capable of controling T cell activation rapidly after SIVagm infection This control was associated with the immediate induction of an anti-inflammatory...
  • 6
  • 215
  • 0
Identification of a new tumor suppressor pathway modulating rapamycin sensitivity in colorectal cancer

Identification of a new tumor suppressor pathway modulating rapamycin sensitivity in colorectal cancer

Ngày tải lên : 09/09/2015, 18:52
... 3' ATGGAGGAGGACATTGATACC 3' ACATTGTATTCACCCCTACG 3' ATACGCCAGTGACGACCAGAGC 3' TAGCCCACACCATGAAAGCG 3' ATGGGAAGGTGAAGGTCGG 3' AAGACGCCAGTGGACTCCACGA 3' GTGGGGCGCCCCAGGCACCA 3' CTCCTTAATGTCACGCACGATTTC ... 3' AGTGGGCTGCGCGTCTCATTTTC 3' AAGGGTTCGTGGAGCATGGG 3' ATGGTTGCAACTGGCAGTTTG 3' AGGACCTTTGAGCAACCAAG 3' AACGGCAGCGCCTTCTTGCT 3' GGCCCATGACCAGATCAGCA 3' ATGAGCTGCACCAGAATGATCC 3' TTGGTTGTGTGAGCACTTCC ... GAPDH ACTIN TCGGCCGCGAGTACGACTA 3' TCTTGTAGCCCACGTTGTGG 3' CCCTGCTTCAGGCGTCTGTA 3' CATGCCATCTTCATCCACCT 3' GACCCGTGAGACAAAGAAGC 3' GCCCTCACACTTGACCAGTT 3' GAACTGCTATCGCATGGTCA 3' AACGTCTCCTGTGAGGATGG...
  • 200
  • 331
  • 0
The study of interactions of transmembrane receptors and intracellular signaling proteins in live cells by fluorescence correlation and cross correlation spectroscopy

The study of interactions of transmembrane receptors and intracellular signaling proteins in live cells by fluorescence correlation and cross correlation spectroscopy

Ngày tải lên : 14/09/2015, 14:25
... disease and cardiovascular diseases (2-7) Thus it is of fundamental importance to investigate cellular signaling pathways and abnormal activations of signaling proteins, which may help in finding ... more and more cellular signaling pathways have been identified, it becomes clear that signaling pathways not exist as linear pathways, but are organized as complex signaling networks [1] The interconnection ... epitope tag heparin-binding epidermal growth factor protein kinase C-related kinase homology region IQ motif containing GTPase activating protein infrared insulin receptor tyrosine kinase substrate...
  • 173
  • 360
  • 0
Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Ngày tải lên : 05/10/2015, 22:32
... by intracellular Ca2+ increase after NMDAR activation during neuronal activity will affect downstream signaling proteins and pathways, including MAPK pathway, cAMP-responsive element-binding ... et al., 1996) N- methyl-D-aspartate (NMDA) induced a rapid and transient Ng oxidation in rat brain slices suggesting that Ng redox plays a role in NMDA- mediated signaling pathways and that there ... plays important roles in intracellular signaling So far in mammals the characterized MAPK pathways can be divided into three main superfamilies, 1) Extracellular signal-regulated kinase, ERK1 and...
  • 129
  • 324
  • 0
Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Ngày tải lên : 06/10/2015, 20:35
... by intracellular Ca2+ increase after NMDAR activation during neuronal activity will affect downstream signaling proteins and pathways, including MAPK pathway, cAMP-responsive element-binding ... et al., 1996) N- methyl-D-aspartate (NMDA) induced a rapid and transient Ng oxidation in rat brain slices suggesting that Ng redox plays a role in NMDA- mediated signaling pathways and that there ... plays important roles in intracellular signaling So far in mammals the characterized MAPK pathways can be divided into three main superfamilies, 1) Extracellular signal-regulated kinase, ERK1 and...
  • 129
  • 455
  • 0
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"

Ngày tải lên : 25/10/2012, 10:02
... Implementation of a new emergency medical communication centre organization in Finland - an evaluation, with performance indicators Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2011 ... organization reform in Finland Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area of southern Finland where the EMCC covers about ... calls in Helsinki, the capital of Finland [5] EMCC organization and EMD in Finland - before and now There used to be 45 municipality-based centers taking emergency calls in Finland There were no official...
  • 5
  • 495
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Ngày tải lên : 18/02/2014, 14:20
... GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG...
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Ngày tải lên : 18/02/2014, 18:20
... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... used were: 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for ... 5¢-CGGTTCAGGTACTCAGT CATCCA-3¢ (antisense) for Bcl-2; and 5¢-ACGGGAGAT GACAATGGAGAAAT-3¢ (sense) and 5¢-CATGGGTAG CAGCTCCTTCTTC-3¢ (antisense) for Apaf-1 Total RNA was extracted from cultured cells using...
  • 12
  • 613
  • 0

Xem thêm