goods rights and other resources controlled by the company as a result of past events and from which future economic benefits are expected to flow to the company

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Smoking and reproduction: The oviduct as a target of cigarette smoke ppt

Ngày tải lên : 05/03/2014, 17:20
... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... (CAM) assay that measures growth of the CAM and chick embryo [188,189] In the CAM assay, many pyridines and pyrazines inhibited CAM growth dramatically, even at very low doses, and in some cases ... on the species, and these are separated from each other by an extracellular matrix, which plays an important role in the pick-up process The structure and distribution of the extracellular matrix...
  • 17
  • 733
  • 0
báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx

báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx

Ngày tải lên : 11/08/2014, 02:22
... and their channels as a result of past tuberculosis, leading to a blockage of lymphatic drainage and resulting in vulval elephantiasis Conclusions Vulval elephantiasis is very rare, and vulval ... seroma formation under the skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed by ... Kogan B, Carlson JA: Granulomatous lymphangitis of the scrotum and penis Report of a case and review of the literature of genital swelling with sarcoidal granulomatous inflammation J Cutan Pathol...
  • 5
  • 457
  • 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Ngày tải lên : 17/03/2014, 23:20
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... & Terman, A (1999) The mitochondrial-lysosomal axis theory of cellular aging Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas, E & Packer, ... neurons and cardiac myocytes) for life maintenance Mitochondria are the main source of ROS formation, as well as the main target for free radical attack The accumulation of defective mitochondria within...
  • 7
  • 444
  • 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22
... a6 -rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA ... AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 ... simultaneously with antitubulin (DM 1A) and anti-actin (lanes and 2) Other samples were stained with antineurofilament protein (lanes and 4) The volume of each sample was adjusted to load a similar amount...
  • 14
  • 416
  • 0
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx

Ngày tải lên : 18/06/2014, 19:20
... feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when it meets a threshold of projected ... investigators’ savvy with respect to the needs of the market, which in turn will aid in assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program ... matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as these mechanisms are routinely...
  • 4
  • 395
  • 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt

Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt

Ngày tải lên : 19/06/2014, 15:20
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
  • 11
  • 306
  • 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf

Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf

Ngày tải lên : 19/06/2014, 15:20
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
  • 11
  • 282
  • 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt

Ngày tải lên : 20/06/2014, 03:20
... feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when it meets a threshold of projected ... investigators’ savvy with respect to the needs of the market, which in turn will aid in assessing the translational potential of ideas that are still in the percolation phase The NIH intramural program ... matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program in Bethesda as these mechanisms are routinely...
  • 4
  • 417
  • 0
Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf

Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf

Ngày tải lên : 11/08/2014, 10:23
... general anaesthesia, a midline laparotomy was performed on the patient On entering the peritoneal cavity, gross distension of the small bowel and collapse of the large bowel was identified The small ... (TLC55, Ethicon) to release the obstruction Care was taken not to compromise the lumen of the ileum The tip of the diverticulum was then dissected off the terminal ileum and the anastomosis over ... a past medical history of only hypercholesterolaemia http://www.jmedicalcasereports.com/content/1/1/8 tified, the decision was made to perform a diagnostic laparotomy and manage the patient accordingly...
  • 5
  • 311
  • 0
The Stockmarket as a Sourc of Finance

The Stockmarket as a Sourc of Finance

Ngày tải lên : 22/04/2016, 07:45
... isto use the q ratio as a measure of the expectedprofitability and cash flows as a measure of the availability of funds (iii) Even though the information-theoreticapproach assumes the prevalence ... acceleratortheoryemphasizesoutput as the principaldeterminantof capital expenditures,neoclassicaltheory emphasizescost of capital,modifiedneoclassicaltheoryemphasizescost of capital and output, cash flow theory ... instead postulates other objectives such as sales, staff, The alternative theories of investment are: accelerator, cash flow, neoclassical, modified neoclassical ,and Q Whilethe acceleratortheoryemphasizesoutput...
  • 52
  • 325
  • 0
Báo cáo y học: " Reducing ventilator-induced lung injury and other organ injury by the prone position" ppt

Báo cáo y học: " Reducing ventilator-induced lung injury and other organ injury by the prone position" ppt

Ngày tải lên : 12/08/2014, 23:23
... death in this situation One of the suggested mechanisms could be the increased systemic plasma levels of inflammatory mediators and proaptotic soluble factors such as Fas ligand [5,6,13], but ... E, Koulouras V, Kanavaros P, Doulis A, Kitsakos A, Karachaliou A, Lekka ME, et al.: Lung and ‘end organ’ injury due to mechanical ventilation in animals: comparison between the prone and supine ... MV and the protective role of the body position seem an exciting area for further research The optimal position in an intensive care unit patient in regard to VILI remains to be defined, and...
  • 2
  • 204
  • 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Ngày tải lên : 20/02/2014, 02:21
... 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGC GTCCAGAGTACTGGTAGCCTCATCC-3¢ ... of 2C1 appears to have lost the ability to exchange ADP for ATP The specificity of ADP-binding was tested by the addition of free MgADP All TAP chains showed a 40–50% release at mM MgADP (data ... with a mixture of anti-TAP1 and anti-TAP2 serum TAP variants are indicated by pictograms (B) The results of the ATP cross-link experiment were quantified by phosphoimager Peak integrals of TAP1- and...
  • 16
  • 407
  • 0
Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx

Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx

Ngày tải lên : 10/08/2014, 10:20
... history and the echocardiographic appearance of the tumor the initial working diagnosis was papillary fibroelastoma Laboratory findings are shown in Table The patient was diagnosed with primary APS ... fibroelastoma On echocardiography papillary fibroelastoma usually arise via a pedicle from mitral valve tissue or adjacent endocardium, and have a characteristic frond-like appearance [31] A remarkable ... GR: Association of antibodies against phospholipids with heart valve disease in systemic lupus erythematosus Lancet 1990, 335:1541-4 Takayama T, Teramura M, Sakai H, Tamaki S, Okabayashi T, Kawashima...
  • 13
  • 584
  • 0
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Ngày tải lên : 13/02/2014, 05:20
... Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences ... illustrating the geographical provinces and ethnic areas from which they are derived; and archæological specimens typical of prehistoric and proto-historic culture [8]Hand in hand with the Laboratory ... monstrosities Ethnic and racial anatomy Evolution of man Comparative anatomy of man and anthropoids Simian and lemurian analogies Fossil remains of man Biology of man Changes produced by nutrition (food...
  • 28
  • 665
  • 0
Tài liệu The Financial Crisis: A Timeline of Events and Policy Actions ppt

Tài liệu The Financial Crisis: A Timeline of Events and Policy Actions ppt

Ngày tải lên : 17/02/2014, 21:20
... detail the rationale and operation of the TALF April 2, 2009 | FASB Press Release The Financial Accounting Standards Board approves new guidance to ease the accounting of troubled assets held by ... facility which will be available to Fannie Mae, Freddie Mac, and the Federal Home Loan Banks; and 3) a temporary program to purchase GSE MBS Page of 32 Loan Banks; and 3) a temporary program to ... of Canada, Bank of England, Bank of Japan, Danmarks Nationalbank, ECB, Norges Bank, Reserve Bank of Australia, Sveriges Riksbank, and Swiss National Bank Swap lines outstanding now total $620...
  • 32
  • 427
  • 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20
... Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic ... oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain of the tetramer does not exhibit any proton-catalyzed auto-oxidation [22] These authors ... increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the...
  • 6
  • 748
  • 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx

BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx

Ngày tải lên : 09/03/2014, 00:20
... of the book Varumärket som värdeskapare (Brand as a Creator of Value) Half of Coca-Cola’s market value today is tied to the brand The value of the Swedish apparel giant H&M’s brand is set at ... representatives and experts in brand valuation, with Jan Treffner as chairman “It’s beneficial to have a common standard that can be compared, especially when awareness about the importance of brands and ... to make valuations that are as accurate as possible,” Treffner says Soon it will be easier to value brands The German standardization organization DIN has taken the initiative in developing a...
  • 36
  • 485
  • 0
The Cleveland Eraby A Chronicle Of The New Order In Politics (dodo Press) By Henry Jones Ford pdf

The Cleveland Eraby A Chronicle Of The New Order In Politics (dodo Press) By Henry Jones Ford pdf

Ngày tải lên : 16/03/2014, 09:20
... coincidence that the Cleveland era was marked by what in the book trade was known as the Cromwell boom Another unfortunate remark made by Senator Edmunds was that it was the first time “that any President ... congressional supporters of protection managed to have the war rates generally maintained and, in some cases, even increased The case is a typical example of the way in which advantage of strategic ... Americans of diligence and industry have advanced to success in the legal profession Cleveland’s career as a lawyer was marked by those steady, solid gains in reputation which result from care and...
  • 119
  • 459
  • 0
Báo cáo khoa học: Inhibition of the mitochondrial calcium uniporter by the oxo-bridged dinuclear ruthenium amine complex (Ru360) prevents from irreversible injury in postischemic rat heart docx

Báo cáo khoa học: Inhibition of the mitochondrial calcium uniporter by the oxo-bridged dinuclear ruthenium amine complex (Ru360) prevents from irreversible injury in postischemic rat heart docx

Ngày tải lên : 16/03/2014, 22:20
... metabolites from the mitochondrial matrix Calcium uptake and release were also measured in isolated mitochondria, with the aim to assess the protective effect of Ru360 Calcium was accumulated by ... uptake into isolated myocytes, finding a biphasic accumulation that was dependent on time [15] The fast phase was associated with cell surface binding, while the slow phase was assumed to be an ... 6B), the temporal courses of SRV calcium release in the presence of Ru360, Ryan and RR are compared As expected, Ryan and RR partially inhibited SRV calcium release at the indicated concentrations,...
  • 12
  • 428
  • 0
The Forty-Niners - A Chronicle of the California Trail and El Dorado pptx

The Forty-Niners - A Chronicle of the California Trail and El Dorado pptx

Ngày tải lên : 17/03/2014, 15:20
... to analyze the reasons why the task of the American conquerors was so easy, and to explain the facility with which the original population was thrust aside It is a sometimes rather annoying anomaly ... In case that policy failed, he was to use all means to separate them from Mexico, and so isolate them from their natural alliances He was furthermore to persuade them that England, France, and ... within the area already burning The occasion was a grand jubilation for every boy in the town which means every male of any age The roar of the flames, the hissing of the steam, the crash of the timber,...
  • 76
  • 423
  • 0

Xem thêm