employees solidarity in work environment is created ranked first followed by regularly disseminate programs and plans for the staff with a mean of 4 32 while plans of the department for the month quarter and year are based on the missi

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Ngày tải lên : 18/06/2014, 22:20
... GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGTA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGAAC EACMV-KE-[TZT] ... CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT ... and compared with the analogous iterons of the Tanzanian isolates of CMGs Recombination analysis for cassava mosaic geminiviruses The pairwise comparison sequence analysis (PCSA) method compares...
  • 23
  • 612
  • 0
báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

báo cáo hóa học:" Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pot

Ngày tải lên : 20/06/2014, 04:20
... GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGTA TATATGATGATGTTGGTC TAGAAGGTGATAGCCGAAC EACMV-KE-[TZT] ... CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT ... and compared with the analogous iterons of the Tanzanian isolates of CMGs Recombination analysis for cassava mosaic geminiviruses The pairwise comparison sequence analysis (PCSA) method compares...
  • 23
  • 522
  • 0
Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

Báo cáo khoa học: Neuroserpin Portland (Ser52Arg) is trapped as an inactive intermediate that rapidly forms polymers Implications for the epilepsy seen in the dementia FENIB ppt

Ngày tải lên : 07/03/2014, 16:20
... bodies) in neurons compared with dementia associated with the Syracuse mutation (Ser49Pro) The clinical manifestations are more severe, with an age of onset of disease  20 years earlier [3] This earlier ... Read, R & Lomas, D .A (2000) Inactive conformation of the serpin a1 -antichymotrypsin indicates two stage insertion of the reactive loop; implications for inhibitory function and conformational ... readily displaced by the reactive loop of another molecule to form the chains of polymers This conformation would also explain the data obtained with Ser52Arg neuroserpin The Ser52Arg mutation...
  • 8
  • 495
  • 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 08/10/2012, 15:22
... mapping is done by gathering (meta-)information about information and documents that are available on the Internet This is a very time-consuming method that causes a lot of data traffic, it lacks ... indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information is available at a suggested location An attempt to change this ... size of the Internet, let alone to make an estimation of the amount of information that is available on or through it; • The dynamic nature of the information on Internet: information that cannot...
  • 100
  • 811
  • 3
an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 26/10/2013, 17:15
... mapping is done by gathering (meta-)information about information and documents that are available on the Internet This is a very time-consuming method that causes a lot of data traffic, it lacks ... indexing agents is that their actions and suggestions are based on a relatively weak model of what the user wants and what information is available at a suggested location An attempt to change this ... size of the Internet, let alone to make an estimation of the amount of information that is available on or through it; • The dynamic nature of the information on Internet: information that cannot...
  • 100
  • 412
  • 0
Tài liệu Đề tài " Global well-posedness and scattering for the energy-critical nonlinear Schr¨odinger equation in R3 " docx

Tài liệu Đề tài " Global well-posedness and scattering for the energy-critical nonlinear Schr¨odinger equation in R3 " docx

Ngày tải lên : 16/02/2014, 06:20
... Bourgain [4] , [5] and Grillakis [20] in the radial case (see (1.7) above) The main advantage of (4. 19) is that it is not localized to near the spatial origin, in contrast with the standard (1.5) and ... thank Andrew Hassell, Sergiu Klainerman, and Jalal Shatah for interesting discussions related to the interaction Morawetz estimate, and Jean Bourgain for valuable comments on an early draft of ... concentration at arbitrary locations in spacetime In [12], [13] this was achieved by translating the origin in the integrand of (1.6) to an arbitrary point y, and averaging against the L1 mass density...
  • 100
  • 434
  • 0
Tài liệu The Itching Palm A Study of the Habit of Tipping in America doc

Tài liệu The Itching Palm A Study of the Habit of Tipping in America doc

Ngày tải lên : 17/02/2014, 19:20
... particularly where the patrons are men The personal contact is influential, and the plaintive tale of meager salary and small tips which she purrs into your ears, the meanwhile flashing a languishing ... dollars, or by such fine and by imprisonment for not more than one year. " Although the Arkansas and Mississippi laws against tipping are not mentioned, a comprehensive idea of the extent and nature ... straight wage system without at least $60 a month pay, each one of the 6,500 would have an increase of $32. 50 a month, or $390 a year This would mean an increase in the company's annual pay-roll of...
  • 60
  • 528
  • 0
Tài liệu The Agrarian Crusade, A Chronicle of the Farmer in Politics doc

Tài liệu The Agrarian Crusade, A Chronicle of the Farmer in Politics doc

Ngày tải lên : 21/02/2014, 08:20
... third act established a board of railroad and warehouse commissioners charged with the enforcement of these and other laws and with the collection of information The railroad companies, denying the ... been increased in vain twice over; in Germany they put on and relaxed similar duties and are screaming for them again; in Scandinavia Denmark more particularly they limit the aggregation of land; ... the railroad magnate; quite naturally, therefore, the farmers attempted to use their new organizations as a means of eliminating the one and controlling the other As in the parallel case of the...
  • 59
  • 497
  • 0
Trends in the European Investment Fund Industry in the Second Quarter of 2011 and Results for the First Half of 2011 potx

Trends in the European Investment Fund Industry in the Second Quarter of 2011 and Results for the First Half of 2011 potx

Ngày tải lên : 07/03/2014, 16:20
... differences in the universe of reporting countries Including Ireland for all months Including Ireland from December 2010 EFAMA Quarterly Statistical Release N 46 (Second Quarter of 2011) Trends in the ... guaranteed funds Total (incl Ireland & Netherlands) 36,733 in No in % (3) in No (1 No full data breakdo wn is available fo r Ireland and the Netherlands; (2) end June 201 co mpared to end M arch ... second quarter Non-UCITS assets have increased by 2.2 percent over the first half of 2011 Net assets of special funds have increased by 1.2 percent during the quarter and by 4. 3 percent since the...
  • 8
  • 637
  • 0
Trends in the European Investment Fund Industry in the Second Quarter of 2012 and Results for the First Half of 2012 pdf

Trends in the European Investment Fund Industry in the Second Quarter of 2012 and Results for the First Half of 2012 pdf

Ngày tải lên : 07/03/2014, 16:20
... which data are available ) EFAMA Quarterly Statistical Release N°50 (Second Quarter of 2012) Trends in the European Investment Fund Industry Net Assets by Country of Domiciliation The combined assets ... Netherlands) of w hich guaranteed funds Total (incl Ireland & Netherlands) 35,766 (1 No full data breakdo wn is available fo r Ireland and the Netherlands; (2) end June 201 co mpared to end M arch ... months of 2012 However, uncertainty regarding a clear solution to the euro area sovereign debt crisis increased investor caution during the second quarter This can be seen from the trends in monthly...
  • 8
  • 663
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... of the wt protein is maintained for the M100K variant, with an r.m.s.d for the ˚ backbone atoms of 0 .4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the ... are also involved in triggering the conformational change resulting in ligand-exchange at alkaline conditions Despite this, no conformational ligand switching is observed at alkaline pH for the ... rotation of side chains This is most likely due to the fact that in the latter the absence of coordination by the Met does not impose any conformational constraints and the localized region of the...
  • 15
  • 509
  • 0
The Cleveland Eraby A Chronicle Of The New Order In Politics (dodo Press) By Henry Jones Ford pdf

The Cleveland Eraby A Chronicle Of The New Order In Politics (dodo Press) By Henry Jones Ford pdf

Ngày tải lên : 16/03/2014, 09:20
... conditions of travel in those days a hard, serious undertaking His son, also named Aaron, became a Congregational minister Two of the sons of the younger Aaron became ministers, one of them an Episcopalian ... movement in his favor, Grant was the leading candidate with 3 04 votes on the first ballot, James G Blaine standing second with 2 84 This was the highest point in the balloting reached by Blaine, while ... governing party seems to have for its natural concomitant the formation of a similar ring in the regular opposition, and the two rings maintain friendly relations behind the forms of party antagonism...
  • 119
  • 459
  • 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Ngày tải lên : 16/03/2014, 12:20
... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... b-DG(6 54 750), and Asat and A0 are the absorbances at saturation and in the absence of ligand, respectively Data were normalized according to the equation (Ai ) A0 ) ⁄ (Asat ) A0 ) and reported as fractional ... this portion of the protein, and Glu667 fi Ala; only one mutation, Val736 fi Ala, was generated within the C-terminal region of the b-DG ectodomain, downstream of the a- DG-binding epitope A map of...
  • 15
  • 337
  • 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Ngày tải lên : 17/03/2014, 10:20
... wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined by its transformation in 2-octyl glycoside and by comparison ... (pyridinium acetate buffer) in comparison with an analogous ester obtained upon alkaline hydrolysis of glucosylated ribitol teichoic acid from the cell wall of S azureus RIA 1009 [ 24] and based on ... identical absolute configurations of the glycosylating sugar (glucose) and the 4- substituted ManpNAc3NAcA residue [26,27] The signals for a- D-Glcp and b-D-ManpNAc3NAcA were identified in the 1H COSY and...
  • 6
  • 561
  • 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

Ngày tải lên : 22/03/2014, 23:20
... think that these diseases can be driven out of the land Any hope of this nature is the impression of the dreamer By a propaganda of education, by the spread of the eugenic idea and ideal, we may, ... health The cost of constipation— Constipation and social exigencies— One of the important duties of mothers— Constipation and diseases of women— Constipation is always harmful— Constipation and ... BABY What to prepare for the coming baby— Care of the newly-born baby The first bath—Dressing the cord—Treatment after the cord falls off A pouting navel —Bathing baby—Clothing the baby— Baby's...
  • 634
  • 1K
  • 0
The Great Intendant A Chronicle of Jean Talon in Canada 1665-1672 doc

The Great Intendant A Chronicle of Jean Talon in Canada 1665-1672 doc

Ngày tải lên : 24/03/2014, 03:21
... On receiving his commission and his instructions, Talon took leave of the king and the minister, and proceeded to make preparations for his arduous mission and for the long journey which it involved ... act as godmother Laval officiated In 1671 the Ursulines had fifty Indian girls in their Seminaire Sauvage, and in Montreal the Sulpicians and the Sisters of the Congregation, as already narrated, ... But the motherland was far away, and European wars and rivalries were engrossing all her attention Fortunately a change was at hand The prolonged struggle of the Thirty Years' War and of the war...
  • 42
  • 387
  • 0
When States Go Broke The Origins, Context, and Solutions for the American States in Fiscal Crisis ppt

When States Go Broke The Origins, Context, and Solutions for the American States in Fiscal Crisis ppt

Ngày tải lên : 30/03/2014, 04:21
... 2011, the Economist magazine recently published a series of articles on constitutional change and politics in California, based in part on Cain and Noll’s analysis Fiscal Institutions and Fiscal ... Governance at Stanford Law School and the Stanford Graduate School of Business His research focuses on banking regulation and financial and fiscal crises, and includes articles published in the Stanford ... financial and fiscal crises, public and private debt regulation, and central banking He is a graduate of Stanford Law School and Harvard College Adam Feibelman is the Sumter Davis Marks Professor of...
  • 342
  • 740
  • 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Ngày tải lên : 31/03/2014, 23:20
... [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of the individual pKa values of the active site residues, were consistent with the existence of ... proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity reaction requiring high amounts of protein and long incubation times [18] Thus, using this dinucleotide ... very similar result has been obtained before for the H50Q variant, while mutation of either Glu96 or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20],...
  • 7
  • 434
  • 0
the barbarians beverage - a history of beer in ancient europe - nelson

the barbarians beverage - a history of beer in ancient europe - nelson

Ngày tải lên : 12/06/2014, 11:30
... says of a drink made from cereal and water, in the local vernacular and barbaric speech in the provinces of Dalmatia and Pannonia it is called sabaium’ Jerome, as a native of Dalmatia (from the ... BC, while fleeing the Persians, the Athenian general and historian Xenophon and his men reached a village in Armenia where they were amiably treated Upon arriving they ate and drank with the head ... the precise meaning of sabaiarius, but it presumably means either a drinker of sabaia beer’ or a maker of sabaia beer’ Moreover, St Jerome, commenting on a passage in the Septuagint, says of...
  • 224
  • 472
  • 0
Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc

Báo cáo sinh học: " Unusual presentation of hepatitis B serological markers in an Amerindian community of Venezuela with a majority of occult cases" doc

Ngày tải lên : 18/06/2014, 18:20
... exhibited the co-circulation of a wild type variant with a variant with a premature stop codon at the core protein, and a variant exhibiting a deletion of 28 amino acids Conclusions The frequency of ... genotype and subgenotype Venezuelan HBV isolates circulating in other Amerindians populations were included, from the Orinoco Delta (DELTA), in Yucpas (JAPREIRA) and in Yanomamis (Y) and Piaroas (P) ... from the Amazon (AMAZ) Figure HBV core variants circulating in a Piaroa Amerindian with OBI a Agarose gel electrophoresis of HBV core amplicons BP21 repeated amplifications of isolate BP21 allow...
  • 13
  • 375
  • 0

Xem thêm