convert an xml file to a delimited file and vice versa

Tài liệu Creating an XML File That Shows Changes Made to a DataSet pptx

Tài liệu Creating an XML File That Shows Changes Made to a DataSet pptx

Ngày tải lên : 21/01/2014, 11:20
... original and current values for the contents of a DataSet It does not include any schema information The DiffGram is also the primary serialization format used by the NET Framework to persist and ... Here are descriptions of the three DiffGram sections: The DataInstanceName is the name of the DataSet or DataTable This block contains the current version of the data containing ... method cannot be used to generate a DiffGram A DataSet can be loaded from an XML DiffGram by specifying an XmlWriteMode of DiffGram when calling the ReadXml( ) method [ Team LiB ] ...
  • 6
  • 428
  • 0
Translating an academic mission to a brand platform

Translating an academic mission to a brand platform

Ngày tải lên : 07/05/2016, 00:41
... QuickTime™ and a decompressor are needed to see this picture ...
  • 79
  • 328
  • 0
Tài liệu Reproductive Health and Partner Violence Guidelines: An Integrated Response to Intimate Partner Violence and Reproductive Coercion doc

Tài liệu Reproductive Health and Partner Violence Guidelines: An Integrated Response to Intimate Partner Violence and Reproductive Coercion doc

Ngày tải lên : 13/02/2014, 10:20
... that traditional service delivery approaches may exacerbate, so that these services and programs can be more supportive and avoid re-traumatization (http://www.samhsa.gov/nctic/trauma.asp) FAMILY ... relationship abuse and physical and sexual assault in adult intimate relationships, sexual assault refers to adult experience, and child abuse includes childhood sexual and physical abuse 44 FAMILY ... and reproductive health have expanded our understanding of the dynamics and health effects of abusive adult and teen relationships This has led to new terminology to describe forms of abuse and...
  • 52
  • 489
  • 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Ngày tải lên : 14/02/2014, 03:20
... thermogravimetric analysis (TGA), attenuated total reflectance (ATR) IR and ATR-near-IR),12 methotrexate (along with TGA),13 carbamazepine (along with FTIR and hot-stage FTIR thermomicroscopy),14 ranitidine ... can be converted back to the hexahydrated Form, sample 49 was heated to 130 °C and subsequently stored at 52% RH at room temperature for days The sample was then analyzed by TGA and produced a ... Evolved Gas Analysis Simultaneous TG/MS and TG/gas chromatography (GC)/MS analysis were performed on several samples A split was used to send a fraction of the evolved gases to a quadruple mass spectrometer...
  • 16
  • 549
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Ngày tải lên : 18/02/2014, 04:20
... ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA GGTTTTCGTCTAGAAGATTTCTGTC-3Â) designed to remove the NTAIL stop codon and to introduce a fragment encoding a TEV cleavage sequence and a NcoI restriction site at position ... from the EXTRA programme of UNIMIB-Cariplo, allowing her to carry out part of this work in Marseille The authors wish to thank Antonino Natalello and Silvia Maria Doglia for their assistance with ... spectra obtained under the same conditions, as in our case [35] At 20 C, NTAIL, PNT and SIC1 share a high content of unordered stretches (5059%) and a low content in a- helices and b-strands (23% and...
  • 14
  • 672
  • 0
Báo cáo khoa học: "USING AN ONLINE DICTIONARY TO FIND RHYMING WORDS AND PRONUNCIATIONS FOR UNKNOWN WORDS " doc

Báo cáo khoa học: "USING AN ONLINE DICTIONARY TO FIND RHYMING WORDS AND PRONUNCIATIONS FOR UNKNOWN WORDS " doc

Ngày tải lên : 08/03/2014, 18:20
... stops, voiced and voiceless fricatives and affricates, nasals, and liquids ters in words gives monotonically decreasing weight to the vowels and consonants as one moves from right to left in the ... (1924), The Rhyming Dictionary, Routledge and Kegan Paul, London Forster, K and Chambers, S (1973), Lexical access and naming time Joutmal of Verbal Learning and Verbal Behavior, 12, 627-635 Webster's ... experimentation n There are other outstanding questions related to the Matching and Combining steps If matches cannot be found for initial and final substrings that overlap (as in the example) or at...
  • 7
  • 381
  • 1
Review and Evaluation of Proposed Legislation Entitled: An Act Relative to Women’s Health and Cancer Recovery Senate Bill 896 pdf

Review and Evaluation of Proposed Legislation Entitled: An Act Relative to Women’s Health and Cancer Recovery Senate Bill 896 pdf

Ngày tải lên : 22/03/2014, 10:20
... medical opinions at the usual customary and reasonable rate, or at a rate listed on a fee schedule filed and approved by DOI; and, (2) establish annual deductibles and coinsurance provisions that ... Highland, Compass Health Analytics Lars Loren, Compass Health Analytics Lisa Manderson, Compass Health Analytics Joshua Roberts, Compass Health Analytics Division of Health Care Finance and Policy ... WHCRA and current coverage Table 1:  Comparison of S.B. 896 with WHCRA and Market Coverage  S.B. 896 Mandate  Federal WHCRA Mandate  Typical Market Coverage  A minimum hospital stay,  Not mandated ...
  • 63
  • 339
  • 0
Health Education to Villages: An integrated approach to reduce childhood mortality and morbidity due to diarrhoea and dehydration; Maharashtra, India 2005 – 2010 pptx

Health Education to Villages: An integrated approach to reduce childhood mortality and morbidity due to diarrhoea and dehydration; Maharashtra, India 2005 – 2010 pptx

Ngày tải lên : 22/03/2014, 15:21
... Villages: an integrated approach to reduce childhood mortality and morbidity due to diarrhoea and dehydration; Maharashtra, India 2005 – 2010 Region and Country: Maharashtra, India Name of Local Partners: ... of Maharashtra, especially health-care providers, mothers, and children, about basic health practice, sanitation, and child care, with a primary focus on diarrhoeal diseases and the use of oral ... school in Maharashtra Usage of Soap and Water ― Promote the habit of washing hands with soap and water to decrease episodes of diarrhoea To ensure the sufficient availability of soap, partnerships...
  • 11
  • 359
  • 0
Báo cáo hóa học: " Heavily glycosylated, highly fit SIVMne variants continue to diversify and undergo selection after transmission to a new host and they elicit early antibody dependent cellular responses but delayed neutralizing antibody responses" pdf

Báo cáo hóa học: " Heavily glycosylated, highly fit SIVMne variants continue to diversify and undergo selection after transmission to a new host and they elicit early antibody dependent cellular responses but delayed neutralizing antibody responses" pdf

Ngày tải lên : 20/06/2014, 01:20
... intermediate and late variants also had no length variation, while others demonstrated extensive variation (up to 80% in one animal) Although animals infected with the late variants had more length variation ... divergence in animals infected with the intermediate and late variants Finally, animals http://www.virologyj.com/content/5/1/90 infected with intermediate and late variants had more length changes and ... manufacturers protocol and sequenced using standard procedures Phylogenetic analysis Sequences from all animals were aligned using Clustal [31] and manually edited using MacClade [32], and no...
  • 15
  • 490
  • 0
Báo cáo khoa học: "Mesenteric rheumatoid nodules masquerading as an intra-abdominal malignancy: a case report and review of the literature" ppsx

Báo cáo khoa học: "Mesenteric rheumatoid nodules masquerading as an intra-abdominal malignancy: a case report and review of the literature" ppsx

Ngày tải lên : 09/08/2014, 04:21
... history of malignancies On examination, the patient was noted to have a well healed midline and right upper quadrant scar, the abdomen was nondistended and nontender to palpation, and no masses were ... literature search, and drafted the manuscript JST performed the surgery, critically revised the manuscript, and obtained images used in the manuscript All authors read and approved the final manuscript ... of his RA and moderate regression of the abdominal rheumatoid nodules 10 11 12 Sayah A, English JC 3rd: Rheumatoid arthritis: a review of the cutaneous manifestations J Am Acad Dermatol 2005,...
  • 5
  • 538
  • 0
báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt

báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt

Ngày tải lên : 10/08/2014, 23:20
... Ruiz-Maciá JA, Brufau C, Carapetod FJ: Cutaneous squamous cell carcicoma and human papillomavirus Actas Dermosifiliogr 2007, 98:583-593 Levi F, Randimbison L, La Vecchia C: Nonmelanomatous skin cancer ... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no ... Princeton, New Jersey Springfield (IL): North American Association of Central Cancer Registries; 2003 Agrawal A, Yau A, Magliocco A, Chu P: Cutaneous metastatic disease in cervical cancer: a case...
  • 4
  • 310
  • 0
báo cáo khoa học: "Posterior leukoencephalopathy following repair of an ileocecal anastomosis breakdown: a case report and review of the literature" ppsx

báo cáo khoa học: "Posterior leukoencephalopathy following repair of an ileocecal anastomosis breakdown: a case report and review of the literature" ppsx

Ngày tải lên : 11/08/2014, 03:20
... the case of a 22-year-old Caucasian man with a 10-year history of Crohn’s disease He had recently undergone a small bowel resection and ileocecal anastomosis On his fourth post-operative day, ... Israel Deaconess Medical Center, Harvard Medical School, Boston MA 02115, USA 2Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston MA 02115, USA 3Department ... Radiology, Brigham and Women’s Hospital, Harvard Medical School, Boston MA 02115, USA Authors’ contributions POZ, RRC, EMK, CCC wrote the manuscript All authors read and approved the final manuscript...
  • 3
  • 347
  • 0
Báo cáo y học: " Axillary nodal metastasis at primary presentation of an oropharyngeal primary carcinoma: a case report and review of the literature" ppt

Báo cáo y học: " Axillary nodal metastasis at primary presentation of an oropharyngeal primary carcinoma: a case report and review of the literature" ppt

Ngày tải lên : 11/08/2014, 17:21
... important intellectual content BM managed the patient, obtaining all tissue samples and imaging BM was the first author JL read and approved the final manuscript Do you have a case to share? Submit ... Srivastava S: Axillary metastases from recurrent oral carcinoma Br J Oral Maxillofac Surg 2004, 42:264-266 Oo AL, Yamguchi S, Iwaki H, Amagasa T: Axillary nodal metastasis from oral maxillofacial ... suggested that complex and variable connections may exist between the cervical lymphatics and the axillary and/ or chest lymphatics, with axillary metastases found in 2% to 9% of patients with head and...
  • 3
  • 276
  • 0
how to copy an opened file - MSDN Blogs

how to copy an opened file - MSDN Blogs

Ngày tải lên : 21/03/2013, 10:27
... way, the VSS SDK contains a set of test VSS scripts that can be used to backup and restore a SQL/MSDE database, and then verify that the restore was succesful Thanks, Adi Yoshihiro Kawabata Jan ... away, all the created shadow copies are going away too In fact, this is a convenient feature for a backup application; for example if that application crashes, then you won't have leaking shadow ... a neat trick that allowed us to avoid defining a separate CMD script At the same time, the test allows us to detect what to when we are inside VSHADOW remember, all we wanted to is to copy a...
  • 8
  • 352
  • 0
Tài liệu Connecting to a Text File pptx

Tài liệu Connecting to a Text File pptx

Ngày tải lên : 24/12/2013, 05:15
... width, and data type for each column The MaxScanRows option indicates how many rows should be scanned to automatically determine column type A value of indicates that all rows should be scanned ... OleDbDataAdapter da = new OleDbDataAdapter("SELECT * FROM [Categories.txt]", ConfigurationSettings.AppSettings["TextFile_0119_ConnectString"]); // Create and fill the table DataTable dt = new DataTable("Categories"); ... Format Description Fields are delimited with commas: CSV Delimited Format=CSVDelimited This is the default value Custom Delimited Fields are delimited with a custom character You can use any...
  • 4
  • 348
  • 0
Đề và đáp án ĐH 2010 khối A - file Word

Đề và đáp án ĐH 2010 khối A - file Word

Ngày tải lên : 12/07/2014, 20:00
... tripeptit (mạch hở) khác loại mà thuỷ phân hoàn toàn đều thu được aminoaxit: glyxin, alanin và phenylalanin? A B C D Câu 22: Hỗn hợp khí X gồm đimetylamin và hai hiđrocacbon đồng ... axit A axit propanoic B axit metanoic C axit etanoic D axit butanoic Câu 49: Đốt cháy hoàn to n lượng hiđrocacbon X Hấp thụ to n sản phẩm cháy vào dung dịch Ba(OH)2 (dư) tạo 29,55 gam kết t a, dung ... cần dùng vư a đủ 100 gam dung dịch NaOH 24%, thu được một ancol và 43,6 gam hỗn hợp muối cu a hai axit cacboxylic đơn chức Hai axit đó là A HCOOH và CH3COOH B CH3COOH và C2H5COOH...
  • 6
  • 301
  • 1
Adding new section to a PE file

Adding new section to a PE file

Ngày tải lên : 25/01/2016, 13:59
... ng quan tr ng nh sau: d ng tr ng Ch s +0 +08 Array[8] of byte Name DWORD PhysicalAddress/Virtual Size +0C DWORD d ng 28h bytes VirtualAddress SizeOfRawData +10 (16) DWORD PointerToRawData +14 ... i phù h p v i thông s data c a section Vritual Address c a section m i (.NEW) = Virtual Address c a data + Vritual Size c a data = 3000+34 = 4000 Vì Section Alignment c a 1000h nên ph i làm tròn ... +0 +08 Array[8] of byte Name DWORD PhysicalAddress/Virtual Size +0C DWORD VirtualAddress +10 (16) DWORD +14 (20) DWORD SizeOfRawData PointerToRawData +18 +1C +20 +22 +24 PointerToRelocations...
  • 7
  • 521
  • 2

Xem thêm