Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento di Biotecnologie e Bioscienze, Universita ` di Milano-Bicocca, Italy 2 Architecture et Fonction des Macromole ´ cules Biologiques, Universite ´ Aix-Marseille I et II, France Introduction Until very recently, one of the pillars of protein science has been the so-called structure–function paradigm, which posits the formation of a unique 3D structure as the prerequisite for biological function [1]. However, during the last decade, numerous proteins have been described that fail to adopt a stable tertiary structure under physiological conditions and yet display biologi- cal activity [2]. This condition, defined as intrinsic disorder, has been found to be widespread in func- tional proteins. Importantly, disordered regions are often required for biological activity, indicating that the lack of stable secondary and tertiary structure is a Keywords conformation; fusion proteins; intrinsically disordered proteins; stability; viral proteins Correspondence M. Lotti, Dipartimento di Biotecnologie e Bioscienze, Universita ` di Milano-Bicocca, Piazza della Scienza 2, 20126 Milano, Italy Fax: +3902 6448 3569 Tel: +3902 6448 3527 E-mail: marina.lotti@unimib.it or S. Longhi, Architecture et Fonction des Macromolecules Biologiques (AFMB), UMR 6098 CNRS et Universite ´ s d’Aix-Marseille I et II, 163, Avenue de Luminy, Case 932, 13288 Marseille, Cedex 09, France Fax: +33 (0) 4 91 26 67 20 Tel: +33 (0) 4 91 82 55 80 E-mail: sonia.longhi@afmb.univ-mrs.fr *Present address Biochemistry Department, University of Cambridge, UK (Received 30 June 2010, revised 10 August 2010, accepted 23 August 2010) doi:10.1111/j.1742-4658.2010.07825.x Intrinsically disordered proteins (IDPs) are functional proteins either fully or partly lacking stable secondary and tertiary structure under physiologi- cal conditions that are involved in important biological functions, such as regulation and signalling in eukaryotes, prokaryotes and viruses. The func- tion of many IDPs relies upon interactions with partner proteins, often accompanied by conformational changes and disorder-to-order transitions in the unstructured partner. To investigate how disordered and ordered regions interact when fused to one to another within the same protein, we covalently linked the green fluorescent protein to three different, well char- acterized IDPs and analyzed the conformational properties of the fusion proteins using various biochemical and biophysical approaches. We observed that the overall structure, compactness and stability of the chime- ric proteins all differ from what could have been anticipated from the structural features of their isolated components and that they vary as a function of the fused IDP. Abbreviations GFP, green fluorescent protein; IDP, intrinsically disordered protein. 4438 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS resource rather than a defect. According to this novel perspective, the straightforward quest for structural features engaged in a function is moving towards a dynamic view in which function arises from conforma- tional freedom. Fully or partly nonstructured proteins are generally referred to as intrinsically disordered (IDPs) or intrinsically unstructured proteins, or also as natively unfolded proteins, a term that emphasizes the fact that, to fulfil their tasks within the cell, these poly- peptides rely on existing as a dynamic ensemble of dif- ferent conformations [3–5]. The intrinsic flexibility of IDPs indeed provides a clue with respect to their broad biological functions and high occurrence among pro- teins with signalling and regulatory roles [4–6]. Consis- tent with their central position in biological networks, many disordered proteins are tightly regulated through the control of their synthesis and degradation and by post-translational modifications (e.g. phosphorylation) [7]. Because of its functional relevance, disorder is widespread in nature, as shown by computational anal- yses at the genomic level, which indicate that more than half of all eukaryotic proteins contain unstruc- tured regions (> 50 residues) and 25–30% of them are mostly disordered [8]. According to their pivotal role in signalling and regulation, IDPs are involved in sev- eral different pathologies [9], such as cancer [10], as well as cardiovascular [11] and neurodegenerative diseases [9,12]. Unstructured protein regions often undergo disor- der-to-order transitions upon interaction with their partners, as well as upon post-translational modifica- tions [13,14]. Although the structural effects of inter- molecular associations have been thoroughly investigated [15–17], the mutual influence that ordered and disordered regions exert on each other when they are embedded in the same protein has received less attention. This is the case for proteins in which more compact regions co-exist with fully or mostly unfolded ones, such as, for example, in KNR4, a 505 residue yeast protein involved in the coordination of cell wall synthesis and cell growth [18], the nucleoprotein and phosphoprotein from measles and Sendai viruses [19,20] and the Rhabdoviridae phosphoprotein [21]. Although the isolated disordered domains of these lat- ter proteins have been studied in depth, comprehensive data on the full-length polypeptides are lacking, with the data available so far only suggesting that unstruc- tured regions maintain this feature in the context of the entire proteins [19–21]. However, evidence that dis- ordered regions may impact on linked globular domains arises from work performed in a different context. In particular, studies by Bae et al. [22] focused on the prediction of rotational tumbling times of proteins containing disordered segments, and high- lighted the effects of the unordered regions on the properties of covalently linked globular domains (in this case on the tumbling of the rigid part), with the extent of the perturbation being proportional to the length of the disordered region. With the aim of investigating the reciprocal confor- mational effect of covalently linked structured and unstructured protein regions, we fused green fluores- cent protein (GFP) with disordered fragments of dif- ferent origin and compactness and investigated the properties of these fusion proteins using biochemical and biophysical methods. GFP is a globular protein with a stable fold and known 3D structure [23]. Its flu- orophore provides a specific marker to monitor struc- tural changes in GFP only. As disordered moieties, we used the unstructured regions of two measles virus proteins (NTAIL and PNT) and the whole Saccharo- myces cerevisiae SIC1 protein. Although they are all IDPs, these proteins have different structural features and a different extent of disorder. NTAIL is the C-ter- minal domain (residues 401–525) of the viral nucleo- protein that is exposed at the surface of the nucleocapsid [24]. Disorder confers a high structural plasticity to NTAIL, thus allowing the establishment of interactions with various partners [25–29]. PNT is the unstructured N-terminal region of the P protein of the viral RNA polymerase complex [30,31]. SIC1 is a 284 residue inhibitor of the cyclin-dependent yeast pro- tein kinase whose conformation in isolation has been described recently [32,33]. We report that differences in the intrinsic properties of the IDP (length, a-helix propensity, compactness) result in fusions with different conformational proper- ties that are not accounted for by the features of their components in isolation. Results and Discussion Fusion proteins are produced in soluble form though at levels lower than the constituent proteins Plasmids for the expression of fusion proteins were designed to encode proteins bearing a histidine tag for immobilized metal-affinity chromatography purifica- tion. All chimeras consist of the IDP (NTAIL, PNT or SIC1), a linker of 14 residues containing the TEV pro- tease cleavage sequence (Glu-Asn-Leu-Tyr-Phe-Gln- Gly-Ser) and the GFP, in that order (Fig. 1). The lengths of the resulting fusion proteins are: 386 resi- dues for NTAIL-GFP (43.2 kDa), 490 residues for PNT-GFP (53.4 kDa) and 545 residues for SIC1-GFP I. Sambi et al. Ordered and disordered protein domains FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4439 (61.7 kDa). Isolated IDPs and GFP were expressed from similar constructs and in the same host cells. The expression protocol was optimized to obtain similar amounts of all proteins and to minimize both the formation of inclusion bodies and spontaneous proteolysis. Indeed, it has been observed that IDPs are prone to undergo proteolytic degradation during puri- fication even upon addition of protease inhibitors to cell extracts [5]. The culture conditions found to satisfy all these requirements were: transformed Escherichia coli BL21 [DE3] cells were grown at 37 °C until D 600 of 0.4–0.5 was reached, then induced with 100 lm of isopropyl thio-b-d-galactoside at 37 °C for 2 or 6 h, depending on whether single or fusion proteins were to be expressed, respectively. Under the above conditions, all proteins were found to be mainly soluble and prote- olytic events were negligible (Fig. 2). Despite repeated attempts (data not shown), we could not improve the expression level of SIC1-GFP, which systematically remained very poor. Notably, all the fusion proteins were fluorescent, thus suggesting that the GFP moiety adopts a native-like conformation. Conformational properties of the fusion proteins vary as a function of the unstructured moiety NTAIL, PNT and SIC1 have been previously shown to belong to the family of IDPs on the basis of their biochemical and biophysical properties [30,32,34]. Accordingly, their far-UV CD spectra recorded at 20 °C show the distinctive IDP profile, characterized by a large negative peak at 200 nm. The ellipticity val- ues observed at 200 and 222 nm are consistent with the existence of some residual helical structure. By con- trast, the GFP spectrum is typical of a structured pro- tein with predominant b-strand content, as indicated by the well-defined positive peak at 195 nm and the broad negative peak with a minimum at 218 nm (Fig. 3). Spectra of the fusion proteins combine fea- tures of ordered and unordered components. Although minima corresponding to helical structures (a well- defined inflection point at 203–207 nm and a less pro- nounced inflection point at 220–222 nm) are clearly observed, the negative ellipticity values at 200 nm, together with the low ellipticity in the range 185– 195 nm, suggest the presence of unordered structures (Fig. 3). Notably, these spectroscopic hallmarks of dis- order are particularly pronounced for the NTAIL and SIC1 fusion proteins (Fig. 3A, C), whereas PNT-GFP exhibits a less disordered nature (Fig. 3B). To highlight possible mutual effects of disordered and ordered moieties within the fusion proteins, we calculated the theoretical average spectra of equimolar IDP and GFP mixtures by averaging the spectra of the individual IDP and GFP proteins. Note that each average spectrum describes what would be expected in case the two components do not affect each other’s conformation. We then compared the average spectra with the experimental measured spectra of equimolar IDP + GFP mixtures. The CD spectra of NTAIL + GFP (Fig. 3A) and PNT + GFP (Fig. 3B) mixtures superimpose quite well onto their respective calculated theoretical average spectra, indicating that, when the two separated components are mixed, they do not undergo any significant structural rearrangement. The spectra of both NTAIL-GFP and PNT-GFP fusion proteins are clearly different from those of the mix- tures either calculated or measured, suggesting that structural rearrangements are induced in the fusion by the forced close proximity of the two proteins. In par- ticular, NTAIL-GFP and PNT-GFP spectra indicate a lower and higher extent of order with respect to the average spectra, respectively. By contrast, the spectrum of the SIC1-GFP fusion protein superimposes onto the calculated average spectrum, suggesting that the two domains do not impact on each other’s conformation Fig. 1. Schematic representation of IDP-GFP constructs. From the N- to C-terminus, each fusion protein contains the hexahistidine tag (H 6 ), the IDP (NTAIL, PNT or SIC1), a TEV cleavage sequence (TEV) and the GFP. Fig. 2. Expression and purification of fused polypeptides and indi- vidual proteins. M, molecular weight markers; TF, total protein frac- tion; SOL, soluble protein fraction; proteins purified by immobilized metal affinity chromatography (IMAC). Ordered and disordered protein domains I. Sambi et al. 4440 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS when they are covalently linked. More difficult to explain are the rearrangements observed in the SIC1 + GFP mixture (Fig. 3C), which suggest that structural rearrangements only take place when the two proteins exist as individual moieties in solution. This observation might be accounted for by the inter- action depending on orientation factors, with the two moieties exhibiting a considerably reduced conforma- tional freedom if covalently linked. In view of obtaining further insight into the struc- ture of the fusion proteins, we estimated the content of a-helices, b-strands, b-turns and unordered regions by the cdsstr deconvolution method (Fig. 4). Although this type of analysis does not yield secondary structure content values that are in perfect agreement with those derived from structural data obtained by other meth- ods, it is assumed to be applicable and trustworthy if its aim is a comparison of the secondary structure con- tent of a restricted set of spectra obtained under the same conditions, as in our case [35]. At 20 °C, NTAIL, PNT and SIC1 share a high con- tent of unordered stretches (50–59%) and a low con- tent in a-helices and b-strands (2–3% and 22–29%, respectively), whereas GFP is rich in b-strands (46%) and exhibits a low content in unordered regions (20%), in agreement with previous data available for these proteins [23,30,32,34]. Interesting differences arise from a comparison of the secondary structure content of each protein in isolation with that of fusion pro- teins. We observed that the linkage with GFP does not alter the b-a-turn-unordered ratio typical of the unstructured moiety when the IDP is NTAIL or SIC1, whereas, in the fusion PNT-GFP, the structured part appears to prevail, raising the percentage of the differ- ent secondary structures to a value close to that of GFP alone (Fig. 4). Comparison between the measured and the averaged secondary structure contents (see Materials and methods) clearly shows that the second- ary structure composition of the fusion proteins devi- ates from the mean of the single contributions (Fig. 5). Although this analysis does not allow an assessment of whether the observed deviations in the structural con- tent reflect structural transitions taking place in only one of the two moieties or rather reflect structural rearrangements distributed over the whole polypeptide, we can speculate that the increase in order in PNT- GFP likely reflects a gain of structure within PNT. That PNT possesses an inherent propensity to undergo a disorder-to-order transition has already been reported, with this gain of structure concerning the first 50 residues [30]. Conversely, the less ordered nat- ure of the NTAIL-GFP fusion protein with respect to the mean of the secondary structure contents of the two components could be ascribed either to partial unfolding of GFP or to loss of residual structure by NTAIL, with the transiently populated a-helical regions of the latter [26,34,36–39] adopting preferen- tially an extended (e.g. disordered) conformation when linked to GFP. A B C Fig. 3. Far-UV CD spectra. The CD spectrum of each of the fusion proteins is compared with that of individual proteins, with the theo- retical average spectrum and with the spectrum of equimolar pro- tein mixtures. (A) NTAIL-GFP; (B) PNT-GFP; (C) SIC1-GFP. Spectra were recorded in 10 m M sodium phosphate (pH 7.5) at 20 °C. I. Sambi et al. Ordered and disordered protein domains FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4441 Notably, the analysis of the GFP sequence alone and of GFP bound to any of the three IDPs using the anchor server, which predicts binding sites within dis- ordered regions [14,40], shows that the GFP N-termi- nal part becomes more disordered (Fig. S1). This can account for the increased disorder measured by far-UV CD on the NTAIL-GFP fusion protein compared to the NTAIL + GFP mixture. According to anchor, NTAIL contains possible binding regions either (Fig. S1). In this case, however, the experimental data suggest that these binding regions are not compatible with GFP binding. anchor predicts numerous possible binding regions within PNT (Fig. S1). As a result of order increasing in PNT-GFP compared to PNT + GFP, one (or more) of the binding regions probably effectively binds to GFP, albeit not to a great extent, because this interaction is not measured in the PNT + GFP mixture. Finally, the predicted SIC1 binding regions (Fig. S1) may interact with GFP, thus accounting for the increased order in the SIC1 + GFP mixture compared to the theoretical average. As a result of steric restrictions, the most likely candidate for GFP binding is the 183–194 stretch (or the weaker ones between 214–229 and 253–259) predicted by anchor. Regardless of the distribution within the fusion pro- tein of such folding and unfolding events, we can clearly state that, in the presence of the same globular domain (GFP), the overall structure of the fusion pro- tein varies as a function of the unstructured moiety. The conformational stability of the chimeras was investigated by recording variations in the mean resi- due ellipticity at 195 nm when heating the protein samples from 20 to 100 °C (Fig. S2). We observed that, although isolated GFP undergoes a cooperative unfolding transition between 70 and 90 °C, all IDPs display almost constant negative mean residue elliptic- ity values, consistent with the absence of cooperative unfolding that typifies unstructured proteins, and a moderate increase of ellipticity at the highest tempera- tures, consistent with the process of temperature- induced folding common to several IDPs [41]. Heat induced transitions recorded for the fusion proteins were intermediate between these two scenarios. Only for NTAIL-GFP was a defined transition visible in the range 75–85 °C range, whereas PNT-GFP and SIC1-GFP did not display a classical two-state confor- mational transition. We also monitored the mean resi- due ellipticity at 195 nm during recooling to 20 °C, and recorded the CD spectra of the cooled solutions in the whole range (260–185 nm) to assess the revers- ibility of unfolding (data not shown). GFP denatur- ation was found to be only partly reversible, with the sample exhibiting some helical structure but not the native b-strand content, whereas the CD spectra of the IDPs acquired before and after the heating ⁄ recool- ing process were fully superimposable. Unfolding of fusion proteins was not fully reversible and showed a trend very similar to that of isolated GFP, suggesting that the GFP moiety retains an inability to recover its native conformation when covalently linked to an IDP. Fig. 4. Secondary structure content of IDPs, GFP and fusion pro- teins. a-helix, b-strands, turns and unordered regions percentages were calculated using CDSSTR. Fig. 5. Deviation from the theoretical secondary structure average composition. Differences are calculated for each fusion and each kind of structure by comparing the percentages derived from exper- imental spectra with the theoretical average compositions as obtained by averaging the secondary structure content of each indi- vidual IDP and GFP. Ordered and disordered protein domains I. Sambi et al. 4442 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS Compactness of fusion proteins depends on the disordered moiety In further experiments, we investigated the effect of the disordered domain on the electrophoretic mobility of the fusion proteins using SDS ⁄ PAGE migration analysis (Table 1). IDPs are known to migrate slower in SDS ⁄ PAGE than globular proteins with the same molecular mass as a result of their relative enrichment in acidic residues [5]. The apparent M r of the isolated IDPs as observed in SDS ⁄ PAGE was larger than expected (Table 1), whereas, for GFP, the expected and observed values were very close. Because all fusion proteins exhibited an apparent molecular mass (M r App ) significantly higher than expected, we con- cluded that the presence of a covalently linked IDP is sufficient to affect GFP migration and that the extent of this modification is correlated with the specific disordered component, as suggested by the observed differences in the M r App ⁄ M rth ratio. We next addressed the impact of the disordered moi- ety onto the overall compactness of the fusion proteins by size exclusion chromatography. Because these studies are quite demanding in terms of protein amounts, we only focused onto those proteins (NTAIL-GFP and PNT-GFP) that could be produced and purified in suffi- cient quantity (Table 1). In gel filtration experiments, the elution volume of a given protein can be directly cor- related with the protein apparent molecular mass by interpolation with a calibration curve in which elution volumes of several globular proteins of known size are correlated with their molecular masses [42]. The hydro- dynamic radius of a protein (Stokes radius, R obs S ) can then be deduced from its apparent molecular mass and compared with the theoretical Stokes radius expected for either the native (R sN ) or the fully denatured (R sU ) form of a protein of the same size (for details, see Materials and methods). As expected, the GFP hydro- dynamic behaviour reflected the properties of a globular protein, with a R obs ⁄ R sN ratio very close to the unit, whereas ‘aberrant’ elution profiles in gel filtration experiments were systematically observed for all IDPs. Previous data showed that NTAIL behaves in gel filtra- tion as a protein of 36 kDa, whereas its expected mass is 15 kDa [34]. The corresponding R obs S was 27 A ˚ , a value closer to the radius expected for a fully denatured state (R sU =35A ˚ ) compared to globular protein (R sN = 19 A ˚ ) [34]. In the present study, PNT (expected mass of 25 kDa) was found to elute with an apparent molecular mass of 115 kDa, in agreement with previous studies [30]. This very high value of the apparent molecular mass corresponds to an observed Stokes radius of 41 A ˚ , which is closer to the value expected for the fully un- ordered (R sU =46A ˚ ) than the globular (R sN =23A ˚ ) form. The apparent molecular weight of SIC1 was reported to be 50 kDa instead of 33 kDa, and the inferred Stokes radius was 30 A ˚ , with the expected R sU and R sN being 53 and 25 A ˚ , respectively [32]. The apparent molecular masses of both NTAIL- GFP and PNT-GFP were higher than calculated from their amino acid sequence ($96 kDa instead of 43 kDa and $73 kDa instead of 53 kDa, respectively). The extent of the discrepancy however was not the same. The calculated R obs S and comparison with the relative R sN and R sU showed that the two fusion proteins have distinctive hydrodynamic behaviours that could not be anticipated from the characteristics of flexi- bility of their unstructured component. The R obs S of the NTAIL-GFP fusion protein ($38 A ˚ ) is closer to the R sN (28 A ˚ ) than to the R sU (61 A ˚ ), whereas the R obs S of PNT-GFP ($35 A ˚ ) is closer to the R sN (31 A ˚ ) than to the R sU (69 A ˚ ) (Table 1). Thus, the hydrodynamic values of NTAIL-GFP and PNT-GFP proteins do not reflect the sum of the Table 1. Apparent M r of IDPs-GFP, IDPs and GFP derived from SDS ⁄ PAGE and gel filtration. Hydrodynamic radii were inferred from the apparent molecular mass according to Uversky [46]. ND, not determined. M rth (kDa) SDS ⁄ PAGE Gel filtration M r App (kDa) M r App ⁄ M rth M r App (kDa) M r App ⁄ M rth R sN (A ˚ ) R sU (A ˚ ) R obs S (A ˚ ) R obs S ⁄ R sN R obs S ⁄ R sU Reference for gel filtration NTAIL-GFP 43 51 1.18 96 2.23 28 61 38 ± 2 1.35 0.62 Present study PNT-GFP 53 64 1.20 73 1.37 31 69 35 ± 2 1.13 0.51 Present study SIC1-GFP 62 67 1.08 ND NTAIL 15 20 1.33 36 2.40 19 35 27 ± 2 1.42 0.77 Longhi et al. [34] PNT 25 34 1.36 115 4.60 23 46 41 ± 2 1.78 0.89 Karlin et al. [30] and present study SIC1 33 39 1.18 50 1.51 25 53 30 ± 2 1.20 0.56 Brocca et al. [32] GFP 29 30 1.03 38 1.31 25 51 27 ± 2 1.08 0.53 Present study I. Sambi et al. Ordered and disordered protein domains FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4443 behaviour of their single components because isolated NTAIL is less extended than isolated PNT. The struc- tural disorder and flexibility typical of isolated NTAIL is maintained and appears to increase in the fusion, resulting in a Stokes radius that is even higher than expected from the mean of the NTAIL and GFP radii. By contrast, the high flexibility of PNT is not reflected in PNT-GFP, suggesting that structural modifications of PNT occur in the fusion protein, in agreement with the CD data. Because isolated NTAIL is less unor- dered than isolated PNT but their GFP fusions show opposite behaviours, these experiments further indicate that specific, rather than generic, interactions occur. CD spectra in the near ultraviolet region (250– 350 nm), also known as the aromatic region, reflect the symmetry of the aromatic amino acid environment and, consequently, characterize the protein tertiary structure. Proteins with rigid tertiary structure are typi- cally characterized by intense near-UV CD spectra, with unique fine structure, which is reflective of the unique asymmetric environment of individual aromatic residues. Conversely, IDPs are characterized by low intensity near-UV CD spectra with low complexity [41]. Accordingly, the near-UV CD spectrum of GFP shows a very pronounced peak at 280 nm, whereas the spectra of the IDPs are very flat, with no such a clear peak being detectable (Fig. 6A). Notably, the spectra of GFP linked to a disordered moiety are much smoother, with the decrease in the intensity of the peak being IDP-dependent. Indeed, the spectrum of the PNT-GFP fusion protein reflects a higher extent of order than that of GFP fused to NTAIL or to SIC1 (Fig. 6A), in agreement with the data inferred from both far-UV CD spectroscopy and size exclusion chro- matography analyses. In the same vein, the visible CD spectra (Fig. 6B) of GFP alone, as well as of GFP fusion proteins, show a very pronounced negative peak at 517 nm, with an intensity in the the order: GFP > PNT-GFP > NTAIL-GFP > SIC1-GFP. This peak reflects the asymmetric and therefore rigid environment of the green chromophore. The gradual reduction in the intensity of the peak in the fusion proteins is indic- ative of progressive loss of ordered structure as PNT, NTAIL or SIC1 are added (Fig. 6B). In conclusion, near and visible CD data are in good agreement with the data provided by far-UV and size- exclusion chromatography studies and, taken together, they converge to show that PNT-GFP is the most compact and ordered fusion protein, whereas SIC1- GFP is the most disordered one. All the results obtained in the present study so far point to reciprocal and different effects of the two moie- ties of the fusion. However, they still do not unravel whether one of the two domains is more affected in its conformation; in other words, whether order prevails on disorder or vice versa. In an attempt to assign these effects to a specific domain, we analyzed changes in GFP fluorescence and resistance to proteolysis of the fusion proteins. GFP stability is not affected by fusion with the disordered domain, whereas IDPs are only marginally protected from proteolysis by the linked GFP The presence of a natural chromophore in the globular part of the fusion provides a sensitive probe for assess- ing possible conformational changes. The fluorescence emission spectra of GFP, NTAIL-GFP and PNT-GFP shared the typical features of the GFP chromophore, with a well-defined peak at 527 nm and a shoulder at A B Fig. 6. Near-UV and visible CD spectra for tertiary structure analy- sis. CD spectra acquired in the near-UV (A) and in the visible (B) wavelength range. Spectra were recorded in 10 m M sodium phos- phate (pH 7.5) at 20 °C. Ordered and disordered protein domains I. Sambi et al. 4444 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 570 nm [43]. The GFP and PNT-GFP emission peaks at 527 nm were almost superimposable, whereas the fluorescence intensity of the corresponding peak in NTAIL-GFP was lower. However, on the basis of the higher scattering peak of NTAIL-GFP at 475 nm, such a decrease can likely be attributed to partial pre- cipitation of the protein rather than to conformational changes (Fig. 7). When denaturation experiments were performed, both fusion proteins displayed transitions in the emitted fluorescence in the temperature range 75–80 °C, which is similar to those observed with the isolated GFP (data not shown). Such temperature values are slightly lower than the ones obtained by CD analysis, as expected for a technique that specifically targets the active site instead than averaging the whole protein secondary structure content. The above observa- tion rules out any effect by the covalently linked IDP on GFP stability, at least in the protein regions around the chromophore or critical for its stabilization, and is in agreement with the results of the spectroscopic analyses described above, where the GFP moiety, both alone and IDP-linked, proved unable to recover its native confor- mation after thermal unfolding. Globular proteins are rather resistant to proteases, whereas the extended structure of IDPs makes them prone to proteolytic attacks [4,5,41,44,45]. For this rea- son, and in view of understanding which domain is affected by structural rearrangements, we assessed whether the presence of GFP is able to protect the unstructured part of the fusion or, in contrast, GFP becomes more protease-accessible when linked to an IDP. In Fig. 8, we show a time-course analysis of a limited tryptic digestion of NTAIL-GFP and PNT- GFP, as well as of their isolated IDP moieties. In these experiments, GFP was very resistant to degradation even with enzyme : substrate molar ratios as high as 1 : 40 and an incubation time of up to 1 h (data not shown), whereas both IDPs started to degrade after 1 min of tryptic digestion, and were no longer detect- able after 5 min (Fig. 8). A significant degradation of NTAIL was already apparent in the absence of the enzyme (t 0 in Fig. 8A), consistent with a high prote- ase-susceptibility of this protein. Interestingly, a fragment of the same apparent molecular mass (approximately 17 kDa) was also observed in the sam- ple containing NTAIL-GFP before the addition of trypsin (see t 0 in Fig. 8A), suggesting that fusion with GFP would not protect this specific proteolytic site within NTAIL. As shown in Fig. 8A, after 20 min of incubation, full-length NTAIL-GFP disappeared and a band of the same molecular mass of GFP became Fig. 7. Fluorescence emission spectra of NTAIL-GFP, PNT-GFP and GFP at 20 °C. Proteins were excited at 474 nm and spectra were recorded in the range 465–620 nm in 10 m M sodium phosphate (pH 7.5) at 20 °C. A B Fig. 8. Limited proteolyis of NTAIL-GFP, PNT-GFP and their compo- nent proteins. Two micrograms of purified proteins were incubated with trypsin at a 1 : 400 enzyme : substrate molar ratio for 1, 2, 5, 10, 20 and 60 min. Samples were separated on 16% SDS ⁄ PAGE and stained by Coomassie. (A) NTAIL-GFP, NTAIL and GFP. (B) PNT-GFP, PNT and GFP. M, molecular weight markers; 0¢, untreated samples. The ‘framed’ bands were further analyzed by MS (Fig. S3). I. Sambi et al. Ordered and disordered protein domains FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4445 detectable (Fig. 8A). In the course of incubation, a fragment with an apparent M r of 32 kDa (i.e. bigger than GFP) accumulated and persisted also after 1 h of digestion (Fig. 8A, box a). Isolated PNT migrated as a unique band in the con- trol sample but underwent fast degradation upon tryp- tic treatment with disappearance of the full-length polypeptide as early as after 5 min of incubation. Pro- teolysis of PNT-GFP proceeded with the formation of a relatively stable fragment with an apparent mass of 31 kDa (Fig. 8B, box b), in addition to that corre- sponding to GFP alone, already after 1 min of incuba- tion (Fig. 8B). Persistent protein fragments (see ‘framed’ bands a and b in Fig. 8) were processed by tryptic in-gel diges- tion and the resulting peptides were analyzed by MS ⁄ MS (Fig. S3). The M r , as determined by MS, of band a from NTAIL-GFP was 31.6 kDa and that of band b from PNT-GFP was 30.8 kDa. Sequencing showed that these protease-resistant fragments encom- pass the trypsin cutting sites at position 128 in NTAIL-GFP and at positions 226, 235 and 236 of PNT-GFP, respectively. These results indicate that the complete proteolytic digestion of both IDPs requires longer incubation when they are fused with GFP, with a proteolytic fragment still containing part of the IDP being detectable after as long as 60 min of incubation in both cases (Fig. 8). That the GFP sensitivity towards proteolysis was not affected by its linkage to an unstructured part was checked in two additional experiments. Western blotting analysis of a time- course digestion (up to 20 min) of NTAIL-GFP and PNT-GFP ruled out the presence of fragments react- ing with anti-GFP antibodies smaller than full-length GFP (Fig. S4). Moreover, the fragment of approxi- mately 20 kDa produced from PNT-GFP after 20 min of tryptic digestion (Fig. 8B, band c) was found to span the same amino acid sequence as the band of the same size that was detectable after 2 min of digestion of PNT alone (Fig. 8B, band d). This protein fragment encompasses a region of PNT upstream that is in band b (Fig. S3), thus ruling out the possibility that it could correspond to a GFP proteolytic frag- ment. On the basis of these two lines of experimental evidence, we concluded that the proteolytic resistance of GFP is not affected by the presence of the fused IDP. In both fusion proteins, proteolysis occurs within the unstructured part only and proceeds from the N-terminus towards the GFP moiety, resulting in the generation of a trypsin-resistant fragment that contains GFP after 1 h of incubation. The persistence of GFP in these fragments, besides highlighting its resistance towards proteolysis, also suggests protection of the C-terminal region of the IDP by the GFP moiety. However, we cannot exclude the possibility that pro- tection only arises from steric hindrance (i.e. from a reduced substrate accessibility to trypsin), rather than being the result of local structural rearrangement within the IDP. How do ordered and disordered parts affect each other? In conclusion, we have observed that different IDPs fused to the same globular protein result in polypep- tides with distinctive secondary structure content and compactness that are not merely the average of their two components. The finding that their overall struc- ture and compactness are not consistent with those that are predicted on the basis of the behaviour of the isolated IDP was intriguing. Indeed, although PNT alone is more flexible than NTAIL, PNT-GFP is by far more structured and compact that the NTAIL fusion. This observation may suggest that linkage with GFP confers the two IDPs with folding propensities that differ from those of the isolated NTAIL and PNT proteins. Nonetheless, our attempts to highlight spe- cific structural rearrangements within either the IDP or the GFP moiety that could account for the specific conformational features observed were hindered by the complex nature of proteins. Association with a disor- dered moiety left GFP almost unchanged, whereas the IDP was marginally stabilized towards proteolysis. However, despite the higher compactness of the PNT- GFP fusion protein with respect to NTAIL-GFP, no higher proteolytic resistance of PNT-GFP could be detected. It could be speculated that the high flexibility of IDPs prevents the formation of stable interactions, causing delocalized structural rearrangements that failed to manifest in the experiments conducted in the present study. Materials and methods Construction of expression plasmids The NTAIL-GFP, PNT-GFP and SIC1-GFP constructs were obtained in two steps: the single IDP-encoding sequences were cloned in the pET22 plasmid (Novagen, Madison, WI, USA) and then the GFP encoding sequence was inserted downstream. The cloning strategy was differ- ent in each case and is described below. The DNA fragment encoding NTAIL with a hexahisti- dine tag fused to its N-terminus was obtained by PCR from the pDest14 ⁄ N TAILHN plasmid [36]. To remove the NcoI Ordered and disordered protein domains I. Sambi et al. 4446 FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS restriction site at position 321, amplification was carried out in two separated reactions yielding products N 1 (from nucleotides 1–330) and N 2 (from nucleotides 331–396). N 1 was amplified using a forward primer (FWN 1 :5¢-TACCG TTAACATCGATATGCATCATCATCATCATCATAC-3¢), designed to introduce a ClaI restriction site at nucleotide position –6 and a reverse primer (REVN 1 :5¢-CCTGCC ATTGCTTGCAGCC-3¢) that introduced a silent mutation at nucleotide position 321 resulting in the suppression of the NcoI site. Product N 2 was amplified with a forward pri- mer (FWN 2 :5¢-GGCTGCAAGCAATGGCAGG-3¢) that introduced the same silent mutation as above at nucleotide position 321 and a reverse primer (REVN 2 :5¢-ATCGCC ATGGTCCCGGGCATATGGGATCCCTGGAAGTACA GGTTTTCGTCTAGAAGATTTCTGTC-3¢) designed to remove the NTAIL stop codon and to introduce a fragment encoding a TEV cleavage sequence and a NcoI restriction site at position +38 after the end of the NTAIL sequence. N 1 and N 2 were mixed, digested with DpnI to remove the methylated DNA template, and used as the template in a PCR reaction with primers FWN 1 and REVN 2 to yield the complete NTAIL amplification product. The DNA fragment encoding PNT with an N-terminal hexahistidine tag was obtained by PCR using the pET21a ⁄ PNT- H6 plasmid [30] as the template. The forward primer (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to insert a ClaI restric- tion site at nucleotide position )6, whereas the reverse primer (5¢ -ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC CC-3¢) was design ed to remove the stop codon and to introduce a DNA fragment encoding a TEV cleavage sequence and a NcoI restriction site at position +38 after the end of the PNT sequence. The DNA sequence encoding SIC1 with a hexahistidine tag fused to its N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI restriction site at nucleotide position –6 and a reverse primer (5 ¢-A TCGCCATGGTC CCGGGCATATGGGATCCCTGGAAGTACAGGTTTT CGCCATGCTCTTGATCCC-3¢) designed to remove the stop codon and to introduce a DNA fragment encoding a TEV cleavage sequence and a NcoI restriction site at posi- tion +38 after the end of the SIC1 gene fragment. PCR reactions contained 2.5 mm dNTPs, 5 lm of each primer, 10 ng of plasmid DNA and 5 U of Triple MasterÔ DNA Polymerase (Eppendorf, Hamburg, Germany). The amplification program was: after a first denaturation step at 94 °C for 5 min, 25 cycles of 20 s at 94 °C, 20 s at 50 ° C and 2 min at 72 °C were performed, followed by a final elongation step of 10 min at 72 °C. All PCR products (NTAIL, PNT and SIC1) were digested with DpnI and purified by precipitation with ethanol, restricted with ClaI and NcoI, checked by agarose (0.8%, w ⁄ v) gel electrophoresis and purified from the gel (QIAquick Gel Extraction Kit; Qiagen, Valencia, CA, USA). The pET22 vector was digested with NdeI, filled-in with the Klenow fragment of the E. coli DNA polymerase I (New England Biolabs, Beverly, MA, USA) to produce blunt ends, and finally cleaved with NcoI. In this way, the sequence pelB, allowing targeting to the periplasm of pro- teins expressed from pET22, was removed. The digested PCR products and pET22 were ligated with T4 Ligase (New England Biolabs). The final constructs are referred to as pET ⁄ NTAIL, pET ⁄ PNT and pET ⁄ SIC1. The GFP gene (cloned from a pET19b ⁄ GFP plasmid) was then inserted downstream NTAIL, PNT and SIC1 at the NcoI and ScaI sites to obtain pET ⁄ NTAIL-GFP, pET ⁄ PNT-GFP and pET ⁄ SIC1-GFP. These constructs encode for fusion proteins bearing a 14 residues linker containing the TEV cleavage sequence between the two components. The final constructs were transformed into the E. coli DH5a strain (Novagen) and the sequence of their ORFs was checked by DNA sequencing on both strands. Expression and purification of fusion proteins The E. coli BL21[DE3] strain (Novagen) was used as the host for heterologous expression. Transformed cells were grown overnight at 37 °C in low-salt LB medium contain- ing 100 mgÆL )1 ampicillin, diluted 1 : 50 in 200 mL of the same broth and incubated at 37 °C until until D 600 of 0.4– 0.5 was reached. Induction was performed by adding 100 lm isopropyl thio-b-d-galactoside. Cells were then grown at 37 ° C for either 2 h when expressing single IDPs or for 6 h when expressing fusions and GFP. Cells were collected by centrifugation and resuspended in 2 mL of lysis buffer (50 mm sodium phosphate, pH 8.0, 300 mm NaCl, 5 mm imidazole) containing the protease inhibitors cocktail P8465 (Sigma-Aldrich, St Louis, MO, USA). After 20 min of incubation on ice, cells were dis- rupted by sonication (four cycles of 10 s each at 50% power output). Cell extracts were centrifuged for 30 min at 10 000 g at 4 °C and the His-tagged proteins recovered as soluble proteins from the supernatant. They were then purified by immobilized metal-affinity chromatography on aNi 2+ -nitrilotriacetic acid resin (Qiagen). The clarified lysate was added to a pre-packed resin suspension (2 mL of resin per 200 mL of culture), eluted by gravity and then reloaded four or five times on the column. After washing with 50 mm sodium phosphate (pH 8.0), 300 mm NaCl buffer containing increasing concentrations of imid- azole (25–50 mm), proteins were eluted with 50 mm sodium phosphate (pH 8.0), 300 mm NaCl and 250 mm imidazole. When required, buffer exchange was performed by gel filtration on PD-10 columns (GE Healthcare, Mil- waukee, WI, USA) and samples were concentrated with a I. Sambi et al. Ordered and disordered protein domains FEBS Journal 277 (2010) 4438–4451 ª 2010 The Authors Journal compilation ª 2010 FEBS 4447 [...]... Journal compilation ª 2010 FEBS 4449 Ordered and disordered protein domains I Sambi et al 10 Iakoucheva LM, Brown CJ, Lawson JD, Obradovic Z & Dunker AK (2002) Intrinsic disorder in cell-signaling and cancer-associated proteins J Mol Biol 323, 57 3–5 84 11 Cheng Y, LeGall T, Oldfield CJ, Dunker AK & Uversky VN (2006) Abundance of intrinsic disorder in protein associated with cardiovascular disease Biochemistry... of a- helices, b-strands, b-turns and unordered regions of the individual intrinsically unstructured proteins and GFP moieties Analytical gel filtration and calculation of Stokes radii ¨ Gel filtration was performed on an AKTA purifier liquidchromatography system (GE Healthcare), using a prepacked, 30 · 1 cm SuperdexTM 75 HR column (GE Healthcare) Chromatography was carried out at room temperature in 50...Ordered and disordered protein domains I Sambi et al MicroconÒ Ultra-15 centrifugal filter device (molecular mass cut-off, 10 000 Da) (Millipore Corp., Billerica, MA, USA) Protein fractions were analyzed on 12% polyacrylamide gels stained by GelCode Blue (Pierce, Rockford, IL, USA) Proteins concentration was determined with the Bradford assay using BSA as the standard CD The CD spectra of proteins. .. S, Iakoucheva LM, Obradovic Z & Dunker AK (2009) Unfoldomics of human diseases: linking protein intrinsic disorder with diseases BMC Genomics 10(Suppl 1), S7 18 Durand F, Dagkessamanskaia A, Martin-Yken H, Graille M, Van TilbeurghH, Uversky VN & Francois JM (2008) Structure-function analysis of Knr4 ⁄ Smi1, a newly member of intrinsically disordered proteins family, indispensable in the absence of a. .. I.S acknowledges financial support from the EXTRA programme of UNIMIB-Cariplo, allowing her to carry out part of this work in Marseille The authors wish to thank Antonino Natalello and Silvia Maria Doglia for their assistance with the fluorescence spectroscopy, as well as for critically reading the manuscript We are indebted to Maria Samalikova for performing the mass spectrometry We also wish to thank... VN, Lotti M, Vanoni M, Alberghina L & Grandori R (2009) Order propensity of an intrinsically disordered protein, the cyclin-dependent-kinase inhibitor Sic1 Proteins 76, 73 1–7 46 33 Mittag T, Orlicky S, Choy WY, Tang X, Lin H, Sicheri F, Kay LE, Tyers M & Forman-Kay JD (2008) Dynamic equilibrium engagement of a polyvalent ligand with a single-site receptor Proc Natl Acad Sci USA 105, 1777 2–1 7777 34 Longhi... nucleocapsid protein J Virol 83, 1037 4–1 0383 30 Karlin D, Longhi S, Receveur V & Canard B (2002) The N-terminal domain of the phosphoprotein of Morbilliviruses belongs to the natively unfolded class of proteins Virology 296, 25 1–2 62 31 Karlin D, Ferron F, Canard B & Longhi S (2003) Structural disorder and modular organization in Paramyxovirinae N and P J Gen Virol 84, 323 9–3 252 32 Brocca S, Samalikova M,... dichroism spectra to estimate protein secondary structure Nat Protoc 1, 287 6–2 890 36 Bourhis JM, Receveur-Brechot V, Oglesbee M, Zhang X, Buccellato M, Darbon H, Canard B, Finet S & Longhi S (2005) The intrinsically disordered C-terminal domain of the measles virus nucleoprotein interacts with the C-terminal domain of the phosphoprotein via two distinct sites and remains predominantly unfolded Protein Sci 14,... Mapping alpha-helical induced folding within the intrinsically disordered C-terminal domain of the measles virus nucleoprotein by site-directed spin-labeling EPR spectroscopy Proteins 73, 97 3–9 88 39 Kavalenka A, Urbancic I, Belle V, Rouger S, Costanzo S, Kure S, Fournel A, Longhi S, Guigliarelli B & Strancar J (2010) Conformational analysis of the partially disordered measles virus N(TAIL)-XD complex by... theoretical average ellipticity values per residue, [h]Ave, expected for a protein mixture in which no secondary structure rearrangements take place upon mixing equimolar amounts of protein 1 and protein 2 were calculated as: ½hŠAve fð½hŠ1 Á n1 Þ þ ð½hŠ2 Á n2 Þg ¼ ðn1 þ n2 Þ where [h]1 and [h]2 correspond to the measured mean ellipticity values per residue of proteins 1 and 2, respectively, 4448 and n1 and . How disorder in uences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 ,. struc- tural disorder and flexibility typical of isolated NTAIL is maintained and appears to increase in the fusion, resulting in a Stokes radius that is even