case the cfd software fluent was used as a tool to examine the u and v velocity patterns and magnitudes with properly scaled geometry developed in gambit to run the simulation program in matlab for concentration and temperature distribution

Conversion of saline water to fresh water using air gap membrane distillation (AGMD)

Ngày tải lên : 11/09/2015, 09:57

... coolant plate to enhance the production by increasing heat and mass transfer simultaneously • Analysis of heat and mass transfer a in a 2-dimensional domain and investigate the temperature and concentration ... MD was intended for desalination, to have a deeper understanding, it was necessary to investigate the transport process and parameters that influence the production Therefore, the review was ... stage, the pressure is maintained at a lower value than that in the previous stage Hence, the entrance of heated seawater into the flash chamber causes vigorous boiling caused by flashing at low...

248
646
0

Báo cáo hóa học: " Global attractor of the extended FisherKolmogorov equation in Hk spaces" pot

Ngày tải lên : 20/06/2014, 22:20

... global attractor in H space, and the global attractor of this equation consists of equilibria with their stable and unstable manifolds Thus, each trajectory has to converge to a critical point ... Fisher-Kolmogorov equation (1.1) in any kth-order space Hk Theorem 3.2 For any a ≥ the extended Fisher-Kolmogorov equation (1.1) has a global attractor A in Ha, and A attracts any bounded set of Ha in the Ha-norm ... > T, u0 ∈ U Then, Equation (2.1) has a global attractor A ⊂ Xα which attracts any bounded set of Xa in the Xa-norm For Equation (2.1) with variational characteristic, we have the following existence...

10
314
0

THE COMPLEX MONGEAMPERE EQUATION IN ` DOMAIN OF C n

Ngày tải lên : 14/10/2015, 08:01

... exists a, r ∈ F(B (a, r), a, r ) such that u a, r v in B (a, r) and (ddc a, r )n = µ in B (a, r) Put ua,r = a, r u in B (a, r), in Ω\B (a, r) Since a, r = u in ∂B (a, r) so ua,r ∈ P SH(Ω) We have u = ua,r ... such that w u f and (ddc u) n = µ in Ω In the following, we give an example to show that there exists a bounded domain Ω and the non-negative measure µ in Cn such that the MongeAmp`ere equation ... Lemma 3.3 in [1] and Lemma 3.6 in [1] we get max(ua,rj+1 , ua,rj ) = ua,rj in B (a, rj+1 ) Thus, ua,rj+1 ua,rj in B (a, rj+1 ) This proves the claim Put ga,r = limj→+∞ ua,rj We have u g v in Ω...

8
179
0

Tài liệu Đề tài " Global well-posedness and scattering for the energy-critical nonlinear Schr¨odinger equation in R3 " docx

Ngày tải lên : 16/02/2014, 06:20

... concentration at arbitrary locations in spacetime In [12], [13] this was achieved by translating the origin in the integrand of (1.6) to an arbitrary point y, and averaging against the L1 mass density |u( y)|2 ... Andrew Hassell, Sergiu Klainerman, and Jalal Shatah for interesting discussions related to the interaction Morawetz estimate, and Jean Bourgain for valuable comments on an early draft of this paper, ... conjugates Thus for instance 3u2 v |v| 2 +9 |u| 2 |v| 4 + 3u2 v |v| 2 qualiﬁes to be of the form O (u2 v ), and similarly we have |u + v| = |u| + |v| + (1.14) O(uj v 6−j ) j=1 and (1.15) |u + v| (u + v) ...

100
434
0

Tài liệu Báo cáo khoa học: Oligomerization of the Mg2+-transport proteins Alr1p and Alr2p in yeast plasma membrane pptx

Ngày tải lên : 19/02/2014, 06:20

... B2-linker-CCAATAGCTGGCCAAGAACC B2-linker-ATTCATACCGAAAAGACC ATTTTTATGAGAAAACGTGAAAAAACTTC GTAATGTCGTCCTTATCGTACGCTGCA GGTCGAC AAAGATCTGCCGACCTACCATAGCGGTC ATGTTAATTGTAACGGCATCGATGAATT CGAGCTCG ... CAGGGTATGGATGAAACGGTTGC TGATCCCGAAGTGGAAGTAGAGC TTAAGTTCTAATGCGAGGCCATCC TTCGTTCACTGTGCCTTTGATGG ACCAAGAGAGGTATCTTGACTTTACG GACATCGACATCACACTTCATGATGG strains AG02 and AG012 (alr1D, alr2D), a disruption ... TTCGAAAAATGCAGCATT TCTACAAAAGCCCTCCTACC CCAGGAGAGAATTCAAGTATTGC B C ALR1 ALR-c36 ALR-c63 ALR-c96 ALR-c137 ALR1-revers ALR1-SU5¢ ALR1-SU3¢ ALR2-SU5¢ ALR2-SU3¢ ALR-c36SU3¢ ALR-c63SU3¢ ALR-c96SU3¢ ALR2-HIS-f...

14
607
0

Tài liệu Báo cáo khoa học: Hyperactive antifreeze protein in ﬂounder species The sole freeze protectant in American plaice docx

Ngày tải lên : 20/02/2014, 01:20

... gene, 5a [16], using a signal peptide prediction program Sequence Source XIDPAARAAAAA IDPAAKAAAAA SIDPGTKAASAA NIDPAVKAAAA Winter ﬂounder AFP 5a hypothetical gene product American plaice AFP Yellowtail ... ([h]222) was measured as the sample was warmed from to 30 °C The magnitude decreased slightly when the sample was warmed above °C, although the ﬁrst substantial changes occurred at °C as the magnitude ... melting and renaturation curves were examined A sample of protein ( 4.2 lm) was dialyzed against 10 mm sodium phosphate (pH 7.0) and, as above, the dialysis buffer was used to establish the baseline...

11
469
0

Tài liệu Báo cáo khoa học: Reconstitution of coupled fumarate respiration in liposomes by incorporating the electron transport enzymes isolated from Wolinella succinogenes docx

Ngày tải lên : 21/02/2014, 03:20

... electron transport from H2 to fumarate was measured in the various preparations (Fig 2A) The activity increased with increasing amounts of detergent until a maximum was reached at the critical ratio ... membrane at various concentrations of TPP+ The internal TPP+ concentration (Ti)n+1 was calculated from an assumed value of (Ti)n (Eqn 1) Using the value so obtained, calculation was repeated until ... found to accumulate SCN, and the H+/e ratio was measured to be close to [15] In these vesicles, hydrogenase is oriented to the inside and fumarate reductase to the outside Therefore, if fumarate...

10
569
0

Báo cáo khoa học: Isothermal unfolding studies on the apo and holo forms of Plasmodium falciparum acyl carrier protein Role of the 4¢-phosphopantetheine group in the stability of the holo form of Plasmodium falciparum acyl carrier protein docx

Ngày tải lên : 16/03/2014, 10:20

... were subjected to thrombin cleavage to remove the histidine tag from the protein Approximately 90% ACP cleavage was achieved, and uncleaved ACP was removed by passage through an Ninitrilotriacetic ... 0.09 Acyl-ACP synthesis assay with holo-ACP E coli acyl-ACP synthase (AAS) utilizes holo-ACP as a substrate and converts it to acyl-ACP E coli AAS also utilizes fatty acids with various chain lengths ... His-tag The N-terminus His-tag of ACP was cleaved by the addition of U of thrombin from bovine plasma (Sigma-Aldrich) per mg of ACP and incubation at 25 C for h The uncleaved ACP was separated...

14
419
0

Báo cáo "Quantum kinetic equation in the quantum hadrondynamics (QHD-I) model " pptx

Ngày tải lên : 22/03/2014, 11:20

... yields unambiguous separation of the vacuum and in- medium effects We obtained the kinetic equation for fermion in the QHD-I model, including the fermion’s interaction with the neutral scalar and vector ... equilibrium processes in the medium of finite density and temperature We have presented and solved the renormalized effective Dirac equation by Laplace transform The formulation of the initial value ... to approach equilibrium Our next paper is intended to be devoted to the quantum kinetic equation for scalar, pseudoscalar and vector meson in the QHD.II model Acknowledgements The authors would...

10
165
0

steinmetz cp discussion on 'the effect of iron in distorting alternating-current wave-form

Ngày tải lên : 04/06/2014, 12:44

... magnetic induction: H B-Il a+ bH as an empirical law, however, but rather as a rational equation approximating the B-H curve, and the deviations of the induction curve from this equation as due to secondary ... limit the vector diagram to the representation of physical action and I always use the idea of a rotating vector for representing in the students' mind the successive instantaneous values of current ... voltages are not quite in phase with the induced voltage, but in phase with each other, since the machines are connected together The triple-f requency voltages so give a resultant, and thus a current...

20
439
0

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Ngày tải lên : 20/06/2014, 22:20

... functional equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis ... approach, we prove the Hyers-Ulam stability of the functional equation (1) in fuzzy normed spaces In the rest of the article, assume that X is a vector space and that (Y, N) is a fuzzy Banach space ... ≤ for all n Î N A trivial example of a non-Archimedean valuation is the function | · | taking everything except for into and |0| = Definition 2.1 Let X be a vector space over a field K with a...

14
479
0

Báo cáo hóa học: " On the stability of an AQCQ-functional equation in random normed spaces" potx

Ngày tải lên : 21/06/2014, 01:20

... Y satisfying (1.4) can be realized as the sum of an additive mapping, a quadratic mapping, a cubic mapping and a quartic mapping This paper is organized as follows: In Section 2, we prove the ... Hyers-Ulam stability of the additive-quadratic-cubic-quartic functional equation (1.4) in RN-spaces for an odd case In Section 3, we prove the Hyers-Ulam stability of the additive-quadratic-cubicquartic ... Art ID 923476 Eshaghi Gordji, M, Zolfaghari, S, Rassias, JM, Savadkouhi, MB: Solution and stability of a mixed type cubic and quartic functional equation in quasi-Banach spaces Abstr Appl Anal...

12
395
0

báo cáo hóa học: " On the stability of pexider functional equation in non-archimedean spaces" pot

Ngày tải lên : 21/06/2014, 02:20

... G, Rassias, THM: Stability of Functional Equations in Several Variables Birkhäuser, Basel (1998) Jung, SM: Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis Hadronic ... conceived of the study, and participated in its design and coordination All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... that V1 is a normed space and V2 is a complete non-Archimedean space For any mapping f : V1 ® V2 , we define two mappings Fe and Fo as Saadati et al Journal of Inequalities and Applications 2011,...

11
325
0

báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx

Ngày tải lên : 21/06/2014, 02:20

... equivalent Volterra integral formulation for problems (1.1) to (1.4) In Section 3, and 5, boundedness, comparisons results and asymptotic behavior regarding particular initial and boundary data ... behavior for the solution were obtained In other frameworks, a class of heat conduction problems characterized by a uniform heat source given as a multivalued function from ℝ into itself was studied ... Bariloche, Av Bustillo 9500, 8400 Bariloche, Argentina 3Depto de Matemática, Universidad Austral, Paraguay 1950, S2000FZF Rosario, Argentina 4Facultad de Ingenier a, Universidad Nacional de Salta, Buenos...

17
520
0

Báo cáo hóa học: " Study of the vertical transport in p-doped superlattices based on group III-V semiconductors" pdf

Ngày tải lên : 21/06/2014, 05:20

... of the acceptors in the nitrides (around 0.1-0.2 eV above the top of the valence band in the bulk materials), in contrast with the case of GaAs-derived heterostructures, in which acceptor levels ... (Max) of a particular miniband εq ,v Its value rises continuously as EF spans the interval between the bottom and the top of this miniband For E F smaller than the minimum eff (Min) of this miniband, ... known The relaxation time for all the minibands is assumed to be the same In order to describe qualitatively the origin of the peculiar behavior as a function of EF , Equation (5) is analyzed with...

6
360
0

Báo cáo hoa học: " On the stability of a mixed type functional equation in generalized functions" ppt

Ngày tải lên : 21/06/2014, 20:20

... initial values of solutions of the heat equation as a special case of the results as in [24] In this case, the condition (i) in the above theorem is replaced by the following: For every ε > there ... i=1 as the equation for the spaces of generalized functions Using the fundamental solution of the heat equation, we solve the general solution and prove the Hyers– Ulam stability of this equation ... Hyers–Ulam–Rassias Stability of Functional Equations in Nonlinear Analysis Springer Optimization and Its Applications Springer, New York (2011) [7] Kannappan, Pl: Functional Equations and Inequalities with Applications...

21
299
0

Báo cáo hóa học: " Research Article New Trace Bounds for the Product of Two Matrices and Their Applications in the Algebraic Riccati Equation" potx

Ngày tải lên : 22/06/2014, 02:20

... fact, for i T i ≤ T V T AU 1, 2, , n, we have λi V T AU V T AU T λi V T λi AUV T AUV T AUV T λi AS AUV T T T V 2.35 10 Journal of Inequalities and Applications Then 2.34 can be rewritten as ... dk V T AU < σ k B dj V T AU − σ j B dj V T AU − σ k B dk V T AU σj B −σk B dk V T AU − dj V T AU ≥ 2.26 Journal of Inequalities and Applications We use d V T AU to denote the vector of d V T AU ... such that dj V T AU dk V T AU , then σ j B dk V T AU > σ k B dj V T AU − σ j B dj V T AU − σ k B dk V T AU σj B −σk B dk V T AU − dj V T AU ≤ 2.22 We use d V T AU to denote the vector of d V...

18
456
0

Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Ngày tải lên : 22/06/2014, 02:20

... restricted domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of ... Rassias, Stability of Functional Equations in Several Variables, Progress in Nonlinear Diﬀerential Equations and Their Applications, 34, Birkh¨ user, Boston, Mass, USA, 1998 a 12 Journal of Inequalities ... Journal of Inequalities and Applications in the spaces of generalized functions Also, we obtain the general solution and prove the Hyers-Ulam stability of 1.1 in the spaces of generalized functions...

12
311
0

Báo cáo hóa học: " Research Article Stability of Cubic Functional Equation in the Spaces of Generalized Functions" potx

Ngày tải lên : 22/06/2014, 18:20

... Butler-Rassias functional equation,” Journal of Inequalities and Applications, vol 2005, no 1, pp 41–47, 2005 [9] T Miura, S.-E Takahasi, and G Hirasawa, “Hyers-Ulam-Rassias stability of Jordan homomorphisms ... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Diﬀerential Equations and Their Applications, Birkh¨ user, Boston, a Mass, USA, ... where u is the Gauss transform of u Thus inequality (4.3) is converted into the classical functional inequality u ax+ y ,a2 t+s + u ax − y ,a2 t + s − au(x + y,t + s) − au(x − y,t + s) − 2a a2 − u( x,t)...

13
371
0

Báo cáo toán học: "Bounds on the number of bound states for the Schroedinger equation in one and two dimensions " docx

Ngày tải lên : 05/08/2014, 15:20

7
369
0