beginning nor yet created by a new decree of god by which he afterwards willed what he had not before willed

Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Defined by Generalized Ruscheweyh Differential Operator" potx

Báo cáo hóa học: " Research Article A New Subclass of Analytic Functions Defined by Generalized Ruscheweyh Differential Operator" potx

Ngày tải lên : 22/06/2014, 06:20
... 2 Journal of Inequalities and Applications the Hadamard product or convolution f1 ∗f2 of f1 and f2 is defined by ∞ f1 ∗f2 z z an,1 an,2 zn 1.4 n Using the convolution 1.4 , Shaqsi and Darus introduced ... Proceedings of the American Mathematical Society, vol 49, no 1, pp 109–115, 1975 S Owa, “On the distortion theorems I,” Kyungpook Mathematical Journal, vol 18, no 1, pp 53–59, 1978 H M Srivastava and ... discuss the integral means inequalities for functions f ∈ Sλ u, v; α The following definitions of fractional derivatives by Owa also by Srivastava and Owa will be required in our investigation Definition...
  • 12
  • 251
  • 0
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)

Ngày tải lên : 17/04/2013, 16:09
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
  • 137
  • 853
  • 0
Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc

Tài liệu Activity 1.1: Designing a New Type of Motorcycle doc

Ngày tải lên : 17/01/2014, 09:20
... they not like the design of current motorcycles You need to collect information to make an informed decision about the type of motorcycle that will attract new riders After you collect and analyze ... develop the motorcycle Participate in small groups assigned by the instructor Provide at least three sources from which you can try to obtain information Be specific If you want to interview a person, ... person, specify their job or characteristics Indicate at least two questions that you can ask each source Different sources may require different types of questions Assume that the three sources...
  • 4
  • 304
  • 0
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf

Ngày tải lên : 18/02/2014, 00:20
... dilemma—traditionally framed as a social dilemma Social Dilemmas: The Problem of the One and the Many Peter Kollock, author of Social Dilemmas: The Anatomy of Cooperation, explains that, Social dilemmas are ... Network mathematics provides a way to analyze and evaluate the value of social connectivity of an individual or organization As we’ll discover when we look at the catalysis lens, the new technologies ... outside the group an action or reaction among actors that is triggered by an CATALYSIS outside agent a very small amount of catalytic agent can facilitate a very large-scale reaction If we think of...
  • 67
  • 893
  • 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: a new view of palytoxin toxicity ppt

Ngày tải lên : 18/02/2014, 14:20
... [7,8] Italian coasts are not the only seawaters where Ostreopsis species have appear; they have been found in the waters around Spain and Greece as well, indicating that the expansion in the Mediterranean ... C Louzao et al Distortion of the Na+ pump At the cellular level, a broad range of studies have indicated that the Na+ pump or Na+ ⁄ K+-ATPase is the higher-affinity cellular receptor for palytoxin ... Ca2+ channels activated by the initial depolarization of the membrane; (b) Na+–Ca2+ exchanger in reverse mode, which drives Ca2+ into the cells because of the intracellular Na+ influx and membrane...
  • 8
  • 691
  • 0
Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf

Tài liệu UN Global Compact-Accenture CEO Study A New Era of Sustainability in Consumer Goods pdf

Ngày tải lên : 18/02/2014, 21:20
... up to the challenges ahead, and they recognize that—as the Global Compact celebrates its tenth anniversary—this is 'the end of the beginning' and not 'the beginning of the end' in the transition ... a situation in 2010 best summarized as 'the end of the beginning' rather than 'the beginning of the end.' Aligning markets and sustainability outcomes will require constant renewal and adaptation ... competitive advantage in the marketplace Our study found widespread agreement among CEOs about what a new era of sustainability would look like: it is one where sustainability is not a separate strategic...
  • 36
  • 556
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Ngày tải lên : 19/02/2014, 00:20
... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA ... on a human prostate Marathon-Ready cDNA (Clontech, Mountain View, CA, USA) Two fragments were isolated and confirmed by Southern analysis using the internal cDNA fragment as the probe and by DNA...
  • 13
  • 588
  • 0
Life and Physical Sciences Research for a New Era of Space Exploration docx

Life and Physical Sciences Research for a New Era of Space Exploration docx

Ngày tải lên : 05/03/2014, 11:21
... similar population databases (e.g., the Nurses’ Health Study database) Coupling the database with a genetic bank and repository of astronaut samples would ensure the availability of the maximal amount ... technical matters Dr Ralph J Cicerone is president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, ... operational data (e.g., to enable the precision of navigation maneuvers performed by crew) that could be linked to data on crew characteristics and made available for data mining Such a database...
  • 47
  • 606
  • 0
Research Program of the Partnership for a New Generation of Vehicles doc

Research Program of the Partnership for a New Generation of Vehicles doc

Ngày tải lên : 06/03/2014, 15:20
... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory,...
  • 134
  • 466
  • 0
A New Database of Financial Reforms pot

A New Database of Financial Reforms pot

Ngày tải lên : 06/03/2014, 19:20
... Singapore Australia Estonia Latvia South Africa Austria Ethiopia Lithuania Spain Azerbaijan Finland Madagascar Sri Lanka Bangladesh France Malaysia Sweden Belarus Georgia Mexico Switzerland Belgium ... adoption of IAS in Egypt, Pakistan and Malaysia) 24 Table Country Coverage of the Financial Reform Database Country name Albania Ecuador Kenya Russia Algeria Egypt Korea Senegal Argentina El Salvador ... Germany Morocco Taiwan Bolivia Ghana Mozambique Tanzania Brazil Greece Nepal Thailand Bulgaria Guatemala Netherlands Tunisia Burkina-Faso Hong Kong New Zealand Turkey Cameroon Hungary Nicaragua...
  • 30
  • 1.1K
  • 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Ngày tải lên : 07/03/2014, 02:20
... only of a transient nature Our data suggest a sequential model of signaling in which CD95 receptor activation generates early signals at the plasma membrane that lead to the translocation of nuclear ... investigation What is the biological function of nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of ... DDcontaining adaptor protein TRADD also rapidly shuttles between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through...
  • 10
  • 483
  • 0
A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot

A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot

Ngày tải lên : 07/03/2014, 15:20
... to Canada, Australia, Britain and Mexico, with Canada receiving 81% of the total The Monitor Company (1999) estimates that the total dollar loss to the US as a result of economic runaways was ... been accompanied by parallel expansion of the industry (and most notably by an increase in the number of small establishments) in the rest of the US Even so, Southern California remains the primary ... companies work partially in the one tier and partially in the other, and others move erratically in and out of the sphere of operation of the Hollywood is neither just a metaphor nor just a business...
  • 19
  • 703
  • 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

Ngày tải lên : 07/03/2014, 21:20
... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase amy_Aspaw a- amylase CBM20 (Purple of Fig.2) atrActsp acarviose transferase cgtBacag CGTase ... 6 -a- glucosyltransferase (Yellow of Fig 2) 4agtBacfr 4 -a- glucanotransferase 4agtSoltu 4 -a- glucanotransferase 4agt_Arath 4 -a- glucanotransferase 4agt_Orysa 4 -a- glucanotransferase (Dark red of Fig 2) agwdArath a- glucan...
  • 17
  • 476
  • 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Ngày tải lên : 09/03/2014, 01:20
... cases, by means of the syntactic analysis) The word-ends are assigned the kinds of information as described in section In the present system of morphemic analysis, there is no place for the notion ... project of man-machine communication called TIBAQ (Text-and-Inference Based Answering of Questions, cf (Haji~ov@ and Sgall, 1981)) with no pre-arranged data base and with the capacity of self-enriching ... nominative and accusative singular masculine-inanimate, and nominative singular masculine-animate, thus representing the adjectival "normal form,'), which clashes only with /pr# (adverb), being accounted...
  • 8
  • 414
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Ngày tải lên : 14/03/2014, 23:20
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as...
  • 11
  • 396
  • 0
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

Ngày tải lên : 22/03/2014, 18:20
... plots all analyses of the NBS-19, MAR-J1, MZ carbonate and Sigma-carb standards made between January, 2004 and April, 2005 Each data point represents the average of between and 10 analyses of the ... both because of the success of our application of the inorganic calibration to Sumatran Porites and deep-sea D dianthus corals and because the inorganic calibration yielded acceptable temperatures ... The temperature stability of the chilled bath was ± 0.2 °C, that of the room temperature bath was ± °C, and that of heated water bath was ±2 °C After thermally equilibrating, N2 gas (99.96%, Air...
  • 18
  • 472
  • 0
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt

Ngày tải lên : 22/03/2014, 20:20
... all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the reduced ... Gaussian random variables with mean value and vari*This work was carried out, while the first author was a member of the MaPhySto – Centre for Mathematical Physics and Stochastics, funded by the ... unital C ∗ -algebra and denote by GL (A) the group of invertible elements of A Let further A : I → GL (A) be a mapping from an open interval I in R into GL (A) , and assume that A is differentiable,...
  • 66
  • 378
  • 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Ngày tải lên : 23/03/2014, 09:20
... encodes a protein of 412 amino acids and has a calculated molecular mass of 46.5 kDa BLAST-P analysis revealed the highest similarity to other hypothetical proteins and putative hydrolases The most ... GATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAAGTTATTGAGATCGTCG-3¢, respectively (the underlining indicates the modified codon) Mutations were confirmed by sequence analysis of both DNA strands ... significant hits of a New thermostable esterase from Thermotoga maritima BLAST search analysis include a hypothetical protein of Solibacter usitatus (36% identity), a hypothetical protein of Bacteroides...
  • 11
  • 460
  • 0
Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot

Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot

Ngày tải lên : 24/03/2014, 00:21
... Strophanthus gratus plants and a longknown inhibitor of the sodium pump, has been identified in blood plasma, adrenal glands, and the hypothalamus of mammals The adrenal gland as a source of ouabain The surprising ... 29 Masugi, F., Ogihara, T., Hasegawa, T., Sagakuchi, K & Kumahara, Y (1988) Normalization of high plasma level of ouabainlike immunoreactivity in primary aldosteronism after removal of adenoma ... blockade of brain ÔouabainÕ by intraventricular infusion of a ouabain-binding antibody lowered the NaCl-dependent rise in the amount of ACE mRNA, which may indicate that the increase in ACE mRNA...
  • 9
  • 651
  • 0

Xem thêm