Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma Nannan Wu*, Xuyuan Liu*, Xuemei Xu*, Xingxing Fan, Min Liu, Xin Li, Qiping Zhong and Hua Tang Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, China Keywords cell cycle; hepatocellular carcinoma; miRNA; miRNA-373; protein phosphatase catalytic subunit (PPP6C) Correspondence H Tang, Tianjin Life Science Research Center and Basic Medical School, Tianjin Medical University, Tianjin 300070, China Fax: +86 22 23542503 Tel: +86 22 23542503 E-mail: htang2002@yahoo.com *These authors contributed equally to this work (Received January 2011, revised 17 March 2011, accepted April 2011) doi:10.1111/j.1742-4658.2011.08120.x MicroRNAs are a class of small noncoding RNAs that function as key regulators of gene expression at the post-transcriptional level Recently, microRNA-373 (miR-373) has been found to function as an oncogene in testicular germ cell tumors In our study, we found that miR-373 is upregulated in human hepatocellular carcinoma (HCC) tissues as compared with adjacent normal tissues, and promotes the proliferation of the HCC cell lines HepG2 and QGY-7703 by regulating the transition between G1-phaseand S-phase The gene encoding the protein phosphatase catalytic subunit (PPP6C ), a negative cell cycle regulator, was identified as a direct target gene of miR-373 by use of a fluorescent reporter assay The mRNA and protein levels of PPP6C were both inversely correlated with the miR373 expression level Overexpression of PPP6C abolished the regulation of cell cycle and cell growth exercised by miR-373 in HepG2 cells These results indicate that miR-373 plays an important role in the pathogenesis of HCC, and may be a new biomarker in HCC Our results demonstrate that miR-373 can regulate cell cycle progression by targeting PPP6C transcripts and promotes the growth activity of HCC cells in vitro The downregulation of PPP6C by miR-373 may explain why the expression of miR-373 can promote HCC cell proliferation Introduction Hepatocellular carcinoma (HCC) accounts for 80–90% of liver cancers, and is one of the most prevalent carcinomas worldwide [1] Liver cancer is a complex genetic disease in which the expression of many specific genes, known as oncogenes or tumor suppressor genes, is abnormally changed Previous studies have revealed several genes related to human HCC For example, the cyclin G1 gene is upregulated in HCC [2], and the phosphatase and tensin homolog (PTEN) gene is downregulated in HCC [3] Although focusing on known genes has yielded much new information, previously unknown noncoding RNAs, such as microRNAs (miRNAs), may also provide insights into the biology of HCC MicroRNAs are a group of noncoding singlestranded RNAs,  22 nucleotides in length, that have emerged as an important class of short endogenous RNAs that post-transcriptionally regulate gene expression by base-paring with their target mRNA [4] Several lines of evidence have shown that the six to eight nucleotides at the 5¢-end of miRNAs (positions 1–8) Abbreviations ASO, antisense oligonucleotide; EGFP, enhanced green fluorescence protein; FACS, fluorescence-activated cell sorting; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HCC, hepatocellular carcinoma; miRNA, microRNA; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyl-tetrazolium bromide; PI, proliferation index; PPP6C, protein phosphatase catalytic subunit; SD, standard deviation; shRNA, small hairpin RNA; siRNA, small interfering RNA 2044 FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS N Wu et al are important for target site recognition, and they have been designated as the ‘seed’ region Animal miRNAs target mRNA 3¢-UTRs predominantly by seed sequence complementarity, and are rarely fully complementary; therefore, they function through translational repression rather than cleavage [5] On the basis of this, miRNAs could control as many as 30% of all protein-coding genes [6] MicroRNAs play important roles in developmental timing, and participate in the regulation of processes such as cell fate determination, proliferation, differentiation, and cell death [7–10] Previous studies have identified cancer-specific miRNAs in many types of cancer, including B-cell chronic lymphocytic leukemia [11], colorectal cancer [12,13], lung cancer [14], breast cancer [15], and brain cancer [16,17] A recent study described miR-373 as a tumor suppressor gene in prostate cancer [18]; other studies provided evidence that miR-373 was upregulated in breast cancer, testicular germ cell tumors, and human esophageal cancer [19–21] However, the regulatory effects of miR-373 on the tumorigenesis of other cancers remain to be elucidated In this study, we found, through real time reverse transcription PCR (real time RT-PCR), that miR-373 was overexpressed in human HCC tissues as compared with adjacent normal tissues, and identified the gene encoding protein phosphatase catalytic subunit (PPP6C) as a direct target of miR-373 We also observed that upregulation of miR-373 promoted cell cycle progression through the G1 ⁄ S checkpoint in HCC cells Taken together, our results suggest that miR-373 regulates the proliferation of a human HCC cell line by negatively regulating PPP6C expression MicroRNA-373 functions as an oncogene in HCC Fig Differential expression of miR-373 in HCC tissues The expression level of miR-373 in 26 pairs of HCC tissues (cancer) and matched normal tissues (normal) was detected by real-time RT-PCR Box-plot lines represent medians and interquartile ranges of the normalized threshold values; whiskers and spots indicate 10–90th percentiles and the remaining data points The expression of miR-373 is normalized to U6 small nuclear RNA (*P < 0.05) To determine the expression of miR-373 in human HCC tissues and adjacent normal tissues, we used quantitative real time RT-PCR to detect 26 pairs of HCC samples It was shown that miR-373 expression level was generally and significantly higher in cancer tissues than in adjacent nontumor tissue (Fig 1) Thus, we speculated that miR-373 might be involved the pathogenesis of HCC detected miR-373 levels by real time RT-PCR Expression of miR-373 was increased 4.5-fold in the HepG2 cells transfected with pcDNA3 ⁄ pri-miR-373 as compared with controls; miR-373 ASOs resulted in an  75% reduction of miR-373 levels (Fig 2A) Cell viability of HCC cells transfected with miR-373 ASOs or pri-373 was evaluated with the 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay; miR-373 ASOs reduced cell viability at 48 or 72 h after transfection, whereas pri-373 increased cell viability (Fig 2B) In parallel, we analyzed colony formation and cellular proliferation to assess the effect of miR373 on the proliferative capacity of HCC cells The colony formation rate of HepG2 cells after transfection with miR-373 ASOs was  30% lower than that of HepG2 cells transfected with control oligomers Conversely, transfection with pri-373 increased colony formation by  29% in HepG2 cells (Fig 2C,D) We observed similar results in another HCC cell line, QGY-7703 (Fig 2) These results indicate that miR373 can promote the cell proliferation of HCC cells Alteration of miR-373 affects cell growth of HCC in vitro miR-373 facilitates the G1 ⁄ S-phase transition in HepG2 cells First, we transfected either miR-373 antisense oligonucleotides (ASOs) or an miR-373 expression vector (pcDNA3 ⁄ pri-miR-373, pri-373) into HCC cells, and To explore whether the promotion of proliferation caused by miR-373 in HCC cells is attributable to an alteration in cell cycle progression, we performed Results MicroRNA-373 is upregulated in HCC FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS 2045 MicroRNA-373 functions as an oncogene in HCC N Wu et al Fig Alteration of miR-373 levels affects the growth of HCC cells (A) The miR-373 expression level in HCC cells was effectively altered by transfection of an miR-373 ASO vector or a pri-373 vector as detected by real-time RT-PCR U6 small nuclear RNA was used for normalization (B) HCC cells were transfected with an miR-373 ASO vector or a pri-373 vector The MTT assay was used to determine relative cellular proliferation at 48 and 72 h A570 nm is the absorbance of MTT measured at 570 nm After transfection with miR-373 or pri-373, the 48h and 72-h data points showed a statistically significant difference (72-h data not shown) (C) HCC cells were transfected with an miR-373 ASO vector or a pri-373 vector (D) Cell growth was measured with colony formation assays and proliferation curve assays The data represent the mean ± SD of three different experiments (NC, negative control; *P < 0.05, **P < 0.005, # P < 0.0005) fluorescence-activated cell sorting (FACS) analysis Interestingly, in miR-373 ASO-treated HepG2 cells, the percentage of cells in G1-phase increased to 54%, whereas scramble ASO-treated cells had only 40% of cells in G1-phase The percentage of miR-373 ASOtreated cells in S-phase decreased to 18%, as compared with 31% in the control group (Fig 3A) The proliferation index of miR-373 ASO-treated HepG2 cells was 85.2%, as compared with 150% in controls In contrast, after transfection with pri-373, the percentage of HepG2 cells in G1-phase was 37%, as compared with 50% in the scramble pcDNA3-treated cells, and the percentage of cells in G2-phase was 20%, as compared with 34% in scramble pcDNA3-treated cells (Fig 3B) These results indicate that miR-373 plays an important role in the G1 ⁄ S-phase transition of the cell cycle 2046 miR-373 targets PPP6C and negatively regulates its expression MicroRNAs regulate a variety of cellular activities through regulation of the expression of target genes To determine the mechanism of miR-373-mediated cell cycle dysregulation in HCC cells, we next identified target genes that could be responsible for the effect of miR-373 Taking into consideration that miR-373 was upregulated in HCC tissues (Fig 1), we reasoned that its target genes should be correspondingly downregulated Twelve candidate genes were predicated by three bioinformatics software packages (pictar, targetscan, and microcosm) Among these genes, the tumor suppressor gene PPP6C, which was predicted to have an miR-373-binding site in its 3¢-UTR (Fig 4A), was chosen for further study FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS N Wu et al MicroRNA-373 functions as an oncogene in HCC Fig miR-373 can promote the progression from G1-phase to S-phase in HepG2 cells After transfection with an miR-373 ASO vector or a pri-373 vector, HepG2 cells were detached, rinsed, fixed and stained as described in Experimental procedures Cell cycle phase distribution was analyzed by FACS (A) The fraction of cells in G1-phase was significantly increased in the miR-373 ASO group, and the fraction of cells in S-phase was significantly decreased in the miR-373 ASO group (B) In the pri-373 group, the fraction of cells in G1-phase was significantly decreased The PI increased noticeably in the pri-373 group The data represent the mean ± SD of three different experiments (NC, negative control; *P < 0.05, **P < 0.005) Fig PPP6C is a direct target of miR-373 (A) The PPP6C 3¢-UTR carries one potential miR-373-binding site (B) The direct interaction of miR-373 and PPP6C mRNA was confirmed by a fluorescent reporter assay HepG2 cells were transfected with an EGFP reporter vector together with an miR-373 ASO or a pri-373 vector, and the EGFP intensity was measured The data represent the mean ± SD of three different experiments (NC, negative control; hsa, Homo sapiens; *P < 0.05, **P < 0.005, #P < 0.0005) Similar results were obtained in QGY-7703 cells (data not shown) To confirm whether miR-373 could bind to this predicted region and suppress the expression of PPP6C protein, we constructed an enhanced green flu- orescence protein (EGFP) reporter vector (pcDNA3 ⁄ EGFP-PPP6C-3¢UTR), in which the 3¢-UTR fragment of PPP6C, including the region encoding the putative binding site, was inserted downstream of the EGFP coding region HepG2 cells were transfected with the reporter vector together with either miR-373 ASOs or pri-373 As shown in Fig 4B, the intensity of EGFP fluorescence was higher in the miR-373-blocked group than in the control groups, whereas ectopic expression of miR-373 decreased the intensity of EGFP fluorescence when compared with the control groups In addition, we constructed another EGFP reporter vector containing mutations in the regions encoding the miR-373 binding sites (Fig 4A) Neither blocking of miR-373 with ASOs nor overexpression of miR-373 had any effect on the intensity of EGFP fluorescence from the vector containing mutations in the region encoding the miR-373 binding sites These results show that miR-373 binds directly to the 3¢-UTR of the PPP6C transcript to repress gene expression To determine whether miR-373 negatively regulates PPP6C expression at the mRNA or protein levels, we assessed endogenous PPP6C expression in HepG2 cells with altered miR-373 expression HepG2 cells were transfected with miR-373 ASOs or pcDNA3 ⁄ pri-miR373 to block or overexpress miR-373, respectively, and the expression level of PPP6C mRNA was measured by real time RT-PCR When miR-373 was blocked, PPP6C mRNA was elevated  3.8-fold as compared with the control group, whereas overexpression of miR-373 resulted in an 80% decrease in PPP6C mRNA FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS 2047 MicroRNA-373 functions as an oncogene in HCC N Wu et al (Fig 5A) Western blot assay indicated that miR-373 ASOs resulted in a 2.3-fold increase in the PPP6C protein level, whereas overexpression of miR-373 reduced the PPP6C protein level by 70% (Fig 5C) To confirm the results obtained from the cell lines, we also examined the expression of PPP6C mRNA in 16 pairs of hepatocarcinoma tissue samples Figure 5B shows that, as compared with adjacent normal tissues, PPP6C mRNA was consistently downregulated in HCC tissue samples These results suggest that miR-373 regulates endogenous PPP6C expression through mRNA degradation Knockdown of PPP6C promotes HCC cell growth Sequence-specific small interfering RNA (siRNA) can effectively suppress gene expression We constructed a plasmid expressing a small hairpin RNA (shRNA) targeting PPP6C (pSilencer ⁄ shRNA-PPP6C) Western blot assay showed that the level of PPP6C expression was reduced by  90% in HepG2 cells that were transfected with pSilencer ⁄ shRNA-PPP6C, as compared with HepG2 cells transfected with a control plasmid (Fig 6A) Inhibition of PPP6C expression increased HCC cell growth as compared with the control group (Fig 6B–D), which was consistent with the effects of miR-373 overexpression Next, we examined the effects of PPP6C knockdown on the cell cycle (Fig 6E) Knockdown of PPP6C resulted in a significant decrease in the proportion of cells in G1-phase and an increase in the proportion of cells in S-phase These findings indicate that PPP6C decreases the proliferation of HCC cells by inducing cell cycle arrest at the G1 ⁄ S checkpoint, which is consistent with the effect of miR-373 on HCC cells Overexpression of PPP6C counteracts the effects of miR-373 expression on the G1 ⁄ S-phase transition PPP6C induces cell cycle arrest at the G1 ⁄ S checkpoint in cancer cells [22] We generated a plasmid (pcDNA3 ⁄ PPP6C, lacking the 3¢-UTR) to increase the protein expression of PPP6C (Fig 7A) We transfected HCC cells with the plasmid, and analyzed cell growth and cell cycle progression In this experiment, ectopic expression of PPP6C abrogated the promotion of cell growth (Fig 7B–D) and the increase in the rate of G1 ⁄ S-phase transition (Fig 7E) caused by miR-373 in HepG2 cells The overall effect of PPP6C overexpression was comparable to that of miR-373 ASO treatment, suggesting that PPP6C is a key mediator of the miR-373 regulation of cell growth and cell cycle progression in HCC 2048 Discussion MicroRNAs regulate diverse biological processes, including tumorigenesis It has been reported that miR-373 functions as an oncogenic miRNA in testicular germ cell tumors [20] and in human esophageal cancer [21] We wanted to determine whether miR-373 also functions as an oncogenic miRNA in HCC cells To address this question, we first examined miR-373 expression in HCC tissues and matched adjacent nontumor tissues by real-time RT-PCR, as previously described [23] The results show that the level of miR-373 is uncreased in tumor tissues as compared with the matched normal tissues in 16 pairs of matched specimens It has been reported that the upregulation of miR-373 promotes the growth of the cell lines in many cancers, e.g breast cancer [19], testicular germ cell tumors [20], and human esophageal cancer [21] We determined the effect of miR-373 on the HCC cell lines HepG2 and QGY-7703 cells by gain and loss of function approaches MTT, colony formation and growth curve assays show that miR-373 can increase the growth of those cells, and FACS analysis indicates that miR-373 can promote progression of the G1 ⁄ S-phase transition in the cell cycle Thus, we inferred that miR-373 might be a growth-promoting factor in HCC In breast cancer, miR-373 can promote invasion of the cancer cells [19] The function of miR-373 on HCC cells needs to be elucidated in the future The fundamental function of miRNAs is to regulate their targets by direct cleavage of mRNA or by inhibition of translation [18], depending on the degree of complementarity with the 3¢-UTR of their target genes Computational algorithms were used to predict miRNA targets, which are based mainly on base pairing of miRNAs and the 3¢-UTRs of genes [6,24–26] Twelve candidate genes were predicted by three bioinformatics software packages (pictar, targetscan, and microcosm), which may be correlated with the phenotype of the HCC cell lines caused by the alteration of miR373 Among them, a tumor suppressor gene, PPP6C, which regulates the G1 ⁄ S-phase transition [22], was selected for further study It was predicted that the 3¢-UTR region of PPP6C transcript would have an miR-373-binding site Given that miR-373 can target PPP6C mRNA, it may suppress the expression of PPP6C Western blot and real time RT-PCR assays show that miR-373 decreases PPP6C expression at the protein and mRNA levels in the HCC cell lines as compared with the control (Fig 5A,C), and also that PPP6C expression is downregulated in HCC tissue as compared with normal tissues (Fig 5B), in which miR-373 is upregulated FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS N Wu et al MicroRNA-373 functions as an oncogene in HCC Fig The expression level of PPP6C is inversely correlated with the level of miR373 (A) When miR-373 was blocked or overexpressed, the mRNA level of PPP6C was subsequently elevated or diminished, respectively, as compared with the control group (B) Relative expression level of PPP6C in HCC tissues or matched noncancerous tissues, as measured by real-time RT-PCR The expression level of PPP6C is normalized to b-actin (C) When miR-373 was blocked or overexpressed, the protein level of PPP6C was subsequently elevated or diminished, respectively, as compared with the control group (NC, negative control; *P < 0.05, #P < 0.0005) (Fig 1) The regulation of genes by miRNA occurs mainly through direct targeting of the 3¢-UTR region [5] We confirmed, with an EGFP-PPP6C-3¢UTR reporter assay, that miR-373 can bind directly to the PPP6C 3¢-UTR and negatively regulate PPP6C expression (Fig 4B) A previous study has demonstrated the direct regulation of CD4, a signal molecule involved in cell growth and adhesion, by miR-373 [18] Here, we have enough evidence to confirm the tumor-suppressing role of PPP6C in HCC cells, because knockdown of PPP6C by siRNA promoted HCC cell proliferation, whereas ectopic expression of PPP6C effectively alleviated the miR-373-induced promotion of HCC cell proliferation Together, these findings indicate that miR-373 might exert its effects in HCC mainly by targeting PPP6C However, Ivanov et al [27] recently reported that PPP6C can be targeted by miR-31, and functions as an oncogene in mesothelioma, which is in contrast to our results obtained in HCC The possible explanation is that the biological molecules have different influences in different tumor cells For example, KLF4 was found to be an oncogene in breast cancer [28], but Guan et al [29] reported KLF4 as a tumor suppressor in B-cell non-Hodgkin lymphoma and in classic Hodgkin lymphoma Also, miRNAs have different functions in different tissues; for instance, miR-9 is upregulated in breast cancer cells [30], but downregulated in human ovarian cancer [31] In addition, different miRNAs can target the same gene; for example, CCND1 is directly regulated by the miR-16 family [32], and miR-19a can also regulate the expression of CCND1 [33] Although miR-31 can target the PPP6C transcript, the binding sites in nucleotides 1363–1369 of the 3¢-UTR are different from the miR-373-binding sites in nucleotides 1338–1344 of the 3¢-UTR, which not overlap Whether miR-373 and miR-31 can simultaneously regulate PPP6C in HCC cells remains to be elucidated In conclusion, miR-373 functions as an oncogene and is upregulated in HCC tissues as compared with adjacent normal tissues Suppression of miR-373 repressed cell growth, possibly through inhibition of the cell cycle by targeting PPP6C Thus, the identification of the oncogene, miR-373, and its target gene, PPP6C, may help us to understand the molecular mechanism of tumorigenesis in HCC and may have potential diagnostic and therapeutic value in the future Experimental procedures Clinical specimen and RNA isolation Twenty-six pairs of clinical specimens, including 26 human HCC tissue samples and 26 matched normal liver tissue samples, were obtained from the Tumor Bank Facility of Tianjin Medical University Cancer Institute and Hospital and the National Foundation of Cancer Research, with patients’ informed consent, which was approved by the ethics committee The category of specimens was confirmed by FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS 2049 MicroRNA-373 functions as an oncogene in HCC N Wu et al Fig Knockdown of PPP6C shows concordant effects with miR-373 overexpression in HCC cells (A) Western blot analysis showed that the expression of PPP6C was successfully suppressed by PPP6C siRNA (B–D) PPP6C was knocked down in HCC cells, and cell growth ⁄ viability activity was analyzed with the (B) MTT, (C) colony formation and (D) proliferation curve assays (E) Cell cycle phase distribution was analyzed by FACS The data represent the mean ± SD of three different experiments (NC, negative control; *P < 0.05, **P < 0.005, #P < 0.0005) pathological analysis Large and small RNAs were isolated from tissue samples with the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA), according to the manufacturer’s instructions Cell culture and transfection Two human HCC cell lines (HepG2 and QGY-7703) were maintained in MEMa or RPMI-1640 (Gibco, Grand Island, NY, USA), respectively, and supplemented with 10% fetal bovine serum, 100 ImL)1 penicillin, and 100 lgỈmL)1 streptomycin Cells were incubated at 37 °C in a humidified chamber supplemented with 5% CO2 Transfection was performed with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s protocol 2050 Construction of expression vectors To construct an miR-373-expressing vector (pcDNA3 ⁄ primiR-373, pri-miR-373), we first amplified a 476-bp DNA fragment carrying pri-miR-373 from genomic DNA; the amplified fragment was then cloned into the pcDNA3 at the XhoI and HindIII sites For construction of EGFPPPP6C-3¢UTR reporter vectors (pcDNA3 ⁄ EGFP-PPP6C3¢UTR and pcDNA3 ⁄ EGFP-PPP6C-3¢UTR mutant), the 3¢-UTR and mutant 3¢-UTR fragments of PPP6C transcripts amplified by RT-PCR were inserted into the vector backbone downstream of the EGFP gene between the BamHI and EcoRI sites of the pcDNA3 ⁄ EGFP vector, as previously described [34] The pSilencer ⁄ shRNA-PPP6C plasmid expressing an siRNA targeting the PPP6C transcript was constructed by annealing single-stranded FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS N Wu et al MicroRNA-373 functions as an oncogene in HCC Fig Effects of PPP6C overexpression in HCC cells HCC cells were transfected with pcDNA ⁄ 373 (pri-373) After h, cells were transfected with a pcDNA3 ⁄ PPP6C vector or pcDNA3 empty vector The pcDNA3 ⁄ PPP6C vector did not contain the 3¢-UTR of PPP6C, and miR-373 could not therefore regulate ectopic PPP6C expression (A) At 48 h after transfection, PPP6C expression was measured by western blot Cell growth ⁄ viability was analyzed with the (B) MTT, (C) colony formation and (D) proliferation curve assays (E) Cell cycle phase distribution was analyzed by FACS The data represent the mean ± SD of three different experiments (*P < 0.05, **P < 0.005, # P < 0.0005) hairpin cDNA and inserting it into a pSilencer2.1 ⁄ neo vector (Ambion), using BamHI and HindIII sites To construct the PPP6C expression plasmid, the coding sequence (ORF) without the 3¢-UTR of human PPP6C was amplified by RT-PCR and inserted into the EcoRI and XhoI sites of pcDNA3 All of the primers used are shown in Table Cell proliferation assay Cells were seeded in 96-well plates at a density of 5000 cells per well, and then transfected with pri-miR-373 or miR-373 ASOs on the next day The MTT assay was used to determine relative cell viability at 48 and 72 h Ten microliters of MTT solution was added to 100 lL of culture medium, and incubated for h at 37 °C; the absorbance at 570 nm (A570) was then measured For cell proliferation measurements, HCC cells were seeded in 24-well plates at 10 000 cells per well (HepG2 cells) and 3000 cells per well (QGY-7703 cells) after transfection with pri-miR-373 or miR-373 ASOs Cell numbers were then counted every day for days Each experiment was performed in triplicate FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS 2051 MicroRNA-373 functions as an oncogene in HCC N Wu et al Colony formation assay After transfection, cells were counted and seeded in 12-well plates (in triplicate) at a density of 500 cells per well (HepG2 cells) or 100 cells per well (QGY-7703 cells) The culture medium was replaced every days Colonies were counted only if they contained more than 50 cells, and the cells were stained with crystal violet The rate of colony formation was calculated with the following equation: colony formation rate = (number of colonies ⁄ number of seeded cells) · 100% with pri-miR-373 or control vector pcDNA3 and the reporter vectors in 48-well plates The red fluorescent protein expression vector pDsRed2-N1 (Clontech) was used for normalization The cells were lysed with radioimmunoprecipitation assay buffer (150 mm NaCl, 50 mm Tris ⁄ HCl, pH 7.2, 1% Triton X-100, 0.1% SDS) 72 h later, and the proteins were harvested The intensities of EGFP and red fluorescent protein fluorescence were detected with an F-4500 Fluorescence Spectrophotometer (Hitachi, Tokyo, Japan) Real time RT-PCR Flow cytometry analysis At 48 h after transfection, the cells were detached from the plates by trypsin incubation, rinsed with NaCl ⁄ Pi, and fixed in 95% (v ⁄ v) ethanol The cells were then rehydrated in NaCl ⁄ Pi and incubated with RNase (100 lgỈmL)1) and propidium iodide (60 lgỈmL)1) (Sigma-Aldrich, MO, USA) Cells were analyzed with the FACS Calibur System (Beckman Coulter, Brea, CA, USA), and the cell cycle phase was determined by cell quest analysis The proliferation index (PI) was calculated as follows: PI = (S + G2 ⁄ M) ⁄ G1 (S, G2 ⁄ M and G1 refer to the percentages of cells in S-phase, G2 ⁄ M-phase and G1-phase, respectively) [35] Bioinformatics The miRNA targets predicted by computer-aided algorithms were obtained with pictar, targetscan, and microcosm For identification of the genes commonly predicted by the three different algorithms, the results of predicted targets were intersected with matchminer EGFP reporter assay To confirm the direct interaction between miR-373 and PPP6C mRNA, HCC cells were simultaneously transfected The stem–loop real time RT-PCR method was performed to detect the miRNA level, as previously described [23] Real time RT-PCR was performed with SYBR Premix Ex Taq (TaKaRa, Otsu, Shiga, Japan) on a 7300 Real Time PCR system (ABI, Foster City, CA, USA) The relative expression of miR-373 was defined as follows: quantity of miR-373 ⁄ quantity of U6 in the same sample The real time RT-PCR results were analyzed and expressed as relative expression of CT (threshold cycle) value, using the 2)DDCT method [36] To detect the relative levels of PPP6C transcript, real time RT-PCR was performed Briefly, a cDNA library was generated through reverse transcription, using Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA) with lg of the large RNA, and used to amplify the PPP6C gene (and the b-actin gene as an endogenous control) by PCR PCR primers were as follows: PPP6C sense and PPP6C antisense as above; b-actin sense, 5¢-CGTGACATTAAGGAGAAGCTG-3¢; and b-actin antisense, 5¢-CTAGAAGCATTTGCGGTGGAC-3¢ PCR cycles were as follows: 94 °C for min, followed by 40 cycles at 94 °C for min, 56 °C for min, and 72 °C for Real time RT-PCR was performed as described above, and the relative expression level of PPP6C was defined as follows: quantity of PPP6C ⁄ quantity of b-actin in the same sample Table The oligonucleotides used in this work Name Sequence (5¢- to 3¢) miR-373-sense miR-373-antisense PPP6C-3¢UTR-sense PPP6C-3¢UTR-antisense PPP6C-3¢UTR-mut-sense PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom PPP6C-forward PPP6C-reverse 2052 FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS N Wu et al MicroRNA-373 functions as an oncogene in HCC Western blot HCC cells were transfected and lysed 48 h later with radioimmunoprecipitation assay buffer, and proteins were harvested All proteins were resolved on a 10% SDS denatured polyacrylamide gel, and then transferred onto a nitrocellulose membrane Membranes were incubated with an antibody against PPP6C or an antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) overnight at °C The membranes were washed and incubated with horseradish peroxidase-conjugated secondary antibody Protein expression was assessed by enhanced chemiluminescence and exposure to chemiluminescent film lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard deviation (SD), and P < 0.05 is considered to be statistically significant with the Student–Newman–Keuls test Acknowledgements This work was supported by the National Natural Science Foundation of China (No 30873017; No 31071191) and the Natural Science Foundation of Tianjin (No 08JCZDJC23300 and No 09JCZDJC 17500) 12 13 14 References Di Bisceglie AM (2004) Issues in screening and surveillance for hepatocellular carcinoma Gastroenterology 127, S104–S107 Gramantieri L, Ferracin M, Fornari F, Veronese A, Sabbioni S, Liu CG, Calin GA, Giovannini C, Ferrazzi E, Grazi GL et al (2007) Cyclin G1 is a target of miR122a, a microRNA frequently down-regulated in human hepatocellular carcinoma Cancer Res 67, 6092–6099 Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST & Patel T (2007) MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer Gastroenterology 133, 647–658 Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB & Bartel DP (2003) The microRNAs of Caenorhabditis elegans Genes Dev 17, 991–1008 Farazi TA, Juranek SA & Tuschl T (2008) The growing catalog of small RNAs and their association with distinct Argonaute ⁄ Piwi family members Development 135, 1201–1214 Lewis BP, Burge CB & Bartel DP (2005) Conserved seed pairing, often flanked by adenosines, indicates that 15 16 17 18 19 thousands of human genes are microRNA targets Cell 120, 15–20 Ambros V (2004) The functions of animal microRNAs Nature 431, 350–355 Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB & Bartel DP (2005) The widespread impact of mammalian microRNAs on mRNA repression and evolution Science 310, 1817–1821 Houbaviy HB, Murray MF & Sharp PA (2003) Embryonic stem cell-specific microRNAs Dev Cell 5, 351–358 Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, Horvitz HR & Ruvkun G (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans Nature 403, 901–906 Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, Dono M et al (2004) MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias Proc Natl Acad Sci USA 101, 11755–11760 Michael MZ, O’ Connor SM, van Holst Pellekaan NG, Young GP & James RJ (2003) Reduced accumulation of specific microRNAs in colorectal neoplasia Mol Cancer Res 1, 882–891 Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E et al (2006) The colorectal microRNAome Proc Natl Acad Sci USA 103, 3687–3692 Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T et al (2006) Unique microRNA molecular profiles in lung cancer diagnosis and prognosis Cancer Cell 9, 189–198 Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M et al (2005) MicroRNA gene expression deregulation in human breast cancer Cancer Res 65, 7065– 7070 Chan JA, Krichevsky AM & Kosik KS (2005) MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells Cancer Res 65, 6029–6033 Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M et al (2004) Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers Proc Natl Acad Sci USA 101, 2999–3004 Yang K, Handorean AM & Iczkowski KA (2009) MicroRNAs 373 and 520c are downregulated in prostate cancer, suppress CD44 translation and enhance invasion of prostate cancer cells in vitro Int J Clin Exp Pathol 2, 361–369 Huang QH, Gumireddy K, Schrier M, Le Sage C, Nagel R, Nair S, Egan DA, Li AP, Huang GH, Klein-Szanto AJ et al (2008) The microRNAs miR-373 FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS 2053 MicroRNA-373 functions as an oncogene in HCC 20 21 22 23 24 25 26 27 28 N Wu et al and miR-520c promote tumour invasion and metastasis Nat Cell Biol 10, 202–283 Voorhoeve PM, le Sage C, Schrier M, Gillis AJ, Stoop H, Nagel R, Liu YP, van Duijse J, Drost J, Griekspoor A et al (2006) A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors Cell 124, 1169–1181 Lee KH, Goan YG, Hsiao M, Lee CH, Jian SH, Lin JT, Chen YL & Lu PJ (2009) MicroRNA-373 (miR-373) post-transcriptionally regulates large tumor suppressor, homolog (LATS2) and stimulates proliferation in human esophageal cancer Exp Cell Res 315, 2529–2538 Stefansson B & Brautigan DL (2007) Protein phosphatase PP6 N terminal domain restricts G1 to S phase progression in human cancer cells Cell Cycle 6, 1386–1392 Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR et al (2005) Real-time quantification of microRNAs by stem–loop RT-PCR Nucleic Acids Res 33, e179 Stark A, Brennecke J, Russell RB & Cohen SM (2003) Identification of Drosophila microRNA targets PLoS Biol 1, E60 Kiriakidou M, Nelson PT, Kouranov A, Fitziev P, Bouyioukos C, Mourelatos Z & Hatzigeorgiou A (2004) A combined computational–experimental approach predicts human microRNA targets Genes Dev 18, 1165– 1178 Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP & Burge CB (2003) Prediction of mammalian microRNA targets Cell 115, 787–798 Ivanov SV, Goparaju CM, Lopez P, Zavadil J, Toren-Haritan G, Rosenwald S, Hoshen M, Chajut A, Cohen D & Pass HI (2010) Pro-tumorigenic effects of miR-31 loss in mesothelioma J Biol Chem 285, 22809– 22817 Al-Nedawi K, Meehan B, Micallef J, Lhotak V, May L, Guha A & Rak J (2008) Intercellular transfer of the oncogenic receptor EGFRvIII by microvesicles derived from tumour cells Nat Cell Biol 10, 619–624 2054 29 Guan HF, Xie LK, Leithauser F, Flossbach L, Moller P, Wirth T & Ushmorov A (2010) KLF4 is a tumor suppressor in B-cell non-Hodgkin lymphoma and in classic Hodgkin lymphoma Blood 116, 1469– 1478 30 Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder TT, Valastyan S et al (2010) miR-9, a MYC ⁄ MYCN-activated microRNA, regulates E-cadherin and cancer metastasis Nat Cell Biol 12, 247–256 31 Li J & Wang CY (2008) TBL1-TBLR1 and beta-catenin recruit each other to Wnt target-gene promoter for transcription activation and oncogenesis Nat Cell Biol 10, 160–169 32 Chen RW, Bemis LT, Amato CM, Myint H, Tran H, Birks DK, Eckhardt SG & Robinson WA (2008) Truncation in CCND1 mRNA alters miR-16-1 regulation in mantle cell lymphoma Blood 112, 822–829 33 Qin X, Wang X, Wang Y, Tang Z, Cui Q, Xi J, Li YS, Chien S & Wang N (2010) MicroRNA-19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells Proc Natl Acad Sci USA 107, 3240–3244 34 Liu T, Tang H, Lang Y, Liu M & Li X (2009) MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin Cancer Lett 273, 233–242 35 Seifer DB, MacLaughlin DT, Penzias AS, Behrman HR, Asmundson L, Donahoe PK, Haning RV Jr & Flynn SD (1993) Gonadotropin-releasing hormone agonist-induced differences in granulosa cell cycle kinetics are associated with alterations in follicular fluid mullerian-inhibiting substance and androgen content J Clin Endocrinol Metab 76, 711–714 36 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method Methods 25, 402–408 FEBS Journal 278 (2011) 2044–2054 ª 2011 The Authors Journal compilation ª 2011 FEBS ... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG... lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are