Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 Zen-ichi Ando, Shigeru Sato, Keiko Ikeda and Kiyoshi Kawakami Division of Biology, Center for Molecular Medicine, Jichi Medical School, Tochigi, Japan Keywords dorsal root ganglia; Six1; Six4; Slc12a2; transcriptional targets Correspondence K Kawakami, Division of Biology, Center for Molecular Medicine, Jichi Medical School, Yakushiji, Minamikawachi, Tochigi, 329-0498, Japan Fax: +81 285 44 5476 Tel: +81 285 58 7312 E-mail: kkawakam@jichi.ac.jp (Received 13 December 2004, revised 15 March 2005, accepted 11 April 2005) doi:10.1111/j.1742-4658.2005.04716.x Six genes are homologs of Drosophila sine oculis and encode transcription factors that are characterized by a conserved Six domain and homeodomain Of the six family members (Six1–Six6) in mice, Six1 and Six4 show similar expression patterns during embryogenesis Six1– ⁄ – mice show defective formation of various organs such as inner ear, nose, skeletal muscle, kidney and thymus, whereas Six4– ⁄ – mice show little anomaly in organogenesis To understand the molecular basis for the differential function of Six1 and Six4 in vivo, we screened target genes of Six1 and Six4 and found that Six1 and Six4 differentially regulated a set of target genes Gel-retardation assays indicated that the promoter region of one of the targets, sodium– potassium–chloride cotransporter (Slc12a2), contains multiple Six1-binding sites and one common binding site of Six1 and Six4, suggesting that the DNA-binding specificity of Six1 is distinct from that of Six4 This underlies the differential regulation of common target genes by Six1 and Six4 Furthermore, in situ hybridization demonstrated that the expression of Slc12a2 was reduced in the developing dorsal root ganglia of Six1– ⁄ – ⁄ Six4– ⁄ – mice, suggesting that Six1 and Six4 regulate Slc12a2 in vivo The Six homeobox gene is characterized by the conserved Six domain (SD) and homeodomain (HD), both of which are required for specific DNA binding [1,2] The prototype of this gene family is Drosophila sine oculis, which is essential for compound eye formation [3,4] Six members (Six1–Six6) of the Six family gene have been identified in mouse and human [1] Six3 and Six6 are essential for forebrain formation and eye development [5–11], whereas Six5 is involved in cataractogenesis and spermatogenesis [12–14] Among the Six family genes, Six1 and Six4 show a remarkably similar expression pattern [1,15,16] Both Six1 and Six4 bind to the MEF3 site in the myogenin promoter and positively regulate the activity of the promoter in conjunction with their coactivator Eya proteins [17,18] Based on these observations, Six1 and Six4 are thought to be functionally similar in vivo Six4– ⁄ – mice showed little anomaly in embryogenesis including skeletal muscles [16] This was explained by the compensatory function of Six1 considering the similar expression pattern of both genes and the functional similarity in activating their target gene myogenin In contrast, Six1– ⁄ – mice showed anomalies in the development of various organs such as the inner ear, nose, thymus, kidney and skeletal muscle [19–23] These results indicate that Six4 does not compensate for the functional loss of Six1, whereas Six1 compensates for the function of Six4, suggesting a distinct function of Six1 and Six4 in vivo To understand the basis for the difference between Six1 and Six4, we screened possible target genes by using an approach similar to that applied in our previous study for searching the targets of Six5 protein [24] We identified Abbreviations Atp1a1, sodium–potassium ATPase alpha subunit; Clcn5, chloride channel 5; Coll2a1, procollagen type alpha 1; Figf, c-fos induced growth factor; Gas1, growth arrest-specific 1; GST, glutathione S-transferase; HD, homeodomain; MCK, muscle creatine kinase; SD, Six domain; Slc12a2, sodium–potassium–chloride cotransporter 1; Trex, transcriptional regulatory element X 3026 FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al three putative categories of targets, Six1-specific targets, Six4-specific targets and common targets We then focused our analysis on one of the typical common target genes, sodium-potassium-chloride cotransporter (Slc12a2) to understand the molecular basis for the distinct functions of Six1 and Six4 Results Identification of potential downstream target genes for Six1 and Six4 Studies of Six1– ⁄ – mice revealed that Six1 is required for inner ear, nose, thymus, skeletal muscle and kidney formation [19–23] Six4 is also reported to be expressed in these regions [16] To explore the target genes of Six1 and Six4 in the physiological context of development, we took advantage of using the cell line mK4 isolated from the kidneys of transgenic mice that express SV40 T-antigen under the control of Hoxa11 promoter The mK4 cells are thought to represent embryonic metanephric mesenchyme that undergoes epithelial conversion and expresses genes typical of late mesenchyme such as E-cadherin, Wnt4, Pax2, Lim1, Pax8 and Bmp7 in addition to Six1, Six4, Eya2 and Eya3 [25] (data not shown) By overexpressing transcriptionally constitutive active fusion proteins VP16– Six1 and VP16–Six4, the direct target genes are expected to be activated through VP16–Six1 or VP16–Six4, respectively, tethered to target gene promoters in the mK4 cells As a control, fusion proteins VP16– Six1W171R and VP16–Six4W263R, which are defective in DNA binding (data not shown), were overexpressed The mK4 cells were infected with recombinant adenovirus expression vectors expressing VP16–Six fusion proteins and cultured for 24 h, then used as the source of poly(A)+ RNA to prepare hybridization probes Expression profiling was performed by hybridization of an oligo microarray containing 20 371 mouse cDNAs Scatter plot analysis of the microarray data showed that most of the data points fell along the diagonal, indicating that most of the genes were equally expressed in the two samples (supplementary Fig S1) The genes that showed more than 1.5-fold higher level of expression in cells infected with VP16– Six1 adenovirus compared with cells infected with VP16–Six1W171R were considered potential Six1 target genes, whereas 1.5-fold higher level of expression in cells infected with VP16–Six4 compared with VP16– Six4W263R were considered potential Six4 target genes A total of 363 Six1 target genes and 149 Six4 targets genes were identified Of these, 63 were common target genes The data were deposited in GEO FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Target genes of Six1 and Six4 database GSE2043 (a complete list of these genes appears in Table S1 and a partial list is shown in Table 1) Because only a single microarray was used for each condition, genes with a relatively low level of expression were excluded Examples of target genes included the cyclin-dependent kinase inhibitor 1C (Cdkn1c), a cell-cycle regulator expressed in the kidney and cochlea, which controls the number of podocytes and glomerular size in the kidney [26] Another example is the sodium–potassium–chloride cotransporter (Slc12a2) that plays an important role in dorsal root ganglia function, spermatogenesis and inner ear formation, and mutation of this gene causes impairment of hearing [27–30] Other examples include the sodium– potassium ATPase alpha subunit (Atp1a1), which was originally identified as the target gene of Six4 [2,31]; c-fos induced growth factor (Figf), which shows remarkably similar patterns of Six1 and Six4 expression [32]; growth arrest-specific (Gas1), which encodes a sonic hedgehog inhibitor [33,34] and whose mutation causes cerebellar and eye defects [33]; chloride channel (Clcn5), which is mainly expressed in the kidney, and mutation of this gene causes kidney stone disease [35,36]; and procollagen type alpha (Col2a1), whose missense mutation causes spondyloepiphyseal dysplasia, hearing loss and retinoschisis [37] To confirm the above microarray results, we performed semiquantitative RT-PCR using RNA prepared from recombinant virus-infected mK4 cells As summarized in Table 2, the results of RT-PCR confirmed > 1.5-fold difference in the expression levels of 13 of 14 genes examined The result seems to suggest that our strategy using microarray as an initial screening to search for potential Six1- and Six4-target genes was largely successful Differential regulation of potential target genes by Six1 and Six4 To verify that the above identified putative target genes are regulated by Six1 or Six4, we performed transient transfection assays and examined the effects of Six1 and Six4 on the promoter activity We used luciferase reporter constructs harboring the Gas1 promoter region of )3408 to +19 (Gas1)3408Luc), the Clcn5 promoter region of )1325 to +2529 (Clcn5) 1325Luc) and the Slc12a2 promoter region of )1938 to +149 (Slc12a2)1938Luc) Gas1 promoter showed similar extent of activation by both Six1 and Six4 in a dose-dependent manner (Fig 1A), although it was listed as a potential Six1-specific target gene Clcn5 promoter showed a moderate repression by Six1 and a strong repression by Six4 in a dose-dependent manner 3027 Target genes of Six1 and Six4 Z-i Ando et al Table A partial list of potential target genes regulated by Six1 and ⁄ or Six4 in mk4 cells Expression profiling was performed using the Mouse Development Oligo Microarray containing 20 371 mouse cDNAs (Agilent Technologies, Palo Alto, CA) Total RNA was prepared as described previously [24] from mK4 cells infected with recombinant viruses To prepare fluorescence-labeled cDNA probes, total RNA (20 lg) was reverse transcribed using an oligo(dT) primer in the presence of aminoallyl dUTP and single-stranded cDNAs were coupled with Cy3 (VP16–Six1wt and VP16–Six4wt infected samples) or Cy5 (VP16–Six1W171R and VP16–Six4W263R samples) dyes Hybridization to the microarray was carried out at 65 °C for 17 h according to the instructions provided by the manufacturer The arrays were washed, dried and scanned using ScanArray 5000 (GSI Lumonics Inc., ON, Canada) Cy3 and Cy5 intensities for each spot on the array were determined by QUANTARRAY software (GSI Lumonics Inc.) The raw data were processed and the Cy3 to Cy5 ratios were calculated as follows: (a) subtraction of the fluorescence intensity of negative control spots as background from the intensity of each of the Cy3 and Cy5 spots, (b) normalization of the entire data set using the global normalization method, (c) elimination of spots with high background intensity for either dye, (d) determination of the Cy3 to Cy5 ratios The microarray data were deposited in the GEO database under accession number GSE2043 Among the genes with a Cy3 ⁄ Cy5 ratio of > 1.5, those with a relatively high level of expression (normalized signal value > 500 in both dyes) were considered to be potential Six1- and Six4-target genes Data are from a single microarray experiment and no dye-swap experiment was carried out Symbol VP16–Six1a wt ⁄ W171R Six1–Six4 common target genes Ogn 5.10 Amot 3.73 Hs6st2 3.07 Rhoe 2.98 Nid2 2.57 Acsl3 2.47 Acadm 2.41 Sdc2 2.30 Add3 2.15 Cav1 2.12 Kif5b 2.11 Stag2 2.05 Sh3bgrl 2.00 Cdkn1c 1.90 Slc12a2 1.80 Six1-specific target genes Atp1a1 2.89 Figf 2.87 Cpd 2.65 Gas1 2.17 Laptm4a 2.12 Fmr1 2.05 Bmi1 1.96 Nrp2 1.86 Irs1 1.85 Mbnl1 1.84 Clcn5 1.83 Cav2 1.73 Aqp1 1.66 Bmpr2 1.62 Six4-specific target genes Cyb561d2 Ifitm3 Gpd2 Thbs1 Col2a1 Matn2 Tmem2 VP16–Six4b wt ⁄ W263R Kidneyc function development 3.71 2.09 1.82 2.60 1.84 2.58 2.09 1.69 1.74 1.55 1.58 1.59 1.64 2.41 1.94 Yes Yes Yes Yes Yes Yes Yes Yes Yes 2.29 2.27 2.24 2.21 2.20 2.05 2.01 Description Ref Osteoglycin Angiomotin Heparan sulfate 6-O-sulfotransferase ras homolog gene family, member E Nidogen Acyl-CoA synthetase long-chain family member Acetyl-Coenzyme A dehydrogenase, medium chain Syndecan Adducin (gamma) Caveolin, caveolae protein Kinesin family member 5B Stromal antigen SH3-binding domain glutamic acid-rich protein like Cyclin-dependent kinase inhibitor 1C Solute carrier family 12, member ATPase, Na+ ⁄ K+ transporting, alpha polypeptide c-fos induced growth factor Carboxypeptidase D Growth arrest specific Lysosomal-associated protein transmembrane A Fragile–mental retardation syndrome homolog B lymphoma Mo-MLV insertion region Neuropilin Insulin receptor substrate Muscleblind-like (Drosophila) Chloride channel Caveolin Aquaporin Bone morphogenic protein receptor, type II [50] [51] [50] [52] [53] [54] [55] [50,56] [57] Cytochrome b-561 domain containing Interferon induced transmembrane protein Glycerol phosphate dehydrogenase 2, mitochondrial Thrombospondin Procollagen, type II, alpha Matrilin Transmembrane protein a Ratio of expression level in VP16–Six1wt-expressing mK4 cells to expression level in VP16–Six1W171R-expressing cells b Ratio of expression level in VP16–Six4wt-expressing mK4 cells to expression level in VP16–Six4W263R-expressing cells c Genes involved in kidney development or function 3028 FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al Target genes of Six1 and Six4 Table RT-PCR analysis of potential Six1- and Six4-target genes identified by microarray Total RNA (10 or 100 ng) prepared from mk4 cells infected with adenoviruses overexpressing VP16–Six1 or VP16–Six4 fusion proteins was subjected to RT-PCR Aliquots of PCR products were removed from the thermal cycler at multiple cycle numbers, separated on a 5% acrylamide gel, stained with the fluorescent dye, scanned and quantitated Linearity of PCR amplification was maintained over several cycles, and the amount of PCR products at 16–28 cycles, depending on the gene, was selected for comparison Three independent RT-PCR reactions were set up from the same RNA samples Data are shown as mean ± SEM We could not find 1.5-fold difference of expression in Lampt4A Six1–Six4 common targets Ogn 1.91 (0.07) Amot 1.99 (0.20) Rhoe 2.71 (0.24) Nid2 1.62 (0.06) Acadm 1.67 (0.01) Cdkn1c 2.09 (0.10) Slc12a2 1.60 (0.04) Six1-specific target genes Figf 2.11 (0.08) Gas1 2.15 (0.10) Clcn5 1.86 (0.03) Six4-specific target genes Ifitm3 1.90 (0.02) Thbs1 0.81 (0.05) Col2a1 1.33 (0.06) Six4wt ⁄ Six4W263Rb Mean (± SEM) Cyclesc 1.88 2.02 2.59 1.63 2.04 3.10 2.28 (0.02) (0.01) (0.02) (0.04) (0.13) (0.03) (0.11) 20 20 20 24 24 24 22 1.51 (0.15) 1.28 (0.09) 2.03 (0.09) 24 20 20 5.52 (0.27) 2.77 (0.12) 1.63 (0.04) 20 16 28 A a Ratio of expression level in VP16–Six1wt-expressing mk4 cells to expression level in VP16–Six1W171R-expressing cells b Ratio of expression level in VP16–Six4wt-expressing mk4 cells to expression level in VP16–Six4W263R-expressing cells c The number of PCR cycles at which the relative amount of PCR products were determined B 10 1.2 1.0 0.8 Fold activation Six1wt ⁄ Six1W171Ra Mean (± SEM) Fold activation Symbol (Fig 1B) In our screening, Clcn5 was listed as a potential Six1-specific target and it is reasonable that even the genes naturally repressed by Six1 were activated by VP16–Six1 in our screening condition Slc12a2 promoter was strongly activated by Six1, but weakly activated by Six4 in a dose-dependent manner (Fig 1C) The apparent discrepancy in the activation ⁄ repression profiles of Six1 and Six4 based on the results of transient transfection assays and microarray analyses may be explained by the involvement of other transcription factors in cells used in transfection assays VP16-fusion 0.6 0.4 0.2 0 Gas1-3408Luc C Clcn5-1325Luc D 35 25 30 20 FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Fold activation Fig Differential regulations of the potential target genes by Six1 and Six4 Transient transfection assays with 175 ng of the indicated promoter-luciferase reporter construct were carried out as described in Experimental procedures Luciferase activity was normalized to the protein content and expressed relative to the value in the presence of 75 ng pFLAG-CMV2 (white bars), which was set at As effectors, increasing amounts (25 and 75 ng) of pfSix1 (black bars) and pfSix4 (gray bars) were cotransfected into COS7 cells Data are mean ± SEM of three independent experiments (each performed in duplicate) (A) Trans-activation of Gas1 promoter by Six1 and Six4 (B) Regulation of Clcn5 promoter by Six1 and Six4 (C) Trans-activation of Slc12a2 promoter by Six1 and Six4 (D) Transactivation of myogenin promoter by Six1 and Six4 (E) Gel-retardation assays of Flag–Six1 and Flag–Six4 in nuclear extracts (800 ng protein for Six1 and 860 ng protein for Six4) from transiently transfected cells using fmol of C3 oligonucleotide probe Arrows indicate the positions of specific retarded complexes and arrowhead indicates the position of nonspecific complex Fold activation 25 20 15 10 10 5 0 Slc12a2-1938Luc E 15 pGL3MG-185 Six1 Six4 Gas1 Clcn5 Slc12a2 pGL3MG 3029 Target genes of Six1 and Six4 protein may bypass the effects of other transcription factors that may affect the promoter activity in cells The control myogenin promoter was moderately activated by Six1 and strongly by Six4 (Fig 1D) To ensure that the differential regulation by Six1 and Six4 is not due to the altered expression levels of cotransfected Six1 and Six4, we performed gel-retardation analysis of nuclear extracts from cotransfected cells Similar amounts of gel-retarded complexes of Flag–Six1 and Flag–Six4 (Fig 1E) were detected among each set of nuclear extracts from the transfected cells except in the case of Flag–Six1 in the presence of the myogenin reporter These findings indicate that Six1 and Six4 differentially regulate their target genes Z-i Ando et al A Relative luciferase activity Slc12a2-820Luc Slc12a2-97Luc pGL3-basic B -1938 -97 +1 +77 Cfr10I +103 +149 HinfI MspI SacI probe A probe B probe C Identification of Six1- and Six4-responsive elements in the Slc12a2 promoter 3030 10 Slc12a2-1938Luc NarI We focused our analysis on Slc12a2 promoter to determine the molecular basis of the differential regulation by Six1 and Six4 To localize Six1 and Six4 responsive elements in the Slc12a2 promoter, we prepared a set of deletion constructs harboring the Slc12a2 promoter regions )1938 to +149 (Slc12a2)1938Luc), )820 to +149 (Slc12a2–820Luc) and )97 to +149 (Slc12a2– 97Luc) Activation by Six1 and Six4 was observed in the series of deletion constructs and similar activation level was still observed in the shortest construct, Slc12a2–97Luc (Fig 2A) To explore the possibility that Six1- and Six4-binding sites lie within )97 to +149, we next performed gel retardation assays using probes of NarI–HinfI fragment ()97 to +77, Fig 2B, probe A), Cfr10I–MspI fragment (+2 to +103, Fig 2B, probe B) and HinfI– SacI fragment (+75 to +149, Fig 2B, probe C) The expressed glutathione S-transferase (GST) fusion protein of Six1 (GST–Six1) bound to probes A, B and C, whereas GST fusion protein of Six4 (GST–Six4) bound to probe C, but not to probes A and B (Fig 2C) These results suggest the existence of at least two Six1specific binding sites, and only one binding site common to Six1 and Six4 To analyse the location of each binding site, we synthesized the double-stranded competitor oligonucleotides (oligo to oligo 9) that covered various portions of the promoter region (Fig 3A) The formation of a complex by Six1 was strongly competed by oligos 2, and for probe A, by oligos and for probe B and by oligos 6, and for probe C (Fig 3B) In contrast, the formation of a complex by Six4 was competed only by oligo for probe C (Fig 3C) To precisely localize the binding element for Six1 and Six4, we generated 4-bp substitution mutations C GST-Six1 probe A B C GST-Six4 A B C complex free probe free probe free probe Fig Identification of Six1 and Six4 responsive regions in the Slc12a2 promoter (A) Effects of Six1 or Six4 on the Slc12a2 promoter in COS7 cells In these studies, 175 ng of luciferase reporter constructs containing a series of deletions of Slc12a2 promoter fragments were cotransfected with increasing amounts (25 and 75 ng) of pfSix1(black bars) and pfSix4 (gray bars) Luciferase activity was normalized to the protein content and expressed relative to the value in the presence of 75 ng pFLAG-CMV2 (white bar), which was set at (B) Schematic representation of the Slc12a2 promoter with the position of a major transcription start site (+1) Solid bars at the bottom show positions of probes used in gel retardation assays (C) Binding of Six1 and Six4 to the promoter DNA fragments of Slc12a2 Gel-retardation assays were performed using bacterially expressed 10 ng of GST–Six1 and 30 ng of GST–Six4 proteins with each fmol probe indicated in (B) Lanes 1–3 and lanes 4–6 were from separated lanes in the same gel Free probes are indicated by the arrows and shifted complexes are indicated by the bracket in various regions of oligo 3, oligo and oligo (Table 3) and each mutated oligo was added to the gel retardation assay mixture to examine the competition to the binding of Six1 and probes A, B and C Oligo FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al probe A probe A Target genes of Six1 and Six4 -97 +77 probe B +2 oligo oligo +75 -99 +149 -62 -31 -68 oligo competitor +103 probe C +3 -37 oligo +34 -4 oligo +65 +28 oligo +93 +59 oligo oligo oligo +115 +86 +109 +138 +115 +152 B probe competitor binding 101112 1314151617 A B C 6 7 1.0 0.5 0.3 0.2 0.5 0.4 0.1 1.0 0.5 0.5 0.1 0.2 1.0 0.3 0.3 0.6 0.2 C 10 probe competitor binding C 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.1 1.2 0.6 Fig Mapping of Six1 and Six4 binding elements in the Slc12a2 promoter (A) Positions of probes A, B and C are indicated in the upper panel Positions of competitors (oligos 1–9) are indicated in the lower panel (B) Gel retardation assays with GST–Six1 in the presence (lanes 2–7, 9–12 and 14–17) or absence (lanes 1, and 13) of competitors; 500-fold molar excess competitor oligonucleotides were added to the reaction The protein amount of GST–Six1 was 16 ng for probe A (lanes 1–7), 15 ng for probe B (lanes 8–12) and 13 ng for probe C (lanes 13–17) The intensities of the retarded bands relative to that in the absence of competitors, which was set at (lanes 1, and 13), are shown at the bottom (C) Gel-retardation assays with 30 ng of GST–Six4 in the presence (lanes 2–10) or absence (lane 1) of competitors; 500-fold molar excess competitor oligonucleotides were added The intensities of the retarded bands relative to that in the absence of competitors, which was set at 1(lane 1), are shown at the bottom Free probes are indicated by the arrow and shifted complexes by the bracket in (B) and (C) FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS 3mut()13 ⁄ )10) showed the most reduced competition among the mutated oligos examined (Fig 4A, lane 7) The reduction of Six1 binding was confirmed by comparing the binding of Six1 to the oligo 3wt probe and the oligo 3mut()13 ⁄ )10) probe The amount of the retarded complex composed of Six1 and oligo 3mut()13 ⁄ )10) was approximately threefold less compared with oligo 3wt (Fig 4B, lanes and 4) As for probe B, all substitution mutations of oligo showed similar competition compared with oligo 6wt (data not shown), suggesting the presence of multiple binding sites for Six1 in oligo We also tested deletion oligos and found that oligo with 10-bp deletion in +65 to +74 [oligo 6del(+65 ⁄ +74)] slightly reduced the competition compared with oligo 6wt (Fig 4A, lanes 11 and 12) The double mutation oligo containing del(+65 ⁄ +74) and substitution mutation in +89 to +92 [del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92)] showed further reduced competition against the probe B–Six1 protein complex formation (Fig 4A, lane 13) The reduction in the binding was confirmed by comparing the binding of Six1 to the oligo 6wt probe and oligo 6del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92) probe and the binding was approximately threefold weaker in the latter compared with the former (Fig 4B, lanes and 10) The oligo 9mut(+135 ⁄ +138) showed the most reduced competition among the oligos examined against the probe C–Six1 protein complex formation (Fig 4A, lane 19) The reduction in the binding was confirmed by comparing the binding of Six1 to the oligo 9wt probe and the oligo 9mut(+135 ⁄ +138) probe and the Six1 binding to the latter was approximately threefold less than the former (Fig 4B, lanes 12 and 14) Likewise, the oligo 9mut(+135 ⁄ +138) showed the most reduced competition to the probe C–Six4 complex formation (Fig 4C, lane 6) The binding of Six4 to the oligo 9wt probe was compared with the oligo 9mut(+135 ⁄ +138) probe and in this case, the reduction of binding was  10-fold (Fig 4D, lanes and 4) In summary, the three Six1-specific binding sites reside around )13 to )10, +65 to +74 and +89 to +92 and the single common binding site resides around position +135 to +138 in the promoter region of Slc12a2 (Fig 4E) Activation of the Slc12a2 promoter by Six1 and Six4 To confirm that Six1 activates through the aboveidentified binding sites, we introduced substitution mutations used in the gel-retardation assays into the luciferase reporter constructs We prepared the following 3031 Target genes of Six1 and Six4 Z-i Ando et al Table Double-stranded oligonucleotides used in Fig Nucleotide substitutions in the mutation oligonucleotides are represented in bold Name Sequence mutation reporters, Slc12a2–97mut()13 ⁄ )10)Luc, Slc12a2–97del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92)Luc, and the combination of the two, Slc12a2–97mut()13 ⁄ )10) ⁄ del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92)Luc as Six1-binding mutations We also prepared Slc12a2–97mut(+135 ⁄ +138)Luc, which abolished Six4 binding We performed reporter gene assays and analysed the effects of Six1 (Fig 5A) and Six4 (Fig 5B) Cotransfection of pfSix1 showed activation of Slc12a2–97Luc in a dose-dependent manner to an  11-fold increase in the level of luciferase activity The activation level was decreased to approximately sixfold in Slc12a2mut()13 ⁄ )10)Luc, whereas Slc12a2del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92)Luc showed comparable luciferase activity to the wild-type reporter construct, Slc12a2–97Luc In contrast, the combina3032 tion of these two mutations, Slc12a2mut()13 ⁄ )10) ⁄ del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92)Luc, showed only 1.3fold activation by Six1 (Fig 5A) These results clearly indicate that the three Six1-binding sites located at around )13 ⁄ )10, +65 ⁄ +74 and +89 ⁄ +92 are the responsible element as a whole for the activation by Six1 As for the effects of Six4, cotransfection of pfSix4 showed 2.6- to 4.6-fold activation in the wild-type reporter construct Slc12a2– 97Luc in a dose-dependent manner By contrast, the luciferase activity of Slc12a2mut(+135 ⁄ +138) was enhanced to 1.6- to 2.3-fold by Six4 (Fig 5B) These results indicate that Six4 activates the Slc12a2 promoter through its binding site around +135 ⁄ +138 FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al Target genes of Six1 and Six4 A B C D oligo 9wt 1.0 oligo 9mut(+135/+138) probe C 9wt 9mut(+117/+120) 9mut(+123/+126) 9mut(+129/+132) 9mut(+135/+138) 9mut(+141/+144) 9mut(+147/+150) 0.6 oligo 9mut(+135/+138) 1.0 0.3 1.0 0.3 +1 -13/-10 1.0 0.3 0.3 0.3 0.6 0.8 0.3 0.3 0.3 E -97 1.0 1.0 0.4 0.3 0.4 0.5 0.8 0.3 0.4 oligo 9wt 1.0 0.1 0.2 0.3 9wt 9mut(+117/+120) 9mut(+123/+126) 9mut(+129/+132) 9mut(+135/+138) 9mut(+141/+144) 9mut(+147/+150) 3wt 3mut(-37/-34) 3mut(-31/-28) 3mut(-25/-22) 3mut(-19/-16) 3mut(-13/-10) 3mut(-7/-4) 3mut(-1/+3) 1.0 0.2 0.2 0.1 0.2 0.1 0.3 0.2 0.2 oligo 6del(+65/+74) /mut(+89/+92) probe C oligo 6del(+65/+74) probe B 10 11121314 oligo 6wt probe A oligo 3mut(-13/-10) 1415161718192021 oligo 3wt 10111213 6wt 6del(+65/+74) 6del(+65/+74) /mut(+89/+92) +65/+74 +89/+92 +135/+138 : Six1-specific binding site : Six1/Six4 common binding site 0.1 Slc12a2 is regulated by Six1 and Six4 in vivo To confirm that Six1 and Six4 regulate the expression of Slc12a2 in vivo, we examined the expression of Slc12a2 in the developing embryos of wild-type, Six1– ⁄ – and Six1– ⁄ – ⁄ Six4– ⁄ – mice The expression of Slc12a2 was observed in various adult organs such as the central nervous system, dorsal root ganglia and renal cortex [38] Because Six1– ⁄ – and Six1– ⁄ – ⁄ Six4– ⁄ – mice die soon after birth and they show developmental defects in various organs [23] (unpublished observation), we compared the FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS +149 expression pattern of Slc12a2 in these embryos The expression level of Slc12a2 was too low to allow precise comparison of its expression level in the nephrogenic cord Therefore, we analysed the expression of the gene by in situ hybridization in the dorsal root ganglia, where Six1 and Six4 were abundantly expressed and some developmental abnormalities were observed in Six1– ⁄ – ⁄ Six4– ⁄ – mice (K Ikeda & K Kawakami, unpublished observation) The antisense probe detected expressions of Slc12a2 in the dorsal root ganglia in E18.5 fetus where significant expression was reported [38] (Fig 6C), 3033 Target genes of Six1 and Six4 Z-i Ando et al Fig Identification of Six1- and Six4-binding sites in the Slc12a2 promoter by gel retardation assays The competitor oligonucleotides harboring mutations are shown in Table (A) Competition assays were performed with GST–Six1 protein in the absence (lanes 1, 10 and 14) or presence of 500-fold molar excess of various competitor oligonucleotides (lanes 2–9, 11–13 and 15–21) Probes A, B and C indicated in Fig were used The protein amount of GST–Six1 was 20 ng for probe A (lanes 1–9), 15 ng for probe B (lanes 10–13), and 16 ng for probe C (lanes 14–21) The intensities of the retarded bands relative to that in the absence of competitors for each probe, which was set at (lanes 1, 10 and 14), are shown at the bottom Shifted complexes were least competed by oligo 3mut()13 ⁄ )10) (lane 7), oligo 6del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92) (lane 13), and oligo 9mut(+135 ⁄ +138) (lane 19) (B) Comparison of binding of GST–Six1 to the wild-type (oligo 3wt, lane 2; oligo 6wt, lane 6; oligo 9wt, lane 12) and to the mutated probes [oligo 3mut()13 ⁄ )10), lane 4; oligo 6del(+65 ⁄ +74) and oligo 6del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92), lanes and 10, respectively; oligo 9mut(+135 ⁄ +138), lane 14] Sixty-seven nanograms of GST–Six1 was used in the reactions Binding of GST–Six1 to oligo 3mut()13 ⁄ )10) was  30% compared with that of oligo 3wt (lanes and 4) Binding of GST–Six1 to oligo 6del(+65 ⁄ +74) and oligo 6del(+65 ⁄ +74) ⁄ mut(+89 ⁄ +92) was  60 and 30%, respectively, compared with that of oligo 6wt (lanes 6, and 10) Binding of GST–Six1 to oligo 9mut(+135 ⁄ +138) was  30% compared with that of oligo 9wt (lanes 12 and 14) Lanes 5–6 and lanes 7–10, lane 11 and lanes 12–14 are from separate lanes of one gel (C) Competition assays were performed with GST– Six4 protein in the absence (lane 1) or presence of 500-fold molar excess of various competitor oligonucleotides (lanes 2–8) Probe C indicated in Fig was used Thirty nanograms of GST–Six4 was used in the reaction The intensities of the retarded bands relative to that in the absence of competitors for the probe, which was set at 1(lane 1), are shown at the bottom Shifted complexes were most weakly competed by the oligo 9mut(+135 ⁄ +138) (lane 6) (D) Comparison of binding of GST–Six4 to the wild-type (oligo 9wt, lane 2) and mutated probes [oligo 9mut(+135 ⁄ +138), lane 4] Thirty nanograms of GST–Six4 was used in the reactions Binding of GST–Six4 to oligo 9mut(+135 ⁄ +138) was  10% compared with that of oligo 9wt (lanes and 4) (E) Schematic representation of binding elements of Six1 and Six4 in the Slc12a2 promoter Six1-specific binding elements reside in the region of )13 ⁄ )10, +65 ⁄ +74 and +89 ⁄ +92 (black ovals) and a bipartite Six1and Six4-binding element in the region of +135 ⁄ +138 (gray box) whereas the control sense probe gave only background signals (Fig 6D) The expression level of Slc12a2 was apparently lower in Six1– ⁄ – ⁄ Six4– ⁄ – embryo at E16.5 compared with the wild-type, whereas that in Six1– ⁄ – was similar to the wild-type (Fig 6H–J) We observed similar reductions of Slc12a2 expression in the dorsal root ganglia of Six1– ⁄ – ⁄ Six4– ⁄ – embryos at E17.5 and E18.5 (data not shown) In the choroid plexus, where no Six1 and Six4 were expressed, the expression level of Slc12a2 was similar in each genotype (Fig 6N–P) These results suggest that the low expression level of Slc12a2 in Six1– ⁄ – ⁄ Six4– ⁄ – embryos is due to the absence of Six1 and Six4 in the dorsal root ganglia and indicate that Slc12a2 is upregulated by Six1 and Six4 in the developing dorsal root ganglia of wild-type embryo A Slc12a2-97Luc Fold activation 10 12 14 -97 To confirm that Six1 and Six4 regulate the other putative target genes in vivo, we analysed the expression of Figf and Col2a1 in E10.5 embryos of wild-type and Six1– ⁄ – ⁄ Six4– ⁄ – by RT-PCR The expression levels in Six1– ⁄ – ⁄ Six4– ⁄ – embryo were significantly reduced (to 36.4% for Figf and to 58.1% for Col2a1 compared with the wild-type), suggesting that these genes are also regulated by Six1 and Six4 in vivo (Fig 7) Discussion Screening of putative target genes of Six1 and Six4 and effectiveness of the screening method To understand the function of transcription factors in organ development, it is essential to identify direct +1 +149 Slc12a2-97mut(-13/-10)Luc Slc12a2-97del(+65/+74) /mut(+89/+92)Luc Slc12a2-97mut(-13/-10) /del(+65/+74)/mut(+89/+92)Luc B Slc12a2-97Luc Slc12a2-97mut(+135/+138)Luc 3034 Fold activation 10 12 14 -97 +1 +149 Fig Transactivation of the Slc12a2 promoter by Six1 and Six4 (A, B) Slc12a2– 97Luc and four types of mutation reporter constructs (shown in the right-hand panel, 70 ng each) were cotransfected with increasing amounts (25 and 75 ng) of pfSix1 or pfSix4 in COS7 cells Luciferase activity was normalized to protein content and expressed relative to the value in the presence of 75 ng pFLAG-CMV2 (white bar), which was set at Data are mean ± SEM of a typical result of three independent experiments (each performed in triplicate) FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al Target genes of Six1 and Six4 Sense Antisense A Dorsal root ganglion B C D Six1-/- Wild type E Six1-/-/Six4-/- F drg G sp drg drg sp Dorsal root ganglion sp v v v I J K Choroid plexsus H L M N O P Fig In situ hybridization of Slc12a2 in the dorsal root ganglia of mouse embryos (A–D) Transverse sections (16 lm) were stained with hematoxylin (A, B) and the adjacent sections hybridized with Slc12a2 antisense (C) or sense (D) probe Specific hybridization signals were detected in the dorsal root ganglia (encircled by the dotted line) of E18.5 embryo in (C) but not in (D) (E–J) Transverse sections (16 lm) from E16.5 wild-type (E, H), Six1– ⁄ – (F, I) and Six1– ⁄ – ⁄ Six4– ⁄ – (G, J) embryos were stained with hematoxylin (E–G) and the adjacent sections hybridized with Slc12a2 antisense probes (H–J) The expression levels of Slc12a2 in the developing dorsal root ganglia of the Six1– ⁄ – embryos were similar to those in the wild-type (H, I), but markedly reduced in the Six1– ⁄ – ⁄ Six4– ⁄ – embryos (J) (K–P) As controls, the signals on the choroid plexus from E16.5 wild-type (K, N), Six1– ⁄ – (L O) and Six1– ⁄ – ⁄ Six4– ⁄ – (M, P) embryos stained with hematoxylin (K–M) and with antisense probe (N–P) are shown Similar expression levels of Slc12a2 were observed in all genotypes (N–P) Scale bar: 100 lm target genes and recognize the gene cascade as well as regulatory mechanisms involved in proper cell growth, differentiation, cell movement and functional maturaFEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS tion of the organ In this analysis, we took advantage of a model cell line that reflects a certain developmental stage of the kidney in order to identify the genes 3035 Target genes of Six1 and Six4 Z-i Ando et al normally involved in the regulation, in conjunction with endogenous Six proteins, thus our screening may be biased in the identification of target genes Still, the identified genes were regulated either by Six1 or Six4 (Fig 1) and some of the genes were downregulated in Six1– ⁄ – ⁄ Six4– ⁄ – (Figs and 7), indicating that this approach is a powerful method for the identification of direct target genes irrespective of whether they are activated or repressed by the proteins Figf Col2a1 b-actin Fig RT-PCR analyses of RNA from E10.5 mouse embryos One hundred nanograms of total RNAs from each of Six1– ⁄ – ⁄ Six4– ⁄ – (lane 1) and wild-type (lane 2) embryos at E10.5 were amplified by RT-PCR using a specific set of primers for Figf, Col2a1 and control b-actin Typical results of three independent experiments (six embryos) that are driven by Six1 and ⁄ or Six4 A similar strategy was previously applied to identify target genes of Six5 using P19 carcinoma cells, and direct target genes Igfbp5 and Igf2 were successfully identified [24] By overexpressing constitutively transcriptionally active forms of VP16–Six1 and VP16–Six4, we expected that genes accessible by Six1 and Six4 will be activated in the cells In this screening, we used mK4 cells, which possess the characteristics of embryonic metanephric mesenchyme [25] As expected, we identified the potential target genes that might be involved in cell growth, differentiation and specific ion transport functions in the kidney Of these, numerous terminal differentiation genes were observed such as Aqp1, Atp1a1, Clcn5, Npr3 and Slc12a2 Although Six1 is involved in the early phase of kidney development, such as aggregation of metanephric mesenchyme around the ureteric bud [21], it is not surprising that Six1 and Six4 proteins also directly regulate the genes involved in the terminal differentiation Many terminal differentiation genes have been identified as target genes of MyoD as well as genes involved in muscle development [39] Our initial screening analysis identified 300 Six1specific targets, 86 Six4-specific targets, and 63 common targets However, this classification may not necessarily be definite considering the data from transient transfection assays For example, one of the Six1-specific target genes, Gas1, was also activated by Six4, and another Six1-specific target, Clcn5, was more efficiently repressed by Six4 than by Six1 In addition, we clearly showed that Six1 can bind to Six4-binding sites, thus, many of the Six4-regulated genes would be also identified as target genes of Six1 VP16 fusion Six proteins are expected to activate their target genes independent of other transcription factors or cofactors that are 3036 Response of potential target genes to Six1 and Six4 We previously reported that Six2, Six4 and Six5 activated the myogenin promoter, and such activation was enhanced by Eya proteins [18] Furthermore, the extent of activation was dependent on the combinations of Six and Eya In this study, we identified various types of target genes that showed similar activation by Six1 and Six4 (Gas1), that were efficiently activated by Six1 compared with Six4 (Slc12a2) and that were repressed by Six1 and even more strongly by Six4 (Clcn5) Such differential regulation of each target gene by Six1 and Six4 may reflect some aspects of the regulatory action in vivo, which should be clarified in future analyses The presence of target genes activated and repressed by Six1 is consistent with the recent finding that Xenopus six1 affects ectodermal genes through both transcriptional activation and repression [40] To explore the molecular mechanism of the differential regulation by Six1 and Six4, we analysed the responsive elements of Slc12a2 gene promoter Our results showed that the number of Six1-binding sites is at least three, whereas there is one Six4-binding site, indicating that the DNA-binding specificity of Six1 is distinct from that of Six4 Another member of the Six1 ⁄ subfamily, Six2, showed similar features, i.e residual activation by Six2 even in a mutation myogenin promoter construct of the MEF3 site, which abolished Six4 and Six2 binding, due to the presence of additional Six2-binding sites other than MEF3 that are not identified in the myogenin promoter region [18] Although we did not address the structural basis of the differential regulation of the promoter by Six1 and Six4 proteins, our results clearly demonstrated that Six1 and Six4 could regulate their target genes differently This predicts that Six1 and Six4 may each express a unique function in some cases, whereas they may play a common role in other cases In fact, we previously reported that Six1 could compensate for the Six4 function but Six4 did not compensate for Six1 function during the development of various organs [16,23] Furthermore, our recent studies of FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al Six1– ⁄ – ⁄ Six4– ⁄ – mice revealed specific anomalies in earlier stages of otic and nasal development and in the formation of branchial arch and some cranial ganglia, which were not observed in Six4– ⁄ – mice and Six1– ⁄ – mice (K Ikeda & K Kawakami, unpublished observation) These observations indicate that the Six1 and Six4 mutually compensate for their functions in the early stage of development, suggesting a common role Target genes of Six1 and Six4 cochlea would be important for understanding deafness caused by the loss of Slc12a2 RT-PCR analyses of E10.5 embryo showed that the expression levels of Figf and Col2a1 were reduced in Six1– ⁄ – ⁄ Six4– ⁄ – embryos compared with wild-type This result suggests that these genes are upregulated by Six1 and Six4 in the developing embryo Experimental procedures DNA-binding sequences of Six1 and Six4 As for the recognition sequence of Six1, which were identified in this study, it is difficult to predict the consensus sequence of the binding sites The binding site of the most similar protein Six2 has recently been reported in Gdnf gene promoter [41] It contains two Six2-binding sites that show similarity to the homeodomain binding core sequence TAAT [41] However, this core sequence was not found in binding sequences of Six1 identified in this study The binding of Six1 may not depend on the exact DNA sequence but rather some structural features like nonsequence-specific HMG protein DNA recognition [42] A new binding site of Six4, the transcriptional regulatory element X (Trex), which is the positive control element within the muscle creatine kinase (MCK) enhancer, has been recently reported [43] We found (G)ACCCGAG, a single mismatch sequence of the MCK Trex, in the +129 ⁄ +138 region of the Slc12a2 promoter Direct target of Six1 and Six4 in vivo Six1 enhanced the promoter activity of Slc12a2 more efficiently than Six4 This was explained by the presence of multiple binding sites of Six1 that exceed in number those of Six4 in the promoter region Although the expression profile of Slc12a2 has not been precisely analysed in the context of development of the kidney and dorsal root ganglion, differential regulation by Six1 and Six4 might be relevant in certain developmental stages in a specific organ In our in situ hybridization analyses of the dorsal root ganglia, the expression levels of Slc12a2 in Six1– ⁄ – embryos were similar to those in the wild-type, whereas the level of expression was markedly reduced in Six1– ⁄ – ⁄ Six4– ⁄ – embryos compared with wild-type These results indicate that Six4 can support the expression of Slc12a2 in the absence of Six1 and that the common binding site around +135 ⁄ +138 is important for the expression of Slc12a2, at least in the developing dorsal root ganglion Similar analyses in the developing FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Plasmid construction Construction of expression plasmids and luciferase reporter plasmids is described briefly here and in full in the supplementary material Plasmids expressing FLAG-tagged Six1 and Six4 (pfSix1 and pfSix4) were constructed as described previously [18,44] To construct constitutively active Six1 and Six4, a transcription activation domain of herpes simplex virus virion protein 16 (VP16) [45] was fused to the N-terminal end of full-length Six proteins [pCS2 + FLAG VP16– Six1wt and pCS2 + FLAG VP16–Six4wt] As a control, mutated proteins harboring a tryptophan (W) to arginine (R) substitution were used [pCS2 + FLAG VP16– Six1W171R and pCS2 + FLAG VP16–Six4W263R] The corresponding mutation in the Six5 HD abolishes DNAbinding activity [24] Plasmids harboring the 5¢ upstream region of Slc12a2 were constructed by inserting appropriate fragments prepared from pGL3-2065 [46] into pGL3-basic (Promega Bioscience, San Luis Obispo, CA) To construct Clcn5) 1325Luc, a mouse Clcn5 promoter fragment ()1325 to +2529) was amplified from C57BL ⁄ genomic DNA and ligated into pGL3-basic To construct Gas1)3409Luc, a Gas1 promoter fragment excised from pUBT–luc ⁄ Gas1 3.5 k [47] was ligated into pGL3-basic pGL3MG185 which harbors )185 to +50 of the myogenin promoter was described previously [18] Production of recombinant adenovirus Recombinant adenoviruses were produced using the Adenovirus Expression Vector Kit (Takara Bio, Shiga, Japan) as described previously [24] Briefly, HindIII–XbaI fragments encoding VP16–Six1wt and VP16–Six1W171R were excised from pCS2 + FLAG VP16 constructs, blunted and ligated into SwaI-cut pAxCAwt cosmid vector Likewise, ClaI– XbaI fragments encoding VP16–Six4wt and VP16– Six4W263R were excised, blunted and ligated into pAxCAwt The recombinant cosmids were cotransfected with the EcoT221-digested AxCAwt DNA-terminal protein complex into 293 cells The recombinant viruses were isolated, propagated and checked for titer (plaque forming unit) and 3037 Target genes of Six1 and Six4 transgene expression Virus titration was carried out using 293 cells and western blotting was used to assess the expression of recombinant proteins Cell culture mK4 cells were cultured as described previously [25] COS7 and 293 cells were grown as described previously [18,24] Virus infection and transient transfection Adenovirus-infection was carried out as described previously [24] To adjust the expression levels of recombinant proteins, we infected mK4 cells at the following multiplicity of infection values: AxCAwt VP16–Six1wt (25), AxCAwt VP16–Six1W171R (200), AxCAwt VP16–Six4wt (50) and AxCAwt VP16–Six4W263R (200) Transfections were carried out using CellPhect (Amersham Biosciences, Piscataway, NJ) or Lipofectamine 2000 (Invitrogen, Carlsbad, CA) in 24-well plates The cells were harvested after two days Luciferase activity was normalized for total protein content in cell lysates Data were shown as mean ± SEM Semiquantitative RT-PCR analysis Total RNA used in the microarray analysis (10 or 100 ng) or total RNA prepared from mouse embryos (100 ng) was subjected to RT-PCR using OneStep RT-PCR kit (Qiagen, Hilden, Germany) and the PCR primers listed in the supplemental Table S2 Each set of PCR primers was derived from different exons except that for the intronless Gas1 For RT-PCR analysis of Gas1, RNA samples were treated with RNase-free DNaseI and checked for the absence of visible PCR products even after 32 cycles of amplification as described previously [24] Aliquots of PCR products were removed from the thermal cycler at multiple cycle numbers, separated on a 5% acrylamide gel, stained with the fluorescent dye Vistra Green (Amersham Biosciences) and scanned using the STORM system (Amersham Biosciences) Quantitation of the amplified products was carried out using the STORM system and imagequant software (Molecular Dynamics, Sunnyvale, CA) Linearity of PCR amplification was maintained over several cycles, and the amount of PCR products at 16–28 cycles, depending on the gene, was selected for comparison Three independent RT-PCR reactions were set up from the same RNA samples For analysis of samples from mouse embryos, b-actin mRNA was also amplified as an internal control to monitor for embryo-to-embryo variations in the quality of input RNA Gel-retardation assay Gel-retardation assays were carried out as described previously [48] GST–Six1 and GST–Six4 (SMNTND1) were 3038 Z-i Ando et al prepared as described previously [2,44] Restriction fragments of Slc12a2 promoter and annealed double-stranded oligonucleotides were end-labeled with [32P]dCTP[aP] by Klenow fragment or with [32P]ATP[cP] by T4 polynucleotide kinase Quantitation of the hybridization signals was carried out using the STORM system (Amersham Biosciences) and imagequant software (Molecular Dynamics) Nuclear extracts and C3 oligonucleotide probe were prepared as described previously [2] In situ hybridization and ethical consideration These experiments were conducted in wild-type, Six1– ⁄ – and Six1– ⁄ – ⁄ Six4– ⁄ – mice of either sex at E16.5 and E18.5 The in situ hybridization histochemistry was performed essentially as described previously [49] An antisense oligo cDNA probe and a sense cDNA probe (complementary to the antisense) for mouse Slc12a2 mRNA were designed as follows; Slc12a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc12a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT All experimental protocols described in this study were approved by the Ethics Review Committee for Animal Experimentation of Jichi Medical School Acknowledgements We thank S S Potter for providing mK4 cells, R de Martin for pUBT-luc ⁄ Gas1 3.5 k and E Delpire for pGL3-2065 plasmids We also thank M Nakamura, Y Goto and Y Takano for the expert technical assistance This work was supported by grants from Ministry of Education, Culture, Sports, Science and Technology of JAPAN (KK and SS), The Science Research Promotion Fund from The Promotion and Mutual Aid Corporation for Private Schools of Japan (KK) and The Research Award to JMS Graduate Student (ZA) References Kawakami K, Sato S, Ozaki H & Ikeda K (2000) Six family genes – structure and function as transcription factors and their roles in development Bioessays 22, 616–626 Kawakami K, Ohto H, Ikeda K & Roeder RG (1996) Structure, function and expression of a murine homeobox protein AREC3, a homologue of Drosophila sine oculis gene product, and implication in development Nucleic Acids Res 24, 303–310 Serikaku MA & O’Tousa JE (1994) sine oculis is a homeobox gene required for Drosophila visual system development Genetics 138, 1137–1150 FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al Pignoni F, Hu B, Zavitz KH, Xiao J, Garrity PA & Zipursky SL (1997) The eye-specification proteins So and Eya form a complex and regulate multiple steps in Drosophila eye development Cell 91, 881–891 Kobayashi M, Toyama R, Takeda H, Dawid IB & Kawakami K (1998) Overexpression of the forebrainspecific homeobox gene six3 induces rostral forebrain enlargement in zebrafish Development 125, 2973–2982 Zuber ME, Perron M, Philpott A, Bang A & Harris WA (1999) Giant eyes in Xenopus laevis by overexpression of Xoptx2 Cell 98, 341–352 Loosli F, Winkler S & Wittbrodt J (1999) Six3 overexpression initiates the formation of ectopic retina Genes Dev 13, 649–654 Zhu CC, Dyer MA, Uchikawa M, Kondoh H, Lagutin OV & Oliver G (2002) Six3-mediated auto repression and eye development requires its interaction with members of the Groucho-related family of co-repressors Development 129, 2835–2849 Carl M, Loosli F & Wittbrodt J (2002) Six3 inactivation reveals its essential role for the formation and patterning of the vertebrate eye Development 129, 4057–4063 10 Lagutin OV, Zhu CC, Kobayashi D, Topczewski J, Shimamura K, Puelles L, Russell HRC, McKinnon PJ, Solnica-Krezel L & Oliver G (2003) Six3 repression of Wnt signaling in the anterior neuroectoderm is essential for vertebrate forebrain development Genes Dev 17, 368–379 ´ 11 Lopez-Rı´ os J, Tessmar K, Loosli F, Wittbrodt J & Bovolenta P (2003) Six3 and Six6 activity is modulated by members of the groucho family Development 130, 185–195 12 Sarkar PS, Appukuttan B, Han J, Ito Y, Ai C, Tsai W, Chai Y, Stout JT & Reddy S (2000) Heterozygous loss of Six5 in mice is sufficient to cause ocular cataracts Nat Genet 25, 110–114 13 Klesert TR, Cho DH, Clark JI, Maylie J, Adelman J, Snider L, Yuen EC, Soriano P & Tapscott SJ (2000) Mice deficient in Six5 develop cataracts: implications for myotonic dystrophy Nat Genet 25, 105–109 14 Sarkar PS, Paul S, Han J & Reddy S (2004) Six5 is required for spermatogenic cell survival and spermiogenesis Hum Mol Genet 13, 1421–1431 15 Oliver G, Wehr R, Jenkins NA, Copeland NG, Cheyette BNR, Hartenstein V, Zipursky SL & Gruss P (1995) Homeobox genes and connective tissue patterning Development 121, 693–705 16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K, Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J, Asano M et al (2001) Six4, a putative myogenin gene regulator, is not essential for mouse embryonal development Mol Cell Biol 21, 3343–3350 17 Spitz F, Demignon J, Porteu A, Kahn A, Concordet JP, Daegelen D & Maire P (1998) Expression of myogenin FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Target genes of Six1 and Six4 18 19 20 21 22 23 24 25 26 27 28 29 30 31 during embryogenesis is controlled by Six ⁄ sine oculis homeoproteins through a conserved MEF3 binding site Proc Natl Acad Sci USA 95, 14220–14225 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation of Eya Mol Cell Biol 19, 6815–6824 Laclef C, Hamard G, Demignon J, Souil E, Houbron C & Maire P (2003) Altered myogenesis in Six1-deficient mice Development 130, 2239–2252 Laclef C, Souil E, Demignon J & Maire P (2003) Thymus, kidney and craniofacial abnormalities in Six1 deficient mice Mech Dev 120, 669–679 Xu P-X, Zheng W, Huang L, Maire P, Laclef C & Silvius D (2003) Six1 is required for the early organogenesis of mammalian kidney Development 130, 3085–3094 Zheng W, Huang L, Wei ZB, Silvius D, Tang B & Xu P-X (2003) The role of Six1 in mammalian auditory system development Development 130, 3989–4000 Ozaki H, Nakamura K, Funahashi J, Ikeda K, Yamada G, Tokano H, Okamura H, Kitamura K, Muto S, Kotaki H et al (2004) Six1 controls patterning of the mouse otic vesicle Development 131, 551–562 Sato S, Nakamura M, Cho DH, Tapscott SJ, Ozaki H & Kawakami K (2002) Identification of transcriptional targets for Six5: implication for the pathogenesis of myotonic dystrophy type Hum Mol Genet 11, 1045–1058 Valerius MT, Patterson LT, Witte DP & Potter SS (2002) Microarray analysis of novel cell lines representing two stages of metanephric mesenchyme differentiation Mech Dev 110, 151–164 Tomari S, Nagahama H, Shu Y, Hoshi S, Nakayama K, Nakayama KI & Nagata M (2002) Glomerular differentiation in p27 and p57 double-mutant metanephroi Anat Embryol 206, 31–36 Sung KW, Kirby M, McDonald MP, Lovinger DM & Delpire E (2000) Abnormal GABAA receptor-mediated currents in dorsal root ganglion neurons isolated from Na-K-2Cl cotransporter null mice J Neurosci 20, 7531–7538 Pace AJ, Lee E, Athirakul K, Coffman TM, O’Brien DA & Koller BH (2000) Failure of spermatogenesis in mouse lines deficient in the Na+-K+-2Cl– cotransporter J Clin Invest 105, 441–450 Delpire E, Lu J, England R, Dull C & Thorne T (1999) Deafness and imbalance associated with inactivation of the secretory Na-K-2Cl co-transporter Nat Genet 22, 192–195 Dixon MJ, Gazzard J, Chaudhry SS, Sampson N, Schulte BA & Steel KP (1999) Mutation of the Na-KCl co-transporter gene Slc12a2 results in deafness in mice Hum Mol Genet 8, 1579–1584 Suzuki-Yagawa Y, Kawakami K & Nagano K (1992) Housekeeping Na, K-ATPase a1 subunit gene promoter 3039 Target genes of Six1 and Six4 32 33 34 35 36 37 38 39 40 41 42 43 is composed of multiple cis elements to which common and cell type-specific factors bind Mol Cell Biol 12, 4046–4055 Avantaggiato V, Orlandini M, Acampora D, Oliviero S & Simeone A (1998) Embryonic expression pattern of the murine figf gene, a growth factor belonging to platelet-derived growth factor ⁄ vascular endothelial growth factor family Mech Dev 73, 221–224 Lee CS, Buttitta L & Fan CM (2001) Evidence that the WNT-inducible growth-arrest specific gene encodes an antagonist of sonic hedgehog signaling in the somite Proc Natl Acad Sci USA 98, 11347–11352 Cobourne MT, Milentich I & Sharpe PT (2004) Restriction of sonic hedgehog signalling during early tooth development Development 131, 2875–2885 Tanaka K, Fisher SE & Craig IW (1999) Characterization of novel promoter and enhancer elements of the mouse homologue of the Dent disease gene, CLCN5, implicated in X-linked hereditary nephrolithiasis Genomics 58, 281–292 Gunther W, Piwon N & Jentsch TJ (2003) The ClC-5 ă chloride channel knock-out mouse an animal model for Dent’s disease Pflugers Arch 445, 456–462 Donahue LR, Chang B, Mohan S, Miyakoshi N, Wergedal JE, Baylink DJ, Hawes NL, Rosen CJ, Ward-Bailey P, Cheng QY et al (2003) A missense mutation in the mouse Col2a1 gene causes spondyloepiphyseal dysplasia congenita, hearing loss, and retinoschisis J Bone Mineral Res 18, 1612–1621 Hubner CA, Lorke DE & Hermans-Borgmeyer I ¨ (2001) Expression of the Na-K-2Cl-cotransporter NKCC1 during mouse development Mech Dev 102, 267–269 Bergstrom DA, Penn BH, Strand A, Perry RLS, Rudnicki MA & Tapscott SJ (2002) Promoter-specific regulation of MyoD binding and signal transduction cooperate to pattern gene expression Mol Cell 9, 587–600 Brugmann SA, Pandur PD, Kenyon KL, Pignoni F & Moody SA (2004) Six1 promotes a placodal fate within the lateral neurogenic ectoderm by functioning as both a transcriptional activator and repressor Development 131, 5871–5881 Brodbeck S, Besenbeck B & Englert C (2004) The transcription factor Six2 activates expression of the Gdnf gene as well as its own promoter Mech Dev 121, 1211–1222 Dragan AI, Read CM, Makeyeva EN, Milgotina EI, Churchill MEA, Crane-Robinson C & Privalov PL (2004) DNA binding and bending by HMG boxes: energetic determinants of specificity J Mol Biol 343, 371–393 Himeda CL, Ranish JA, Angello JC, Maire P, Aebersold R & Hauschka SD (2004) Quantitative proteomic identification of Six4 as the Trex-binding factor in the 3040 Z-i Ando et al 44 45 46 47 48 49 50 51 52 53 54 55 muscle creatine kinase enhancer Mol Cell Biol 24, 2132–2143 Ozaki H, Watanabe Yoko Ikeda K & Kawakami K (2002) Impaired interactions between mouse Eya1 harboring mutations found in patients with branchio-otorenal syndrome and Six, Dach, and G proteins J Hum Genet 47, 107–116 Kessler DS (1997) Siamois is required for formation of Spemann’s organizer Proc Natl Acad Sci USA 94, 13017–13022 Randall J, Thorne T & Delpire E (1997) Partial cloning and characterization of Slc12a2: the gene encoding the secretory Na+-K+-2Cl– cotransporter Am J Physiol 273, C1267–C1277 de Martin R, Cowled PA, Smith SE, Papavassiliou AG, Sorrentino V, Philipson L & Bohmann D (1993) Structure and regulation of the growth arrest-specific (gas1) promoter J Biol Chem 268, 22788–22793 Kawakami K, Scheidereit C & Roeder RG (1988) Identification and purification of human immunoglobulin-enhancer-binding protein (NF-jB) that activates transcription from a human immunodeficiency virus type promoter in vitro Proc Natl Acad Sci USA 85, 4700–4704 Toyoda H, Ohno K, Yamada J, Ikeda M, Okabe A, Sato K, Hashimoto K & Fukuda A (2003) Induction of NMDA and GABAA receptor-mediated Ca2+ oscillations with KCC2 mRNA downregulation in injured facial motoneurons J Neurophysiol 89, 1353–1362 Schwab K, Patterson LT, Aronow BJ, Luckas R, Liang HC & Potter SS (2003) A catalogue of gene expression in the developing kidney Kidney Int 64, 15881604 Miosge N, Kother F, Heinemann S, Kohfeldt E, Heră ken R & Timpl R (2000) Ultrastructural colocalization of nidogen-1 and nidogen-2 with laminin-1 in murine kidney basement membranes Histochem Cell Biol 113, 115–124 Nagahama H, Hatakeyama S, Nakayama K, Nagata M, Tomita K & Nakayama K (2001) Spatial and temporal expression patterns of the cyclin-dependent kinase (CDK) inhibitors p27Kip1 and p57Kip2 during mouse development Anat Embryol 203, 77–87 Kaplan MR, Plotkin MD, Brown D, Hebert SC & Delpire E (1996) Expression of the mouse Na-K-2Cl cotransporter, mBSC2, in the terminal inner medullary collecting duct, the glomerular and extraglomerular mesangium, and the glomerular afferent arteriole J Clin Invest 98, 723–730 Shull GE, Greeb J & Lingrel JB (1986) Molecular cloning of three distinct forms of the Na+,K+-ATPase alpha-subunit from rat brain Biochemistry 25, 8125– 8132 Lloyd SE, Pearce SHS, Fisher SE, Steinmeyer K, Schwappach B, Scheinman SJ, Harding B, Bolino A, Devoto M, Goodyer P et al (1996) A common mole- FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Z-i Ando et al cular basis for three inherited kidney stone diseases Nature 379, 445–449 56 Ma T, Yang B, Gillespie A, Carlson EJ, Epstein CJ & Verkman AS (1998) Severely impaired urinary concentrating ability in transgenic mice lacking aquaporin-1 water channels J Biol Chem 273, 4296– 4299 57 Martinez G, Loveland KL, Clark AT, Dziadek M & Bertram JF (2001) Expression of bone morphogenetic protein receptors in the developing mouse metanephros Exp Nephrol 9, 372–379 Supplementary material The following material is available from http://www blackwellpublishing.com/products/journals/suppmat/EJB/ EJB4716/EJB4716sm.htm FEBS Journal 272 (2005) 3026–3041 ª 2005 FEBS Target genes of Six1 and Six4 Table S1 A complete list of potential target genes regulated by Six1 and ⁄ or Six4 in mk4 cells Fig S1 Scatter plot analysis of microarray data Logscale scatter plots of normalized fluorescent intensity values (normalized data) obtained from Cy3 and Cy5 channels The Agilent Mouse Developmental Oligo Microarrays, which contains 20 371 genes, were hybridized with cDNA probes prepared from mRNAs derived from mk4 cells infected with recombinant adenovirus overexpressing VP16–Six1 fusion proteins (A) and VP16–Six4 fusion proteins (B) Normalized data from Cy3 channel were plotted against Cy5 channel in log scale (A) VP16–Six1wt (Cy3) vs VP16– Six1W171R (Cy5) (B) VP16–Six4wt (Cy3) vs VP16– Six4W263R (Cy5) 3041 ... oligo cDNA probe and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense,... Regulation of Clcn5 promoter by Six1 and Six4 (C) Trans-activation of Slc1 2a2 promoter by Six1 and Six4 (D) Transactivation of myogenin promoter by Six1 and Six4 (E) Gel-retardation assays of Flag? ?Six1. .. genes of Six1 and Six4 Table S1 A complete list of potential target genes regulated by Six1 and ⁄ or Six4 in mk4 cells Fig S1 Scatter plot analysis of microarray data Logscale scatter plots of normalized