Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... oligo cDNA probe and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, ... Regulation of Clcn5 promoter by Six1 and Six4. (C) Trans-activation of Slc1 2a2 promoter by Six1 and Six4. (D) Trans- activation of myogenin promoter by Six1 a...
Ngày tải lên: 07/03/2014, 17:20
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... 25 2.2 2 1.8 1.4 1.2 1.6 1 0.8 0.6 0.4 0.2 0 A 600 A 600 A 600 Time (h) Fig. 5. His41 is essential for Paracoc- cus pantotrophus NirF, but Asp129 is dis- pensable. Growth plots and time courses of nitrite appearance and disappearance ... presence of two oxo groups at C3 and C8 and methyl groups at positions C2 and C7 [7,22]. Also, its synthesis is mediated via a...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of the vacuolar hydrolases ... peroxisomal aspartate aminotransfer- ase Aat2p in HPLC fraction 7 at a molecular mass of approximately 45 kDa (Fig. 1A) [15]. The predicted molecular mass of Lpx1p is 44...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf
... The absorbance was determined at 492 nm with plate reader (Sunrise, Tecan, Gr ¨ odig, Austria). Data analysis Data were analyzed by Student’s t-test. A value of P < 0.05 was considered statistical ... NANOGP8 60 50 40 30 20 10 0 Mock Mock NANOGP8 NANOGP8 1.8 A B 1.6 1.4 1.2 1 0.8 0.6 0.4 0.2 0 day 1 day 2 day 3 day 4 % Absorbance S stage percentage Fig. 6. FACS analysis results. FACS...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, ... S.pombe his5 + construct amplified from plasmid pUG27 as described above using the primers disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCT...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... health -related quality of life after intensive care in Morocco. Acta Anaesthesiol Scand 2007, 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain ... the acquisition of data. NM helped to draft the manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the study. AAZ participate...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... 5¢-cttcctgtgtcaagtggcag-3¢ (for- ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD 5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggct atcg-3¢ (reverse). Hybridization, washing, antibody reaction and ... o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggc tgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagct gaccaaactccttg-3¢)forMACS1, and cloned into the EcoRI/ XhoIorEcoRI/XbaI site...
Ngày tải lên: 08/03/2014, 02:20
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... cells Kentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa 1 Faculty of Pharmaceutical Sciences, University of Tokushima, Japan The effect of a- tocopheryl hemisuccinate ... Y., Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin a...
Ngày tải lên: 22/02/2014, 04:20
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... Bacitracin is not a specific inhibitor of protein disulfide isomerase Anna-Riikka Karala and Lloyd W. Ruddock Biocenter Oulu and Department of Biochemistry, University of Oulu, Finland Introduction Protein ... domains, a, b, b¢, and a , a linker region x between the b¢ and a domains, and a C-terminal acidic extension. The a and a domains contain the CGHC active s...
Ngày tải lên: 16/02/2014, 14:20
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray 1 , Srijita Dhar 1 , Arvind Shakya 1 , Papiya Ray 1 , Yasunori Okada 2 and Bimal K. Ray 1 1 Department of...
Ngày tải lên: 07/03/2014, 02:20