Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... oligocDNA probe and a sense cDNA probe (complementary tothe antisense) for mouse Slc1 2a2 mRNA were designed asfollows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAATCACCTGGTACCAAGGATGT; Slc1 2a2 sense, ... Regulation of Clcn5 promoter by Six1 and Six4. (C)Trans-activation of Slc1 2a2 promoter by Six1 and Six4. (D) Trans-activation of myogenin promoter by Six1 and Six4. (E) Gel-retarda-tion assays ... microarray as an initial screen-ing to search for potential Six1- and Six4 -target geneswas largely successful.Differential regulation of potential target genesby Six1 and Six4 To verify that...
- 16
- 476
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... 252.221.81.41.21.610.80.60.40.20 A 600 A 600 A 600Time (h)Fig. 5. His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable. Growth plots and time courses of nitrite appearance and disappearance ... presence of two oxogroups at C3 and C8 and methyl groups at positionsC2 and C7 [7,22]. Also, its synthesis is mediated via a separate branch of the tetrapyrrole biosynthetic path-way from uroporphyrinogen ... in a mutant thatlacks NirF; this too is not trivial as the DnirF straindoes not accumulate readily detectable amounts of anintermediate of d1synthesis.Experimental proceduresDNA manipulationsDNA...
- 12
- 613
- 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... Woolford CA, Noble JA, Garman JD, Tam MF, InnisMA & Jones EW (1993) Phenotypic analysis of protein-ase A mutants. Implications for autoactivation and thematuration pathway of the vacuolar hydrolases ... peroxisomal aspartate aminotransfer-ase Aat2p in HPLC fraction 7 at a molecular mass of approximately 45 kDa (Fig. 1A) [15].The predicted molecular mass of Lpx1p is 44 kDa.It carries a peroxisomal ... 5¢-GAGGATCCATGGAACAGAACAGGTTCAAG-3¢ and 5¢-CGGAATTCTTACAGTTTTTGTTTAGTCGTTTTAAC-3¢) was subcloned into EcoRV-digested pBluescript SK+, and then cloned into the BamHI and EcoRI sites of pUG36...
- 11
- 568
- 0
Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf
... The absorbance was determined at 492 nm withplate reader (Sunrise, Tecan, Gr¨odig, Austria).Data analysisData were analyzed by Student’s t-test. A value of P < 0.05 was considered statistical ... NANOGP86050403020100MockMockNANOGP8NANOGP81.8 A B1.61.41.210.80.60.40.20day 1day 2 day 3 day 4% AbsorbanceS stage percentageFig. 6. FACS analysis results. FACS analysis of cells transfectedwith NANOGP8 and ... electrophoresis and the bands were extracted usinggel extraction kit (Omega, Bio-Tek, Doraville, GA, USA).DNA fragments extracted were ligated into T vector (Pro-mega) and sequencing analysis was carried...
- 8
- 495
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... plasmid pUG27 [13] using the primersdisSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, ... S.pombehis5+construct amplified from plasmid pUG27 asdescribed above using the primers disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. ... 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢, respectively. YEp351-SUT2was linearized with SphI and co-transformed...
- 8
- 485
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... health -related quality of life after intensive care in Morocco. Acta Anaesthesiol Scand2007, 51:189-197.27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali-dation of a behavioral pain ... the acquisition of data. NMhelped to draft the manuscript, and participated in the acquisi-tion of data. AZ participated in the coordination of the study.AAZ participated in the design of the ... (RocheDiagnostics, Mannheim, Germany). The limits of detectionwere 0.071 mg/dl.Statistical analysesData are presented as the mean ± standard deviation for vari-ables with a normal distribution, and as the...
- 10
- 597
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... 5¢-cttcctgtgtcaagtggcag-3¢ (for-ward), 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggctatcg-3¢ (reverse). Hybridization, washing, antibody reaction and ... o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, and cloned into the EcoRI/XhoIorEcoRI/XbaI site of a pcDNA3.1/myc-His ... (forward), 5¢-agaacgcatgcagccgaggg-3¢ (reverse); KS2 5¢-tggtagctacctgggaagcc-3¢ (forward), 5¢-gaagcaccagactcattctg-3¢ (reverse);MACS1 5¢-gagttggagctccaagctgg-3¢ (forward), 5¢-tgatccctgttcgcatgcag-3¢...
- 10
- 393
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... cellsKentaro Kogure, Motoki Morita, Susumu Hama, Sawa Nakashima, Akira Tokumura and Kenji Fukuzawa1Faculty of Pharmaceutical Sciences, University of Tokushima, JapanThe effect of a- tocopheryl hemisuccinate ... Y.,Hagiwara, H., Ueyama, H. & Goldstein, A. L. (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulatesrelease of prolactin and growth hormone from rat anterior ... results of Western blot analysis were representative pictures of at leastthree independent experiments.Statistical analysisData were expressed as the mean ± standard deviation of atleast three...
- 6
- 494
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... Bacitracin is not a specific inhibitor of protein disulfideisomeraseAnna-Riikka Karala and Lloyd W. RuddockBiocenter Oulu and Department of Biochemistry, University of Oulu, FinlandIntroductionProtein ... domains, a, b, b¢, and a , a linker region xbetween the b¢ and a domains, and a C-terminal acidicextension. The a and a domains contain the CGHCactive site motif, and are sufficient alone to performthiol–disulfide ... Journal compilation ª 2010 FEBSbacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections causedby...
- 9
- 620
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 1028 A. Ray et al. ... variant of the SAF-1/MAZ/Pur-1family, is expressed during inflammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2 and Bimal K. Ray11 Department of Veterinary ... distinctfunctional SAF isoforms, and imply the existence of combinatorial mechanisms that allow fine regulationby SAF-regulated genes.ResultsIdentification and characterization of a novel SAFisoformScreening...
- 11
- 439
- 0
Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ