Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation Alpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2 and Bimal K Ray1 Department of Veterinary Pathobiology, University of Missouri, Columbia, MO, USA Department of Pathology, School of Medicine, Keio University, Tokyo, Japan Keywords gene expression; inflammation; SAF-1/MAZ/ Pur-1; splice variant; transcription factor Correspondence B K Ray, Department of Veterinary Pathobiology, University of Missouri, 124 Connaway Hall, Columbia, MO 65211, USA Fax: +1 573 884 5414 Tel: +1 573 882 4461 E-mail: rayb@missouri.edu A Ray, Department of Veterinary Pathobiology, University of Missouri, 126 Connaway Hall, Columbia, MO 65211, USA Fax: +1 573 884 5414 Tel: +1 573 882 6728 E-mail: rayal@missouri.edu Database The sequence for MAZ genomic DNA has been submitted to the Genbank database under the accession numbers D89880 (Received January 2009, revised 12 May 2009, accepted June 2009) The Cys2His2-type zinc finger transcription factor serum amyloid A activating factor [SAF-1, also known as MAZ (myc-associated zinc finger protein) or Pur-1 (purine binding factor-1)] plays an important role in regulation of a variety of inflammation-responsive genes An SAF-2 splice variant acting as a negative regulator of SAF-1 was identified previously, and the present study reports the identification of a novel SAF-3 splice variant that is expressed during inflammation SAF-3 mRNA, isolated from a cDNA library produced from IL-1b-induced cells, originates from a previously unknown first coding exon, and thereby contains a unique N-terminal domain but shares the same six zinc finger DNA-binding domains as present in SAF-1 In addition, a negatively functioning domain present at the N-terminus of SAF-1 and SAF-2 is spliced out in SAF-3 The expression of SAF-3 is very low in normal tissues and in cells grown under normal conditions However, RT-PCR analysis of mRNAs from cytokine and growth factor-induced cells as well of mRNAs isolated from several diseased tissues revealed abundant expression of SAF-3 The transactivation potential of SAF-3 is much greater than that of the predominantly expressed splice variant SAF-1 These findings show that transcriptional regulation of downstream inflammation-responsive genes by SAF/MAZ/ Pur-1 is likely to be more complex than previously assumed In addition, we show that SAF-3 expression initiates from an upstream novel promoter This is the first report of the existence of multiple promoters regulating expression of the SAF/MAZ/Pur-1 family of proteins doi:10.1111/j.1742-4658.2009.07136.x Introduction Transcription factors play a central role in regulating cell growth and development as well as in cellular maintenance as a result of their indispensable role in synthesizing mRNA Dysregulation of transcription factor activity leads to alteration in target gene expression patterns, which is one of the most important causes of disease development and progression Exten- sive studies on the characterization of transcription factors have indicated that, in general, transcription factors exist as a family of structurally related proteins, containing conserved and unique domains The family members can perform similar tasks due to the conserved domains but may be functionally specific due to the unique domains The various members of the Abbreviations CAT, chloramphenicol acetyl transferase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; MAZ, myc-associated zinc finger protein; MMP, matrix metalloproteinase; OA, osteoarthritis; Pur-1, purine binding factor-1; RA, rheumatoid arthritis; SAF-1, serum amyloid A activating factor; VEGF, vascular endothelial growth factor 4276 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS A Ray et al family are often generated from a single gene by alternative splicing, which is recognized as an efficient means of increasing the diversity of proteins Serum amyloid A activating factor (SAF-1) is the first identified member of a transcription factor family containing multiple Cys2His2-type zinc finger proteins [1] The human and mouse orthologs of SAF-1 are known as myc-associated zinc finger protein (MAZ) [2] and purine binding factor-1 (Pur-1) [3], respectively The SAF-1/MAZ/Pur-1 transcription factor is an inflammation-responsive protein, and regulates the expression of a variety of genes that include serum amyloid A [1,4], vascular endothelial growth factor (VEGF) [5], p21 [6], several matrix metalloproteinases (MMPs) [7–10], c-myc [2], insulin [3], and the serotonin 1A receptor [11], which are involved in diverse cellular processes and various pathogenic conditions A number of inflammatory stimuli such as cytokines [12], phorbol 12-myristate 13-acetate [13], lipopolysaccharide [14] and oxidized low-density lipoproteins [15] have been shown to activate SAF-1 protein and increase its DNA-binding and transactivating functions The SAF-1 DNA-binding and transcriptional activity is significantly increased in response to mediators of signal transduction and phosphorylation by a number of protein kinases [13,16,17] The transcript level of SAF-1/MAZ is also reported to be increased in response to cytokine stimulation [18], in hepatocellular carcinoma [19], chronic myelogenous leukemia [20] and acute myeloid leukemia [21], and during skeletal myocyte differentiation [22] In a previous analysis, we identified SAF-2 [23], the second member of this family, which is encoded by the same gene by alternate splicing Insertion of a new exon originating from the non-coding sequences of intron of the SAF-1/MAZ gene resulted in creation of a different C-terminus consisting of eight zinc finger domains in SAF-2 [23] The SAF-2 isoform has a much higher DNA-binding activity and acts as a negative regulator of SAF-1 function under normal conditions [23] During inflammation, SAF-2 expression is down-regulated, which alleviates the repression of SAF-1 activity and further promotes SAF-1-mediated transactivation of the target genes [23] In this paper, we present evidence for a third member of SAF family, which is also transcribed from the same gene but originates from an upstream novel start site and contains an entirely different N-terminus Expression of SAF-3 is restricted to inflammatory conditions Further, we present evidence that SAF-3 is much more transcriptionally active than SAF-1 These results shed light on the relevance of the generation of multiple distinct functional SAF isoforms, and imply the existence of Transcription factor SAF-3 is expressed during inflammation combinatorial mechanisms that allow fine regulation by SAF-regulated genes Results Identification and characterization of a novel SAF isoform Screening of an IL-1b-induced human HTB-94 chondrocyte cell cDNA library identified a novel human SAF-1/MAZ/Pur-1 isoform that contains unique N-terminal sequences (Fig 1) This clone, with an open reading frame of 455 amino acids, was designated SAF-3 (GenBank accession number FJ532357), with SAF-1/MAZ/Pur-1 being the originally identified isoform [1–3] Comparison of amino acid sequences indicated that the N-terminal region of SAF-3 is different from that of SAF-1, after which both cDNAs contain identical sequences The previously isolated SAF-2 isoform differs from SAF-3 at both the N- and C-termini [23] SAF-1 and SAF-2 have identical N-termini, but the SAF-2 mRNA contains an unique exon near the 3¢ end, and thus its C-terminus is different from that of SAF-1 [23] The open reading frames in SAF-1, SAF-2 and SAF-3 code for 477, 493 and 455 amino acids, respectively SAF-3 is produced by alternative splicing To determine the presence of unique N-terminal domain in SAF-3, we examined the genomic DNA sequence of human SAF-1/MAZ/Pur-1 [24] Sequence analysis indicated that the unique N-terminal amino acids of SAF-3 are encoded by a previously unidentified exon (exon 1A) that is present 351 nucleotides upstream of the first exon of human SAF-1/MAZ (Fig 2A) The first exon in human SAF-3 (exon 1A) encodes 12 amino acids, including the initiator methionine (Fig 2B) The nucleotide sequence around the initiation ATG codon in SAF-3 matches the translation initiation site consensus sequence as determined by Kozak [25] (Fig 2B) The second exon of SAF-3 (exon 1C) starts at around the middle of the first exon of SAF-1/SAF-2 The SAF-3 transcript also represents an in-frame splicing event, for which the open reading frame remains unchanged The 5¢ and 3¢ splice junctions of exons 1A and 1C match consensus splice donor and acceptor sequences (Fig 2C and Table 1) The N-terminal amino acid sequences of three SAF isoforms are shown in Fig 2D We performed primer extension analysis to determine whether the SAF-3 cDNA contains a full-length 5¢ UTR A 32P-endlabeled, 18-base antisense oligonucleotide primer was FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4277 Transcription factor SAF-3 is expressed during inflammation A Ray et al Fig Analysis of a structurally altered form of SAF The nucleic acid and predicted amino acid sequences of the cDNA encoding SAF-3 are shown The initiator ATG codon and stop codon are indicated 4278 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS A Ray et al Transcription factor SAF-3 is expressed during inflammation F A E G B C H D Fig Schematic representations of SAF splice variants (A) Exons are indicated by white boxes, and 5¢ and 3¢ UTRs by speckled boxes The introns and UTRs are not drawn to scale The positions of the primers used for RT-PCR are indicated by bold lines (B) Sequence of exon 1A in SAF-3 The Kozak consensus sequence is indicated by a line above the sequence (C) The exon/intron boundaries conform to consensus splice junction sequences (D) N-terminal amino acids of the SAF-1/SAF-2 and SAF-3 isoforms (E) Primer extension analysis A 5¢ end-labeled oligonucleotide complementary to a sequence near the 5¢ end of sequenced cDNA (+4 to +21 with respect to translation initiator ATG codon) was used to prime cDNA synthesis using poly(A)+ RNA from IL-1b-induced HTB-94 cells (lane 2) The arrow indicates the major primer extension product, and the arrowheads show minor primer extension products As a negative control, yeast tRNA was used in separate extension reaction, and no extension product was produced (lane 3) Lane contains a G-specific reaction of an unrelated sequence that was used as a size marker to determine the length of the primer extension products (F) RT-PCR analysis Total RNA isolated from IL-1binduced HTB-94 cells was subjected to reverse transcription and nested PCR using SAF-3-specific (lane 1) and SAF-1-specific (lane 2) oligonucleotide primers The amplified product was verified by direct DNA sequencing (G) Bacterially expressed SAF-1 (lane 2) and SAF-3 (lane 3) proteins were fractionated by SDS–PAGE The migration positions of these proteins in lanes and are indicated Lane contains proteins from vector-transfected cells (H) In vitro transcription and translation A linear plasmid containing full-length SAF-3 cDNA downstream of T7 RNA polymerase transcription start sequences was subjected to in vitro transcription and translation The protein products were labeled with 35S-methionine, fractionated by SDS–PAGE and autoradiographed Lane contains no added DNA and lane contains SAF-3 plasmid DNA The sizes of the protein products were identified using standard protein molecular weight markers Table Sequences of exon/intron junctions in human SAF-3 Exon sequences are shown in upper-case letters, and intron sequences are shown in lower-case letters Exon Intron size Exon (nt) size 5¢ splice donor (nt) 3¢ splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG 1028 utilized for the primer extension reaction, and indicated several possible transcription start sites for SAF-3 mRNA (Fig 2E, lane 2) However, the estimated length of the major primer extension product corresponded well with the sequence of cloned SAF-3, suggesting that this cDNA possibly contains a fulllength 5¢ UTR The two faint but longer primerextended products that were visible in Fig 2E, lane 2, probably arise from other transcription start sites, and are minor transcription products Nested RT-PCR analysis was performed for further verification of the existence of novel exon 1A in SAF-3 A product of the FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4279 Transcription factor SAF-3 is expressed during inflammation right size was amplified from mRNAs of IL-1binduced HTB-94 cells using an upstream primer corresponding to the 5¢ untranslated sequences of SAF-3 and a downstream primer corresponding to the sequences at exon (Fig 2F, lane 1) The identity of the PCR-amplified product was verified by DNA sequence analysis The same downstream primer at exon 2, together with an upstream primer corresponding to the SAF-1 sequence at exon 1B, produced an SAF-1-specific PCR product (Fig 2F, lane 2) The translation product of SAF-3 cDNA was determined by cloning SAF-3 cDNA in a bacterial expression vector (Fig 2G) In line with the cDNA size, bacterially expressed SAF-3 protein migrates slightly faster than bacterially expressed SAF-1 protein in the same vector (Fig 2G, compare lanes and 2) We performed a coupled in vitro transcription and translation reaction to further determine whether SAF-3 is indeed initiated from the first ATG codon The SAF-3 protein translated from the predicted ATG codon is 455 amino acids long The next ATG codon in the SAF-3 cDNA is 603 nucleotides downstream of the first ATG codon, and a protein initiated from this ATG would be of considerable smaller size, containing 254 amino acids and with an approximate molecular mass of 28 kDa As seen in Fig 2H, lane 3, the in vitro transcribed and translated protein product from SAF-3 cDNA was of A B A Ray et al similar size to that obtained using the bacterial expression system, indicating that the major translation product of SAF-3 mRNA is 455 amino acids long Inflammation-responsive expression of SAF-3 To determine the expression pattern of SAF-3, we hybridized a multiple-tissue Northern blot with a radiolabeled SAF-3-specific oligonucleotide probe (corresponding to exon 1A), and found no detectable signal (Fig 3A) However, upon re-hybridization with a full-length SAF-1 cDNA probe containing sequences common to SAF-1, SAF-2 and SAF-3, the same blot showed the presence of multiple bands (Fig 3B) As a positive control for the SAF-3-specific oligonucleotide probe, we prepared SAF-1 and SAF-3 RNA by in vitro transcription and hybridized the RNA with radioactive SAF-3 oligonucleotide probe This probe clearly detected in vitro transcribed SAF-3 mRNA but did not detect SAF-1 mRNA (Fig 3C) Together, these results suggest very low SAF-3 expression in normal tissues Given that SAF-3 was isolated from a cDNA library produced from IL-1b-induced cells, we examined the status of this isoform during cytokine stimulation of cells RT-PCR of RNA isolated from untreated and IL-1b-treated HTB-94 cells showed expression of a detectable level of SAF-3 only upon cytokine induction C D E Fig Cytokine or growth factor treatment stimulates expression of SAF-3 (A) Northern analysis of an RNA blot (Clontech) containing 1.0 lg of poly(A)+ RNA per lane from various tissues as indicated The blot was hybridized using a 32P-labeled oligonucleotide probe containing unique exon 1A sequences of SAF-3 mRNA (B) The same blot was stripped and re-hybridized with a full-length 1.4 kb 32P-labeled SAF-1 cDNA probe (C) SAF-1 (lane 2) and SAF-3 (lane 3) RNAs were in vitro transcribed from corresponding cDNA plasmids by T7 RNA polymerase Reaction products were fractionated in a 1% agarose gel, transferred to nylon membrane, and hybridized with a 32P-labeled oligonucleotide probe containing unique exon 1A sequences of SAF-3 mRNA Lane contains HindIII-digested kcI857 DNA (D) HTB-94 and Saos-2 cells were treated with or without IL-1b (500 mL)1) or TGFb (5 ngỈmL)1), as indicated Total RNA isolated from these cells was subjected to reverse transcription followed by nested PCR amplification to monitor SAF-3 expression The same sets of RNAs were also used to monitor MMP-9 and GAPDH expression, as indicated The PCR products were separated in a 1.5% agarose gel and visualized by ethidium bromide staining (E) Western blotting with SAF-3-specific antibody One microgram each of purified bacterially expressed SAF-1 protein (lane 1) and SAF-3 protein (lane 2) and 50.0 lg each of uninduced (lane 3) and IL-1b-induced (lane 4) HTB-94 cell extracts were fractionated by 11% SDS– PAGE, transferred onto membrane and Western blotted with anti-SAF-3 serum The arrow indicates SAF-3 protein in IL-1b-induced cells 4280 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS A Ray et al (Fig 3D, lanes and 2) SAF-3 was also detected in TGFb-induced Saos-2 osteosarcoma cells (Fig 3D, lanes and 4) As positive control, we examined the expression of MMP-9, which is known to be induced in HTB-94 cells by both IL-1b and TGFb MMP-9 expression was detected in both IL-1b- and TGFbstimulated cells As a control for the same input of RNA in RT-PCR, the glyceraldehyde-3-phosphate dehydrogenase (GADPH) expression pattern was monitored, and this remained unchanged during cytokine induction To detect in vivo expression of SAF-3, a specific antibody was generated utilizing the unique N-terminal peptide sequences Western blot analysis was performed to confirm the specificity of this antibody, as it did not detect bacterially expressed SAF-1 protein but clearly detected bacterially expressed SAF-3 protein (Fig 3E, lanes and 2) SAF-3 expression was detected at a low level in IL-1b-induced HTB-94 cells using this antibody (Fig 3E, lanes and 4) Detection of SAF-3 mRNA in chronic inflammatory diseased tissues Given the cytokine-responsive expression of SAF-3, we examined its level in diseased tissues Osteoarthritis (OA) is a chronic inflammatory disease that involves degeneration of the cartilage tissue, while rheumatoid arthritis (RA) is a systematic chronic inflammatory and destructive arthropathy As seen in Fig 4, SAF-3 mRNA expression was detected in OA synovial (Fig 4, lanes 3–6) and RA synovial (Fig 4, lanes 7–9) tissues, but very little to no SAF-3 mRNA expression was detected in normal synovium (Fig 4, lanes and 2) SAF-1 expression was detected in normal tissues and was slightly elevated in both disease conditions This result is consistent with previous findings indicating that the main mode of activation of SAF-1 is by post-translational modification, including phosphoryla- Fig SAF-3 expression is detected in human arthritic tissues Total RNA was isolated from representative normal, OA and RA synovium tissues and subjected to RT-PCR using SAF-3-, SAF-1and GAPDH-specific primers, as indicated GAPDH expression was used as an internal control Transcription factor SAF-3 is expressed during inflammation tion [13, 16, 17] Together, these results indicated that SAF-3 expression is very low and highly regulated under normal conditions, but increases in response to pathogenic signals and cytokine or growth factor stimulation SAF-3 is a superior transcriptional activator SAF-3 contains six zinc finger motifs, and should have the ability to interact with DNA at a similar level to SAF-1 [26] However, because it contains a different N-terminus, the transactivation potential of SAF-3 may be different, and it may thereby regulate expression of downstream genes at a different level To determine the functional significance of SAF-3, we compared its transactivation potential with that of SAF-1 The SAF-3 expression plasmid transactivated expression of the SAF-3X-CAT reporter at a much higher level than the same amount of SAF-1 expression plasmid DNA (Fig 5A) To rule out the possibility that SAF-1 and SAF-3 proteins were not expressed at the same level, we performed a Western blot assay using an anti-His tag IgG and representative transfected cells (Fig 5B) This experiment showed no discrepancy in the expression of proteins, indicating that SAF-3 is a superior transcriptional activator compared to SAF-1 For further verification, we compared ability of these two isoforms to transactivate expression of VEGF, a natural SAF-regulated gene [5] In correlation with previous results, the SAF-3 expression plasmid increased expression of the 1.2 VEGF-CAT reporter in a more effective manner (Fig 5C) Together, these results show that the SAF-3 splice variant has significantly higher transactivation potential SAF-3 mRNA is transcribed from a distinct transcription start site An SAF-1/SAF-2-specific 5¢ RACE did not reveal any upstream 5¢ sequences in SAF-3 (data not shown); this suggests that SAF-3 and SAF-1/SAF-2 mRNAs may be transcribed from distinct promoter regions To determine whether SAF-3 and SAF-1/SAF-2 mRNAs are initiated from different promoters, we examined the respective 5¢ flanking regions Genomic DNA sequences upstream of SAF-3 and SAF-1/SAF-2 were ligated into the promoterless vector pBLCAT3 to produce ()2000/+200)SAF-CAT, ()2000/)351)SAFCAT and ()351/+200)SAF-CAT reporter constructs Transient transfection of HTB-94 cells with these reporters resulted in significantly higher levels of chloramphenicol acetyl transferase (CAT) activity, FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4281 Transcription factor SAF-3 is expressed during inflammation A Ray et al albeit variable, compared to cells transfected with the promoterless pBLCAT3 vector (Fig 6) These results clearly indicate that the DNA sequences between )2000 and )351 and )351 and +200 contain necessary elements that can promote transcription We conclude from these results that the human SAF-1 gene has at least two promoters A Discussion In this paper, we describe a novel splice variant of SAF-1/MAZ/Pur-1 family of transcription factors that may be involved in regulating inflammation-induced expression of various SAF targets associated with pathogenic conditions In addition, we provide the first evidence of the existence of two promoters in the human SAF-1/MAZ/Pur-1 gene that permit transcription of multiple mRNAs with different N-termini The novel SAF-3 splice variant reported here is transcribed from the upstream promoter SAF-3 is predominantly expressed in cytokine- and growth factor-treated cells and in diseased tissues, but is barely detectable under normal conditions B C A B Fig Transactivation potential of SAF-3 (A) HTB-94 cells were co-transfected with SAF3X-CAT2 reporter plasmid (0.5 lg) and pCMV-bgal expression plasmid (0.4 lg) without ()) or together with (+) empty vector pcDNA3 (0.5 lg), pcDSAF-1 (0.5 lg) or pcDSAF-3 (0.5 lg) expression plasmid DNA, as indicated After 24 h, cells were harvested and equivalent amounts of cell extracts were assayed for CAT reporter activity The data shown represent the mean ± SEM of three separate experiments (*P < 0.05 versus control) (B) Western blot analysis of transfected cells with anti-His tag IgG (C) CAT reporter assay HTB-94 cells were transfected with 1.2VEGF-CAT reporter plasmid (0.5 lg) and pCMV-bgal expression plasmid (0.4 lg) without ()) or together with increasing concentrations (0.2, 0.3, 0.4 and 0.5 lg) of pcDSAF-1 or pcDSAF3 expression plasmid DNA, as indicated After 24 h, cells were harvested and equivalent amount of cell extracts were assayed for CAT reporter activity The data shown represent the mean ± SEM of three separate experiments (*P < 0.05) 4282 Fig SAF-3 mRNA is transcribed from an upstream promoter (A) Schematic drawing of the two promoter regions in the SAF gene (B) CAT reporter assay Each of the reporter constructs (0.5 lg) was co-transfected together with pCMV-bgal expression plasmid (0.4 lg) into HTB-94 cells After 24 h, cells were harvested and equivalent amounts of cell extracts were assayed for CAT reporter activity The data shown represent the mean ± SEM of three separate experiments (*P < 0.05) FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS A Ray et al Alternative splicing is a widespread mechanism of gene regulation, and is also an efficient means of increasing the diversity of proteins from a single gene [27–29] This versatile mode of gene regulation is utilized during development, sex determination, hormonal regulation and apoptosis Deletion or inclusion of an exon during splicing can generate a family of transcription factors that may have subtle or dramatically different properties Due to such changes in specificity and/or binding strength, one member can act as a negative regulator of another member In the SAF family of Cys2/His2-type zinc transcription factors, the three members that have been identified so far are generated from a single gene by alternative splicing SAF-1 and SAF-2 mRNAs initiate from the same start site and thereby have identical N-termini but different C-termini due to insertion of an exon in SAF-2 [23] The SAF-3 mRNA is transcribed from an upstream promoter and contains a totally different N-terminus In addition, a portion of the first exon constituting the N-terminus of SAF-1/SAF-2 mRNA is deleted in SAF-3 mRNA (Figs and 2) In previous studies, this region of SAF-1/SAF-2 was shown to contain a negatively functioning module [26] The SAF-2 isoform activates SAF-1 under inflammatory conditions in a unique fashion [23] Under normal conditions, SAF-2 negatively regulates SAF-1 transactivation, but, as SAF-2 is down-regulated under various inflammatory conditions, the repression of SAF-1 activity is relieved, which permits a further increase in the expression of SAF-1 targets In contrast to SAF-2, SAF-3 is specifically expressed during inflammation SAF-3 thus appears to play a significant role in the pathogenic conditions associated with increased expression of many SAF target genes, due to the combination of inflammation-responsive expression of SAF-3 and the superior transactivation potential of SAF-3 The underlying mechanism for the increased transcriptional function of SAF-3 is presently unknown Increased transcriptional activity of SAF-3 could result from (a) a transactivating module present in the unique N-terminus, (b) binding of the N-terminus by ancillary factors, (c) the lack of a negatively functioning module that is present in the N-terminus of SAF-1 [26], or (d) all of the above It was interesting to note the lack of a consensus TATA box and/or CAAT box in both promoters of the SAF gene In this regard, SAF-1/MAZ/Pur-1 resembles about the third of eukaryotic gene promoters that not contain a consensus TATA box Another notable feature of the two SAF promoters is the presence of a high frequency of CpG dinucleotides, which are also known as CpG islands The CpG Transcription factor SAF-3 is expressed during inflammation islands have been shown to play an important role in epigenic control during mammalian development, and are frequently altered in many disease conditions such as cancer [30–32] In addition, methylation of the cytosines of CpG islands in the promoter or the first exon has been shown to affect the rate of transcription [33], and ever since the clear demonstration of a causal relationship between hypermethylation of the promoter of tumor suppressor genes and the development of cancer, it has been believed that transcription of many genes is repressed via DNA methylation [34] It remains to be investigated whether transcription from the upstream SAF promoter, i.e expression of SAF-3 mRNA, is regulated via DNA methylation In conclusion, we show that the human SAF-1/ MAZ/Pur-1 gene has two promoters, which are utilized to produce multiple mRNAs with unique properties A specific increase in the expression level of SAF-3 transcript transcribed from the upstream promoter may determine the level of SAF protein during inflammation and pathogenic conditions Further analyses of the factors that modulate transcriptional activity of the upstream SAF promoter are necessary to clarify the mechanisms regulating increased expression of SAF-3 during inflammatory conditions Experimental procedures Isolation, cloning and sequencing of the SAF-3 splice variant A kgt-11 cDNA library was prepared using mRNAs isolated from IL-1b-induced human HTB-94 cells The library was screened using an SAF-1 cDNA probe The DNA inserts from the selected clones were sub-cloned in pTZ19U and sequenced One of these cDNA clones contained the SAF-3 sequence The promoter region of SAF-1/SAF-2/ SAF-3 was isolated by screening a human genomic DNA library in kEMBL3 (Clontech Laboratories Inc., Mountain View, CA, USA) with a full-length SAF-1 cDNA probe Three independent positive clones were selected Regions of the phage DNA spanning the human SAF gene were sequenced Cell cultures and transfection Human HTB-94 chondrocyte cells, derived from a primary grade II chondrosarcoma, and human osteosarcoma Saos-2 cells were cultured in Dulbecco’s modified Eagle’s medium containing high glucose, 100 unitsỈmL)1 penicillin and 100 unitsỈmL)1 streptomycin supplemented with 7% fetal calf serum Both cell lines were obtained from the American Type Culture Collection, Manassas, VA, USA) FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4283 Transcription factor SAF-3 is expressed during inflammation Transfection assays were performed as described previously [7] pSV-b galactosidase (Promega Corporation, Madison, WI, USA) plasmid DNA was used as an internal control, and was assayed as described previously [35] Cells were harvested 24 h post-transfection, and CAT activity was assayed as described previously [35] All transfection experiments were performed at least three times Plasmid constructs The SAF3X-CAT2 reporter was constructed by ligating three tandem copies of SAF DNA-binding elements into the pBLCAT2 vector as described previously [23] 1.2VEGF-CAT was constructed by ligating a 1.2 kb promoter DNA fragment of human VEGF gene into the pBLCAT3 vector as described previously [5] Expression plasmids pcDHis-SAF-3 and pcDHis-SAF-1 were constructed by ligating full-length SAF-3 or SAF-1 cDNA into the pCDNA3.1-His vector (Invitrogen, Carlsbad, CA, USA) The ()2000/+200)SAF-CAT, ()2000/)351)SAF-CAT and ()351/+200)SAF-CAT plasmids were prepared by PCR amplification of the respective DNA fragments of the promoter region of human SAF gene followed by ligation into the pBLCAT3 plasmid vector A Ray et al SAF-3-specific forward primer 5¢-CGCGAGCCACCT CCCTCCCTCC-3¢ and reverse primer 5¢-GCTTCAGG GCCGCTGTGTCCAC-3¢ were used, which produced a 345 bp product The reaction products were separated in an agarose gel, and a portion of the first PCR-amplified product (345 bp) was punched out using a Pasteur pipette and resuspended in 200 lL of sterile dH2O; 1.0 lL of this suspension was used as the template for the second PCR The SAF-3 primers for the second PCR primers were 5¢-CCGCCATGGATCCCAGCAACTGGAGCAGC-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTCCAC-3¢ (reverse) The amplification product of the second PCR was 208 bp The reaction products were resolved in a 1.5% agarose gel, and the identity of amplified DNA was verified by DNA sequence analysis The primers for the SAF-1-specific PCR were 5¢-CCATGTTCCCCGTGTTCCCTTGCACG CTG-3¢ (forward) and 5¢-GAGAACCGGGAGCAAGTC CAC-3¢ (reverse), and the amplification product was 271 bp The primers for MMP-9 were 5¢-GGCTCTCCAA GAAGCTTTTCTC-3¢ (forward; present in exon 10) and 5¢-CATAGCTCACGTAGCCCACTTGG-3¢ (reverse; present in exon 13), and the amplification product was 378 bp The primers for GAPDH were 5¢-TGCACCACCAACTG CTTAG-3¢ (forward) and 5¢-AGAGGCAGGGATGATGT TC-3¢ (reverse), and the amplification product was 177 bp Preparation of SAF-1 and SAF-3 proteins For bacterially expressed SAF-1 and SAF-3 proteins, the corresponding cDNAs were subcloned into the pRSET vector (Invitrogen) Proteins expressed from these constructs were purified by nickel–agarose column chromatography (Invitrogen) according to the manufacturer’s protocol Isolation of RNA and RT-PCR Total RNA was isolated from untreated HTB-94 cells and from HTB-94 and Saos-2 cells treated with IL-1b (500 mL)1) and TGF-b (5 ngỈmL)1), respectively, using the guanidinium thiocyanate method [36] Total RNA was isolated from synovial tissue of OA and RA patients as described previously [37] Briefly, arthritic synovial tissue was obtained from patients undergoing total knee joint or hip replacement Synovial tissues were prepared from seven RA knee joints and 14 OA knee joints Informed consent was obtained from the patients according to ethical guidelines RT-PCR was performed using an RT-PCR kit according to the manufacturer’s protocol (Invitrogen) DNase-treated RNA (1 lg) was used in the reverse transcription with random hexamers and oligo(dT)12–18 as the extension primer PCR was performed by denaturing at 94 °C for min, followed by incubation at 94 °C for 15 s and 68 °C for for 40 cycles For detection of SAF-3 mRNA, nested PCR was performed In the first PCR, the 4284 Northern blot analysis A multiple-tissue Northern blot (Clontech Laboratories Inc.) was hybridized using a 32P-labeled oligonucleotide probe that contained the unique region of SAF-3 The sequence of the SAF-3 specific oligonucleotide probe is 5¢-CCAGGGTGAGCGCGAGCCACCTCCCTCCCTCCC TCCGCCATGGATCCCAGCAACTGGAGCAGCTTCAT CTTCCAG-3¢ After stripping off the probe, the same membrane was re-hybridized with a 32P-labeled SAF-1 cDNA probe containing the entire coding region (approximately 1.4 kb) Primer extension analysis For primer extension analysis, 0.5 lg of poly(A)+ RNA from IL-1b-induced HTB-94 cells was hybridized with a 5¢end 32P-labeled, 18-base antisense oligonucleotide primer (5Â-GCTCCAGTTGCTGGGATC-3Â; 106 countsặmin)1) corresponding to positions +4 to +21 with respect to the ATG start codon of the SAF-3 cDNA The probe and RNA were heated at 90 °C for 15 in 80% formamide, 40 mm Pipes pH 6.4, 400 mm NaCl, mm EDTA buffer, and then incubated overnight at 50 °C The annealed mRNA and oligonucleotide was ethanol-precipitated and resuspended in 50 lL of 50 mm Tris/HCl pH 8.3, 50 mm KCl, 10 mm MgCl2, mm dithiothreitol, 0.5 mm spermidine, mm each of the four dNTPs, 1000 mL)1 RNasin FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS A Ray et al (Promega) and 1000 mL)1 AMV reverse transcriptase (Promega), and incubated at 42 °C for 90 The sample was extracted with phenol/chloroform and ethanolprecipitated As a negative control, yeast tRNA was used as the template in a separate extension reaction The products of primer extension reactions were fractionated in a 12% polyacrylamide/urea sequencing gel Transcription factor SAF-3 is expressed during inflammation Acknowledgements This study was supported in part by US Public Health Service grants AR48762 and DK49205 and funds from the College of Veterinary Medicine, University of Missouri References Preparation of SAF-3 and SAF-1 RNA by in vitro transcription To prepare SAF-3 and SAF-1 RNA transcripts, full-length SAF-3 and SAF-1 cDNAs cloned into pTZ19U vector were subjected to in vitro transcription using T7 RNA polymerase and a commercial Riboprobe System T7 kit (Promega) according to the manufacturer’s protocol The products were fractionated in a 1% agarose gel, transferred to nylon membrane and hybridized with radioactive SAF-3-specific oligonucleotide probe In vitro transcription and translation of SAF-3 protein Full-length SAF-3 cDNA cloned into pTZ19U vector was subjected to in vitro transcription and translation using a TNT T7 coupled reticulocyte lysate system kit (Promega) according tot the manufacturer’s protocol In vitro transcription of SAF-3 mRNA was performed by using T7 RNA polymerase, and transcribed SAF-3 mRNA was further in vitro translated and 35S-labeled The control reaction contained no plasmid DNA The reaction products were fractionated by 11% SDS–PAGE and visualized by autoradiography Western blot analysis pcDNA3-His, pcDSAF-1 and pCDSAF-3 plasmid-transfected cells were lysed in 50 mm Tris/HCl pH 7.5, 100 mm NaCl, 0.5 mm dithiothreitol, 1% Nonidet P-40, 0.1% SDS, mm phenylmethanesulfonyl fluoride and 0.5 mgỈmL)1 of benzamidine buffer, followed by mild sonication The extracts (50 lg protein) were fractionated by 11% SDS– PAGE and transferred to a nitrocellulose membrane To evaluate the relative amount of proteins in each lane, proteins were stained with Ponceau S solution (Sigma-Aldrich, St Louis, MO, USA) Immunoblotting was performed using a : 5000 dilution of anti-His tag IgG (Millipore Corporation, Billerica, MA, USA) Bands were detected using a chemiluminescence detection kit (Amersham Biosciences, Piscataway, NJ, USA) In some Western blots, anti-SAF-3 serum was used to detect the SAF-3 protein level in IL-1binduced or uninduced cells SAF-3 antibody was prepared against the N-terminal epitope (MDPSNWSSFIFQ peptide) that is absent in the SAF-1 and SAF-2 isoforms Ray A & Ray BK (1998) Isolation and functional characterization of cDNA of serum amyloid A-activating factor that binds to the serum amyloid A promoter Mol Cell Biol 18, 7327–7335 Bossone SA, Asselin C, Patel AJ & Marcu KB (1992) MAZ, a zinc finger protein, binds to c-MYC and C2 gene sequences regulating transcriptional initiation and termination Proc Natl Acad Sci U S A 89, 7452–7456 Kennedy GC & Rutter WJ (1992) Pur-1, a zinc-finger protein that binds to purine-rich sequences, transactivates an insulin promoter in heterologous cells Proc Natl Acad Sci U S A 89, 11498–11502 Ray A & Ray BK (1996) A novel cis-acting element is essential for cytokine-mediated transcriptional induction of the serum amyloid A gene in nonhepatic cells Mol Cell Biol 16, 1584–1594 Ray BK, Shakya A & Ray A (2007) Vascular endothelial growth factor expression in arthritic joint is regulated by SAF-1 transcription factor J Immunol 178, 1774–1782 Ray A, Shakya A, Kumar D & Ray BK (2004) Overexpression of serum amyloid A activating factor inhibits cell proliferation by the induction of cyclin-dependent protein kinase inhibitor p21WAF-1/Cip-1/Sdi-1 expression J Immunol 172, 5006–5015 Ray A, Kuroki K, Cook JL, Bal BS, Kenter K, Aust G & Ray BK (2003) Induction of matrix metalloproteinase gene expression is regulated by inflammation-responsive transcription factor SAF-1 in osteoarthritis Arthritis Rheum 48, 134–145 Ray BK, Shakya A, Turk JR, Apte SS & Ray A (2004) Induction of the MMP-14 gene in macrophages of the atherosclerotic plaque: role of SAF-1 in the induction process Circ Res 95, 1082–1090 Ray A, Shakya A & Ray BK (2005) Inflammationresponsive transcription factors SAF-1 and c-Jun/c-Fos promote canine MMP-1 gene expression Biochim Biophys Acta 1732, 53–61 10 Ray A, Bal BS & Ray BK (2005) Transcriptional induction of matrix metalloproteinase-9 in the chondrocyte and synoviocyte cells is regulated via a novel mechanism: evidence for functional cooperation between serum amyloid A-activating factor-1 and AP-1 J Immunol 175, 4039–4048 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS 4285 Transcription factor SAF-3 is expressed during inflammation 11 Parks CL & Shenk T (1996) The serotonin 1a receptor gene contains a TATA-less promoter that responds to MAZ and Sp1 J Biol Chem 271, 4417–4430 12 Ray A, Schatten H & Ray BK (1999) Activation of Sp1 and its functional co-operation with serum amyloid A-activating sequence binding factor in synoviocyte cells trigger synergistic action of interleukin-1 and interleukin-6 in serum amyloid A gene expression J Biol Chem 274, 4300–4308 13 Ray A, Fields AP & Ray BK (2000) Activation of transcription factor SAF involves its phosphorylation by protein kinase C J Biol Chem 275, 39727–39733 14 Ray BK & Ray A (1997) Involvement of an SAF-like transcription factor in the activation of serum amyloid A gene in monocyte/macrophage cells by lipopolysaccharide Biochemistry 36, 4662–4668 15 Ray BK, Chatterjee S & Ray A (1999) Mechanism of minimally modified LDL-mediated induction of serum amyloid A gene in monocyte/macrophage cells DNA Cell Biol 18, 65–73 16 Ray A, Yu GY & Ray BK (2002) Cytokine-responsive induction of SAF-1 activity is mediated by a mitogenactivated protein kinase signaling pathway Mol Cell Biol 22, 1027–1035 17 Ray A, Ray P, Guthrie N, Shakya A, Kumar D & Ray BK (2003) Protein kinase A signaling pathway regulates transcriptional activity of SAF-1 by unmasking its DNA-binding domains J Biol Chem 278, 22586–22595 18 Kovacevic A, Hammer A, Stadelmeyer E, Windischhofer W, Sundl M, Ray A, Schweighofer N, Friedl G, Windhager R, Sattler W et al (2008) Expression of serum amyloid A transcripts in human bone tissues, differentiated osteoblast-like stem cells and human osteosarcoma cell lines J Cell Biochem 103, 994–1004 19 Dudas J, Mansuroglu T, Moriconi F, Haller F, Wilting J, Lorf T, Fuzesi L & Ramadori G (2008) Altered regulation of Prox1 gene-expression in liver tumors BMC Cancer 8, 92–106 20 Daheron L, Salmeron S, Patri S, Brizard A, Guilhot F, Chomel JC & Kitzis A (1998) Identification of several genes differentially expressed during progression of chronic myelogenous leukemia Leukemia 12, 326–332 21 Greiner J, Ringhoffer M, Simikopinko O, Szmaragowska A, Huebsch S, Maurer U, Bergmann L & Schmitt M (2000) Simultaneous expression of different immunogenic antigens in acute myeloid leukemia Exp Hematol 28, 1413–1422 22 Himeda CL, Ranish JA & Hauschka SD (2008) Quantitative proteomic identification of MAZ as a transcriptional regulator of muscle-specific genes in skeletal and cardiac myocytes Mol Cell Biol 28, 6521–6535 4286 A Ray et al 23 Ray B K, Murphy R, Ray P & Ray A (2002) SAF-2, a splice variant of SAF-1, acts as a negative regulator of transcription J Biol Chem 277, 46822–46830 24 Song J, Murakami H, Tsutsui H, Tang X, Matsumura M, Itakura K, Kanazawa I, Sun K & Yokoyama KK (1998) Genomic organization and expression of a human gene for Myc-associated zinc finger protein (MAZ) J Biol Chem 273, 20603–20614 25 Kozak M (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes Cell 44, 283–292 26 Ray A, Kumar D, Ray P & Ray BK (2004) Transcriptional activity of SAF-1 is regulated by distinct functional modules J Biol Chem 279, 54637–54646 27 Hanke J, Brett D, Zastrow I, Aydin A, Delbruck S, Lehmann G, Luft F, Reich J & Bork P (1999) Alternative splicing of human genes: more the rule than the exception? Trends Genet 15, 389–390 28 Graveley BR (2001) Alternative splicing: increasing diversity in the proteomic world Trends Genet 17, 100–107 29 Caceres JF & Kornblihtt AR (2002) Alternative splicing: multiple control mechanisms and involvement in human disease Trends Genet 18, 186–193 30 Nan X, Ng HH, Johnson CA, Laherty CD, Turner BM, Eisenman RN & Bird A (1998) Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex Nature 393, 386–389 31 Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J & Wolffe AP (1998) Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription Nat Genet 19, 187–191 32 Bird A (2002) DNA methylation patterns and epigenetic memory Genes Dev 16, 6–21 33 Miranda TB & Jones PA (2007) DNA methylation: the nuts and bolts of repression J Cell Physiol 213, 384–390 34 Baylin SB (2002) Mechanisms underlying epigenetically mediated gene silencing in cancer Semin Cancer Biol 12, 331–337 35 Sambrook J & Russell DW (2001) Molecular Cloning: A Laboratory Manual, 3rd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 36 Chomczynski P & Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction Anal Biochem 162, 156–159 37 Imai K, Morikawa M, D’Armiento J, Matsumoto H, Komiya K & Okada Y (2006) Differential expression of WNTs and FRPs in the synovium of rheumatoid arthritis and osteoarthritis Biochem Biophys Res Commun 345, 1615–1620 FEBS Journal 276 (2009) 4276–4286 ª 2009 The Authors Journal compilation ª 2009 FEBS ... 5¢ splice donor (nt) 3¢ splice acceptor 1A 75 ATCTTCCAGgtaacaac 625 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag... Journal compilation ª 2009 FEBS 4277 Transcription factor SAF-3 is expressed during inflammation A Ray et al Fig Analysis of a structurally altered form of SAF The nucleic acid and predicted amino... Osteoarthritis (OA) is a chronic inflammatory disease that involves degeneration of the cartilage tissue, while rheumatoid arthritis (RA) is a systematic chronic inflammatory and destructive arthropathy