Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork Yoshihiro Kanai, Gen Ishikawa, Ryo Takeuchi, Tatsushi Ruike, Ryo-ichi Nakamura, Ayumi Ihara, Tetsuyuki Ohashi, Kei-ichi Takata, Seisuke Kimura and Kengo Sakaguchi Department of Applied Biological Science, Tokyo University of Science, Chiba, Japan Keywords active-site mutant; DmGEN; novel flap endonuclease; nuclease activity; sitedirected mutagenesis Correspondence K Sakaguchi, Department of Applied Biological Science, Faculty of Science and Technology, Tokyo University of Science, 2641 Yamazaki, Noda-shi, Chiba-ken 278-8510, Japan Fax: +81 7123 9767 Tel +81 7124 1501 (Ex 3409) E-mail: kengo@rs.noda.tus.ac.jp (Received April 2007, revised 24 May 2007, accepted June 2007) doi:10.1111/j.1742-4658.2007.05924.x Drosophila melanogaster XPG-like endonuclease (DmGEN) is a new category of nuclease belonging to the RAD2 ⁄ XPG family The DmGEN protein has two nuclease domains (N and I domains) similar to XPG ⁄ class I nucleases; however, unlike class I nucleases, in DmGEN these two nuclease domains are positioned close to each other as in FEN-1 ⁄ class II and EXO-1 ⁄ class III nucleases To confirm the properties of DmGEN, we characterized the active-site mutant protein (E143A E145A) and found that DmGEN had flap endonuclease activity DmGEN possessed weak nick-dependent 5¢)3¢ exonuclease activity Unlike XPG, DmGEN could not incise the bubble structure Interestingly, based on characterization of flap endonuclease activity, DmGEN preferred the blocked-flap structure as a substrate This feature is distinctly different from FEN-1 Furthermore, DmGEN cleaved the lagging strand of the model replication fork Immunostaining revealed that DmGEN was present in the nucleus of actively proliferating Drosophila embryos Thus, our studies revealed that DmGEN belongs to a new class (class IV) of the RAD2 ⁄ XPG nuclease family The biochemical properties of DmGEN and its possible role are also discussed DNA replication, recombination and repair are key processes in maintaining genome integrity Nucleases are necessary for their nucleolytic activities They act on a variety of structural frameworks, ranging from sitespecific (e.g AP endonuclease) to structure-specific (e.g RAD2 ⁄ XPG nuclease family) and nonspecific (e.g DNase I) nucleases In particular, members of the RAD2 ⁄ XPG nuclease family have unique nuclease activities and play critical roles in genome stability [1–6] In a preliminary report, we described the presence of a new nuclease, Drosophila melanogaster XPG-like endonuclease (DmGEN) which belongs to the RAD2 ⁄ XPG nuclease family, shows unique activity and possibly plays a critical role in genome stability [7] The ORF of the DmGEN gene encoded a predicted protein of 726 amino acid residues with a molecular mass of 82.5 kDa The gene was located at 64C9 on the left arm of Drosophila polytene chromosome as a single site The RAD2 ⁄ XPG family of nucleases, which have two conserved nuclease domains (the N domain and the I domain), are currently separated into three classes (XPG ⁄ class I, FEN-1 ⁄ class II and EXO-1 ⁄ class III) based on the types of nuclease activity and sequence homology [8,9] In Drosophila, mus201 protein (class I), FEN-1 homologue protein (class II), and Tosca protein (class III) have been reported as RAD2 family proteins The DmGEN protein showed a relatively high degree of sequence homology with RAD2 nucleases, particularly XPG, although the locations of the N and I domains were similar to those of FEN-1 and EXO-1, and the molecular mass of DmGEN was found to be close to that of EXO-1 Therefore, we proposed a new class (class IV) to categorize DmGEN and SEND-1, which we also found in higher plants [8] Recently, a new member of the class IV nucleases, OsGEN-like, has been reported in rice; RNA-mediated Abbreviations BF, blocked flap; DmGEN, Drosophila melanogaster XPG-like endonuclease; dsDNS, double stranded DNA; RF, replication fork; ssDNA, single-stranded DNA 3914 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al silencing of the OsGEN-like caused male sterility due to a defect in microspore development [9] Although DmGEN homologues are found widely in mammals and higher plants [7,9], knowledge about their biochemical properties is limited In this study, we determined the biochemical properties of native and an active-site mutant DmGEN to more deeply understand the nature of this new class of nucleases As for the biochemical features, class I consists of XPG homologues, which cleave at the 3¢ side of the bubble structure formed during nucleotide excision repair [10,11] Class II comprises the FEN-1 homologues, which show 5¢-flap endonuclease, 5¢)3¢ exonuclease and gap endonuclease activities, and play important roles in RNA primer removal, base excision repair and apoptotic DNA fragmentation [12–14] Class III is made up of the EXO-1 homologues, which have 5¢)3¢ exonuclease activity and are involved in DNA recombination, mismatch repair and DNA replication [15–18] The function for class IV, however, remains unclear In relation to the studies, we must correct some mistakes in our previous study We reported previously that DmGEN has not only 3¢)5¢- and nick- and gap-dependent 5¢-3¢ exonuclease activities, but also endonuclease activity at a site or bp from the 5¢-end [7] However, such activities were not found when DmGEN was purified more carefully, although nickdependent 5¢-3¢ exonuclease activity was present Thus, it is important to re-characterize this novel enzyme Here, we report that the DmGEN protein is a new flap endonuclease, which is different in nature from FEN-1 Based on our studies we have confirmed that DmGEN belongs to a new class of the RAD2 ⁄ XPG family In addition, we have characterized the biochemical properties of DmGEN Results Design of substrates All DNA substrates were designed as shown in Fig 1, and were assembled using the oligonucleotides described in Table Comparison of the nuclease domain of the RAD2/XPG family The RAD2 ⁄ XPG family of proteins have two conserved nuclease domains (N and I domains), and these are essential for nuclease activity and substrate specificity DmGEN also has these conserved nuclease domains The N and I domains of DmGEN were similar to those of XPG ⁄ class I (Fig 2A,B) The Flap endonuclease activity in DmGEN Fig The three categories of DNA substrates used in this study Names shown (A, B, C, A-Flap, etc.) correspond to the oligonucleotides summarized in Table N domain of DmGEN showed 35.1, 25.0 and 10.9% homology (% identity) with the N domains of HsXPG, HsFEN-1 and HsEXO-1, respectively The I domain of DmGEN showed 44.2, 38.5 and 38.5% homology (% identity) with the I domains of HsXPG, HsFEN-1 and HsEXO-1, respectively The spacer region between the N and I domains is not required for nuclease activity, but contributes to substrate specificity [19] The spacer region of DmGEN is very short, similar to that of FEN-1 ⁄ class II and EXO-1 ⁄ class III, but not XPG ⁄ class I (Fig 2A) Therefore, DmGEN cannot be categorized into class I, II, or III Like other members of the RAD2 ⁄ XPG family, DmGEN also contains several acidic residues coordinating two Mg2+ at the active center for catalysis; one of these, which is an aspartic acid residue in other members of the RAD2 ⁄ XPG family, is a glutamic acid residue in DmGEN (Fig 2B, asterisk 1) In addition to the nuclease domains, the X-ray crystal structures FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3915 Flap endonuclease activity in DmGEN Y Kanai et al Table Oligonucleotides used to construct various DNA substrates shown in Fig Oligo name A B C A-flap B-flap B-g1 B-g2 B-g4 A-b15 A-b17 A-b19 D E F G X1 X2 X3 X4 X1half X1half-g4 X1half-g8 X4half Sequences (5¢- to 3¢) GGCTGCAGGTCGAC CAGCAACGCAAGCTTG GTCGACCTGCAGCCCAAGCTTGCGTTGCTG ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA CAGCAACGCAAGCTT CAGCAACGCAAGCT CAGCAACGCAAG AGAGATTTTCCACAT CTAGAGATTTTCCACAT TGCTAGAGATTTTCCACAT TGACAAGGATGGCTGGTGGGACTTAGCGTA TACGCTAAGTCCCACCAGCCATCCTTGTCA CCAGTGATCACATACGCTTTGCTAGGACATT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAG TGCCACGTTGTATGCCCACGTTGACCG CGGTCAACGTGGGCATACAACGTGGCACTGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC GGACATCTTTGCCCACGTTGACCCG ATCTTTGCCCACGTTGACCCG TTGCCCACGTTGACCCG GCGATAGTCTCTAGACAGCATGTCC of the archaeal FEN-1 homologues have assisted in the identification of critical structural elements (helical clamp, H3TH motif and several loop regions) for substrate binding [14] Recently, Qui et al [20] identified 18 positively charged amino acids that are important in the FEN)1–DNA interaction DmGEN contains a number of positively charged residues; however, most of the positively charged amino acid residues forming the DNA-biding domain of HsFEN-1 are not conserved in DmGEN (Fig 2C, Table 2) Expression, purification and characterization of DmGEN DmGEN was expressed in Escherichia coli, tagged with six His residues at the N-terminus DmGEN expression in E coli was increased dramatically over 3916 the previously reported amount [7] by using the pCold I expression vector carrying the cold-shock promoter and inducing overexpression of DmGEN at 15 °C The recombinant protein was sequentially purified by chromatography using a Ni-NTA resin column, SP Sepharose beads, and then fractionated on a Superdex-200 gel-filtration column In the gel-filtration column, the protein (expected molecular mass  82.5 kDa) migrated between the expected molecular mass markers 75 and 100 kDa (Fig 3A) Gel-filtration chromatography was crucial to completely purify the protein Next, to characterize DmGEN nuclease activity more precisely, we constructed an active-site double mutant (E143A E145A) of DmGEN as described in Experimental procedures As shown in Fig 2B, these active-site residues (asterisks and in Fig 2B) are highly conserved in the I domain of the RAD2 ⁄ XPG family, and are important in coordinating divalent metal ions to interact with an incoming nucleotide [21] We previously reported that DmGEN has both 5¢)3¢ and 3¢)5¢ exonuclease activity and endonuclease activity at a site or bp from the 5¢-end in doublestranded DNA (dsDNA) [7] The mutants were used to confirm these activities We analyzed the nuclease activities of wild-type and E143A E145A double-mutant DmGEN Wild-type DmGEN did not show any detectable 3¢)5¢ exonuclease and endonuclease activities towards either singlestranded DNA (ssDNA) or dsDNA (Fig 3D) These results differed from our previous report [7] The previously reported nuclease activities of DmGEN [7] may have resulted from other contaminating nucleases Indeed, when we checked other fractions from the gelfiltration column, we found these activities in a fraction obtained from the shoulder area of the elution profile In our previous study, we were not able to use gel-filtration for purification because of the low yield of DmGEN Subsequently, on further careful characterization, we found that purified wild-type DmGEN shows flap endonuclease activity, and the E143A E145A double mutant lacks such activity (Fig 3B) Thus, DmGEN cleaves the flap structure substrate at the junction between the ssDNA and dsDNA, and subsequently generates a product of 20 nucleotides This activity of DmGEN was confirmed using 3¢-end-labeled flap substrate (Fig 3C) As shown, the 3¢-end-labeled 30-nucleotide flap substrate was cleaved by wild-type DmGEN, but not by mutant DmGEN Neither wildtype nor mutant DmGEN cleaved a 30-nucleotide ssDNA substrate or blunt-ended dsDNA substrate (Fig 3D) FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al Flap endonuclease activity in DmGEN A B C Fig Comparison of the amino acid sequences of the RAD2 ⁄ XPG family (A) Schematic representation of the conserved N and I domains of some members of the RAD2 ⁄ XPG family The total number of amino acids in each protein and homology (% identity) between DmGEN and other members are indicated (B) The conserved sequences encompassing the nuclease active site are aligned Asterisk indicates the nonconserved aspartic residue of DmGEN Asterisks and indicate the active residues of DmGEN substituted by site-directed mutagenesis (C) Comparison of positively charged amino acid residues essential for the FEN)1–DNA interaction with those of DmGEN In total, 18 amino acid residues are compared in gray boxes FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3917 Flap endonuclease activity in DmGEN Y Kanai et al Table Conservation of essential positively charged amino acid residue HsFEN-1 DmGEN Conserved Functional motif Binding site R47 D43 N Upstream R70 R58 Y K93 R104 K125 K128 K129 K132 R192 K81 Q92 K114 S117 R118 H121 R177 Y N Y N N N Y K200 A190 N K201 G191 N K244 R245 K252 K254 K267 D235 G236 K243 K245 G258 N N Y Y N R327 E317 N K326 L318 N Substrate-binding loops Substrate-binding loops Helical clamp Helical clamp Helical clamp Helical clamp Helical clamp Helical clamp Substrate-binding loops Substrate-binding loops Substrate-binding loops H3TH motif H3TH motif H3TH motif H3TH motif Substrate-binding loops Substrate-binding loops Substrate-binding loops Upstream 5¢ flap 5¢ flap 5¢ flap 5¢ flap 5¢ flap 5¢ flap Upstream Upstream Upstream Downstream Downstream Downstream Downstream Downstream Upstream Upstream Biochemical properties of DmGEN To characterize the difference between the flap endonuclease activity of DmGEN and that of FEN-1 (class II), optimal reaction conditions for DmGEN were first determined using the flap structure substrate (Fig 5) (Details of the reaction conditions are given in the legend to Fig 5.) The optimal pH for DmGEN flap activity was 8, which was same as for FEN-1 (class II) DmGEN required divalent metal ions (such as Mg2+ and Mn2+), and the concentration of Mg2+ or Mn2+ ions required for optimal flap activity was mm However, the cleavage product of DmGEN in the presence of mm Mn2+ was only 43.3% that in the presence of mm Mg2+ Ca2+ and Zn2+ could not substitute for Mg2+ or Mn2+ DmGEN nuclease activity was highest in reaction mixtures containing 25 mm KCl, and further increasing the concentration of KCl inhibited the activity These biochemical properties of DmGEN differed from data reported previously [7] The requirement for divalent metal ions and low ionic strength for DmGEN optimal activity were like those of EXO-1 (class III) The above-described biochemical properties of DmGEN differed from those of other members (class I, II, and III) of the RAD2 ⁄ XPG family Effect of DmGEN on the various flap structures Ability of DmGEN to cleave other structures To analyze the substrate specificity of DmGEN, we examined various test substrates, which were expected to be cleaved by the nuclease These are shown schematically in Fig First, we tested whether DmGEN possesses nick- or gap-dependent 5¢)3¢ exonuclease activity, and produced gapped and nicked double-stranded substrates as reported previously [7] As shown in Fig 4A, DmGEN exhibited weak nick-dependent 5¢)3¢ exonuclease activity, but showed little or no gap-dependent 5¢)3¢ exonuclease activity We confirmed that DmGEN cut only one nucleotide from the 3¢-end-labeled nicked substrate (Fig 4B) Because we had to use a large amount of DmGEN to cleave the nicked substrate, the cleaving rate of the nick-dependent 5¢)3¢ exonuclease activity of DmGEN is obviously lower than the flap endonuclease activity Next, we tested whether DmGEN would cleave the bubble-like and the Holliday junction substrates, which are known to exist in vivo Although XPG (class I nuclease) incised the target strand 3¢ to the bubble-like and damage-containing structures [10], DmGEN was unable to cleave the bubble-like structure substrate (Fig 4C, left) Nor was the Holliday junction substrate cleaved by DmGEN (Fig 4C, right) 3918 To determine the flap nuclease activity of DmGEN, we tested the action of DmGEN on several derivatives of the flap structure substrates We prepared pseudo Y, gapped-flap, blocked-flap, double-flap and 3¢-flap substrates, as shown in Fig In agreement with previous studies [14,22], FEN-1 cleaved the flap, pseudo Y, gapped-flap, blocked-flap and double-flap structure substrates (Fig 6) Previously, it was reported that the blocked-flap substrate was hardly cleaved by the flap endonuclease activity of FEN-1 [23] However, according to a recent report, the blocked-flap was cleaved by the gap endonuclease activity of FEN-1 [14] Unlike FEN-1, DmGEN did not cleave the pseudo Y, gapped-flap and 3¢-flap, but did cleave the blocked-flap and double-flap structures In contrast to FEN-1, DmGEN preferred the blocked-flap structure substrate (Fig 6) DmGEN cleaves blocked-flap structures and model replication fork substrates To characterize DmGEN nuclease activity on the blocked-flap structure, we prepared blocked-flap structure substrates with various sizes of oligonucleotides FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al Flap endonuclease activity in DmGEN A Fig Flap endnuclease activity of purified wild-type and mutant recombinant DmGEN (labeled as GEN) (A) Silver-stained gel showing the molecular mass markers and 290 ng of purified DmGEN and DmGEN (E143A E145A) Proteins were separated by electrophoresis on a 10% SDS-polyacrylamide gel (B) Flap endonuclease activity at different concentrations of DmGEN 5¢-Endlabeled flap structure substrate (25 nM) was incubated with different amounts of DmGEN (24, 48, 96 and 192 nM) or DmGEN E143A E145A double mutant (24, 48, 96 and 192 nM) at 37 °C for 90 in a 20 lL reaction volume (C) 3¢-End-labeled flap structure substrate (25 nM) was incubated with DmGEN (24 and 48 nM) or DmGEN E143A E145A double mutant (96 nM) at 37 °C for 90 in a 20 lL reaction volume (D) ssDNA and dsDNA substrate (25 nM) was incubated with DmGEN (192 nM) or DmGEN E143A E145A double mutant (192 nM) at 37 °C for 60 in a 20 lL reaction volume Asterisk indicates the position of the radiolabel Substrate and cleavage product sizes were as indicated Electrophoresis was carried out on 10% polyacrylamide ⁄ M urea gels The amounts of nuclease products were calculated with the aid of an image analyzer (IMAGE J 1.36b, National Institutes of Health) B C D bound to the 5¢-tail of the single-stranded flap The sizes of the blocking oligonucleotides in the blockedflap (BF) substrates – BF1, BF2 and BF3 – were 15, 17 and 19 bp, respectively (Fig 7A) The single-stranded region of the BF structure was 19 bp, and the gap sizes of the blocked strand of BF1, BF2 and BF3 were 4, and nucleotides, respectively In agreement with a previous study [24], the cleavage efficiency of HsFEN-1 decreased with the narrower gapped substrate (Fig 7A) FEN-1 cleaved the blocked-flap substrate at much slower rate than the free flap structure substrate However, DmGEN cleaved both BF1 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3919 Flap endonuclease activity in DmGEN A Y Kanai et al C Fig (A) Nuclease activity of DmGEN protein (192 nM) on the 5¢-end-labeled nicked and gapped substrates (25 nM) The reaction condition is described in Experimental procedures Time-course experiments were performed Substrates are depicted schematically in each panel The asterisk indicates the position of the radiolabel Substrate and cleavage product sizes were as indicated (B) Nuclease activity of DmGEN protein (192 nM) on the 3¢-end-labeled nicked substrates (25 nM) Time-course experiments were performed (C) Nuclease activity of DmGEN (192 nM) on bubble and Holliday junction structure substrates (5 and 25 nM, respectively) Incubation was carried out at 37 °C for 60 in a 20 lL reaction volume Substrates are depicted schematically in each panel Asterisk indicates the position of the radiolabel Substrate sizes were as indicated (A,B) Electrophoresis carried out on 20% polyacrylamide ⁄ M urea gels (C) Electrophoresis carried out on 10% polyacrylamide ⁄ M urea gels wt: DmGEN wild-type; mut: DmGEN E143A E145A double mutant B and BF2 to a similar extent as the nonblocked flap substrate (Fig 7B) There was also some cleavage of BF3, the blocked-flap substrate without gap (Fig 7B) Because the free 5¢ ssDNA end of the flap is important for FEN-1 cleavage efficiency [14,23,24], we also examined flap endonuclease activity on the hairpinned-flap structure with no free 5¢-end We prepared the hairpinned-flap structure substrates with the same sequence as the blocked-flap substrate (Table S1) In agreement with a previous study [24], the cleavage efficiency of HsFEN-1 on the hairpinned-flap substrates decreased considerably with the narrower gapped substrate (Fig S1A) However, DmGEN cleaved hairpinnedflap, although the activity was weaker than on the free flap substrate (Fig S1B) Because DmGEN cleaved the blocked-flap structure, we examined whether DmGEN cleaves model replication fork (RF) substrates Model replication fork substrates, in which the junction branch migrates, were made as shown in Fig 7C We prepared four derivatives (RF1–RF4) of the model replication fork RF1 resembles the replication fork that lacks the progressing lagging strand RF2, RF3 and RF4 are the forms of the normal replication fork differing in the gap sizes of the lagging strand The gaps in the RF2, RF3 and RF4 are 8, and bp, respectively As 3920 shown in Fig 7C, DmGEN cleaved the lagging strand of the model normal replication forks with gaps (RF2 and RF3) to the similar extent as the RF1 However, DmGEN poorly cleaved RF4, the substrate without any gap both at the lagging strand and the leading strand (Fig 7C) Localization of DmGEN in Drosophila embryos To confirm the relationship between DmGEN and DNA replication in vivo, immunostaining of Drosophila embryos was performed In Drosophila, the embryonic stages were separated into 17 steps [25] The first 13 nuclear divisions occurred in stage 1–4 embryos (0:00–2:10 h embryos) The first seven rounds take place within the interior of the embryo, the majority of nuclei then migrate to the cortex during cycles and 9, leaving behind a small number of yolk nuclei [26] Polyclonal anti-DmGEN serum used for the immunocytochemical study reacted specifically with the DmGEN protein (expected molecular mass 82.5 kDa) in a crude extract of 0–3 h Drosophila embryos (Fig 8, left) As a result of immunostaining, DmGEN was localized in the nucleus throughout the 13 nuclear division cycles The nuclear localization of DmGEN was seen in the interior of the embryo at the FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al Flap endonuclease activity in DmGEN Fig Biochemical properties of the DmGEN protein Purified DmGEN (39 nM) was incubated with 5¢-end-labeled flap structure substrate (25 nM) at 37 °C for 90 in a 20 lL reaction volume To test the effect of divalent metal ions, the reaction was carried out in mM dithiothreitol, 10% glycerol, 50 mM Tris (pH 8) supplemented with 50 mM KCl and various concentrations of a given divalent metal ion, as indicated in the figure To test the effect of salt, the reaction was carried out in mM MgCl2, mM dithiothreitol, 10% glycerol and 50 mM Tris (pH 8) and a given concentration of KCl, as indicated in the figure To test the effect of pH, the reaction was carried out in mM MgCl2, mM dithiothreitol, 50 mM KCl, 10% glycerol and 50 mM Tris (pH 6.5–9.5) Following the reaction, products were resolved on 20% polyacrylamide ⁄ M urea gels and quantified using the IMAGE J 1.36b image analyzer stage (Fig 8A–C, right) However, nuclear localization of DmGEN was observed in a wide range of embryo at the stage (Fig 8D–F, right) Discussion The purpose of this study was to precisely characterize a newly found member (class IV) of the RAD2 ⁄ XPG family of nucleases, DmGEN, from Drosophila melano- gaster The biochemical properties of class IV nucleases are largely unknown in various animals and plants For this purpose, we created an active-site mutant, and used this mutant to confirm the biochemical properties of DmGEN We purified wild-type and mutant DmGEN protein using an improved purification protocol, and analyzed the nuclease activities of the purified proteins Thus, we showed that DmGEN was a new type of flap endonuclease FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3921 Flap endonuclease activity in DmGEN Y Kanai et al Fig Nuclease activities of DmGEN (51 nM) and HsFEN-1 (4.7 nM) on various flap structure substrates (5 nM) Incubation was carried out at 37 °C for 60 for DmGEN and 15 for HsFEN1 in a 20 lL reaction volume Electrophoresis was carried out on a 20% polyacrylamide ⁄ M urea gel Substrates are depicted schematically in each panel Asterisk indicates the position of the radiolabel Substrate and cleavage product sizes were as indicated Amounts of nuclease products were calculated with the aid of the IMAGE J 1.36b image analyzer wt: DmGEN wild-type; mut: DmGEN E143A E145A double mutant; hFEN-1: HsFEN-1 wild-type The amino acid sequence of DmGEN protein has three principal features (Fig 2) First, one of the acidic residues at the active center for catalysis was not conserved in DmGEN (Fig 2B, asterisk 1) Regarding this nonconserved aspartic acid residue, Constantinou et al [27] reported that the D77E active-site mutant of XPG protein showed considerably lower nuclease activity than wild-type XPG protein Second, most of the positively charged amino acids residues, which are essential for binding FEN-1 to DNA [14,20], were not conserved in DmGEN protein (Fig 2C, Table 2) These two features contribute to the low nuclease activity of DmGEN Lastly, DmGEN shows high homology between the N and I regions and XPG (class I), but the spacing of these regions is similar to in FEN-1 and EXO-1 (class I and III, respectively) We confirmed how this feature contributes the nuclease activity of DmGEN (class IV) DmGEN had a flap endonuclease activity, like FEN-1, but was not able to cleave the bubble structure, unlike XPG (Figs 3, 4) Because DmGEN had no 5¢)3¢ exonuclease activity on the dsDNA substrate (Fig 3D), DmGEN is distinctly different from EXO-1 (class III) Recently, it was suggested that the activity of the RAD2 ⁄ XPG nuclease family is determined by the properties and positions of the two nuclease domains [19,28] The adjacent position of the two domains may be responsible for not cleaving the bubble structure (Fig 4C), because a 3922 XPG mutant with a deletion in the spacer region was shown to prefer the pseudo Y structure to the bubble structure [19] The flap endonuclease activity of DmGEN is more accurate and weaker than that of FEN-1 (class II nuclease) For example, FEN-1 cleaves many DNA structures such as 5¢-single-strand overhang including flap, pseudo Y, gapped-flap and 5¢-overhang double-strand [14] In contrast, as shown Fig 6, DmGEN cleaves the normal flap substrate and a special flap structure: the blocked-flap substrate in which the 5¢-single-strand overhang of the flap is double-stranded; DmGEN cleaves just at the ssDNA ⁄ dsDNA junction point We found very little cleavage of gapped-flap and pseudo Y substrates by DmGEN Therefore, the DNA structure at the junction seems to be important for DmGENmediated cleavage Unlike pseudo Y and gapped-flap, DmGEN preferred a substrate in which the 5¢-upstream of the flap is completely double-stranded This idea is supported by the fact that DmGEN cleaved the double-flap substrate (Fig 6) The interesting feature of DmGEN is that this nuclease cleaves the blocked-flap structure, and this activity is slightly stronger than the normal flap structure cleaving activity, a feature that is distinctly different from that of FEN-1 In agreement with the previous report [24], we also found that the activity of FEN-1 decreases considerably when the flap substrate is double-stranded (Fig 7A) On the hairpinned-flap substrates having no free 5¢-end, the nuclease activity of both FEN-1 and DmGEN are weaker than that on the normal flap substrate (Fig S1) Because FEN-1 prefers a free 5¢ ssDNA end of flap [14,23,24], the nuclease activity on the hairpinned-flap substrate is weak, like for the blocked-flap substrate [24] Therefore, in contrast to FEN-1, DmGEN prefers a free 5¢-end of flap, which is either single- or double-stranded, this is deduced from the fact that DmGEN preferred the blocked-flap structure, but not the hairpinned-flap structure These results suggest that binding of the substrate to DmGEN might differ from that of FEN-1 This is also suggested by the fact that most of the positively charged amino acids residues, which are essential for binding of FEN-1 to DNA [14], were not conserved in the DmGEN protein (Fig 2C) The most interesting activity of DmGEN is that it cleaves the blocked-flap structure and the hairpinnedflap structure substrate (Fig 7B, Fig S1) The blocked-flap structure can be regarded as a model for the normal replication fork Interestingly, DmGEN cleaved the lagging strand of the model replication fork with gaps (Fig 7C) Furthermore, DmGEN was localized in the nucleus of Drosophila FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al Flap endonuclease activity in DmGEN A B C Fig (A) Nuclease activity of HsFEN-1 (4.7 nM) on the flap structure substrate and blocked-flap structure substrates (5 nM) The reaction condition is described in Experimental procedures Time-course experiments were performed Substrates are depicted schematically in each panel Asterisk indicates the position of the radiolabel Substrate and cleavage product sizes were as indicated Electrophoresis was carried out on a 20% polyacrylamide ⁄ M urea gel hFEN-1: HsFEN-1 (B) Nuclease activity of DmGEN (48 nM) on the flap structure substrate and blocked-flap structure substrates (25 nM) (C) Nuclease activity of DmGEN protein (97 nM) on the model replication fork substrates (25 nM) (B,C) Electrophoresis was carried out on 10% polyacrylamide ⁄ M urea gels Amounts of nuclease products were calculated with the aid of the IMAGE J 1.36b image analyzer wt: DmGEN wildtype; mut: DmGEN E143A E145A mutant FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3923 Flap endonuclease activity in DmGEN Y Kanai et al A B C D E F G H I J K L Fig A rabbit polyclonal anti-DmGEN serum was used for Immunostaing of 0–3 h Drosophila embryos Microscopic imaging of embryos labeled with DNA in blue (DAPI) and DmGEN in green (a-DmGEN pAb) (A–C) Embryo at stage (0:25 to 1:05 h embryo) (D–I) Embryo at stage (1:05 to 2:10 h embryo) (J–L) Negative control Magnification: ·100 (A–F); ·400 (G–I); ·100 (J–L) early embryos, in which DNA replication is actively occurred (Fig 8) To maintain chromosome integrity, several DNA repair pathways coupled with the lagging strand of the replication fork are working [29,30] Lopes et al reported that ssDNA gaps accumulate along replicated duplexes in vivo, when DNA replication forks pause and restart near lesions on the template [31] They also argued that translesion synthesis and recombinational repair play a crucial role in repairing these ssDNA gaps [31] RAD51mediated DNA recombinational repair needs free 3¢-overhang DNA [32,33] We speculate that DmGEN may cleave the lagging strand of the replication fork with gaps As a result of the cleavage, DmGEN produces free 3¢-overhang DNA, which subsequently becomes available for RAD51-mediated recombinational repair 3924 The above-described properties of DmGEN obviously differ from other members of the RAD2 ⁄ XPG family of nucleases Thus, we suggest that DmGEN should be categorized in a new class (class IV) of the RAD2 ⁄ XPG family Homologues of DmGEN are widely found in animals and plants This suggests that DmGEN may play an important biological role Further characterization of DmGEN may shed new light on biological events related to DNA metabolism Experimental procedures Expression and purification of DmGEN protein PCR was carried out using the EST clone RE33588, containing the entire Drosophila GEN (DmGEN) coding FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al sequence The primers synthesized chemically were 5¢-CA TATGGGCGTCAAGGAATTATG-3¢ and 5¢-GGATCCC TTAATCACTAATCACCACCA-3¢ The resultant 2181 bp NdeI ⁄ BamHI DNA fragment was cloned into the corresponding sites of the pCold I expression vector (Takara, Shiga, Japan) For protein expression, the pCold I– DmGEN plasmid was transformed into the E coli BL21(DE3) (Novagen, Darmstadt, Germany) Bacteria containing the plasmid were grown at 30 °C in 2000 mL of Luria–Bertani medium supplemented with 50 lgặmL)1 ampicillin Cells were grown to D ẳ 0.7 and isopropylb-d-thiogalactoside was added to a final concentration of mm After 24 h incubation at 15 °C, cells were harvested by centrifugation at 3000 g for 10 Cell pellets were resuspended in 40 mL of ice-cold binding buffer (50 mm NaPO4 pH 8.0, 0.5 m NaCl, mm imidazole and 0.01% NP-40) and sonicated with five 10-s bursts Cell lysates were centrifuged at 15 000 g for 30 and the supernatant containing soluble proteins was collected as the crude extract The supernatant was loaded onto a mL of Ni-NTA resin column (Invitrogen Japan, Tokyo, Japan) The column was washed with 40 mL of washing buffer (50 mm NaPO4 pH 8.0, 0.5 m NaCl, 20 mm imidazole and 0.01% NP-40), and the bound protein was eluted with 10 mL of elution buffer (50 mm NaPO4 pH 8.0, 0.5 m NaCl, 0.5 m imidazole and 0.01% NP-40) The eluted protein was dialyzed against TEG (50 mm Tris ⁄ HCl pH 7.5, mm EDTA and 10% glycerol) The dialysate was loaded onto a mL SP Sepharose Fast Flow column (GE Healthcare, Buckinghamshire, UK) equilibrated with TEG After washing, the bound protein was eluted with 30 mL of a linear gradient of 0–1.5 m NaCl in TEG and the collected protein was dialyzed against TEG Finally, the dialysate was loaded onto a Superdex-200 column (GE Healthcare) equilibrated with TEMG (50 mm Tris ⁄ HCl pH 7.5, mm EDTA, mm 2-mercaptoethanol and 10% glycerol) containing 150 mm NaCl The peak fraction (1 mL) of DmGEN was dialyzed against the TEMG buffer containing 150 mm NaCl, and stored at )80 °C until used We also purified the HsFEN-1 protein from the E coli BL21(DE3) transformed with the pET28– HsFEN-1 plasmid and following a previously published report [34], and used the purified HsFEN-1 as a positive control Construction of an active-site double mutant of DmGEN (E143A E145A) We identified the active-site conserved residues of DmGEN (E143 and E145) by amino acid sequence alignment with the other members of the RAD2 ⁄ XPG family of nucleases (Fig 2B, asterisks and 3), in particular, HsFEN-1, which was previously functionally characterized using point mutation analysis by Shen et al [21] The following primers were chemically synthesized to create DmGEN point mutations: Flap endonuclease activity in DmGEN 5¢-CGTCCAAGGTCCCGGCGCAGCGGCAGCCTACTG TGCCTTT-3¢ and 5¢-AAAGGCACAGTAGGCTGCCGC TGCGCCGGGACCTTGGACG-3¢ (altered DNA sequences are underlined) Mutagenesis was performed using the Quick Change II site-directed mutagenesis kit (Stratagene, La Jolla, CA) Expression and purification of the mutant DmGEN protein were carried out following the procedures described above for wild-type DmGEN Preparation of substrates for nuclease assays The nucleotide sequences of the oligonucleotides used to form DNA substrates for this study are shown in Table DNA substrates were prepared as described previously [7] The gapped-flap is a flap substrate that has a bp gap at the upstream primer of the dsDNA By contrast, the blocked-flap (BF) is a flap substrate in which a primer is bound to the 5¢-tail of the single-stranded flap The doubleflap is a flap substrate that has both a 5¢ flap and a 3¢ flap Model replication fork and Holliday junction substrates were made as described by Boddy et al [35] Figure shows the DNA structures generated Nuclease assay (with linear DNA as the substrate) The DmGEN protein was incubated with 32P-labeled DNA substrate in a 20 lL reaction mixture containing 50 mm Tris ⁄ HCl pH 8.0, mm MgCl2, 10% glycerol and mm dithiothreitol at 37 °C The amounts of protein and substrates used are given in the figure legends The reaction was stopped by adding 20 lL of gel-loading buffer (90% formamide, mm EDTA, 0.1% bromophenol blue and 0.1% xylene cyanol), the sample was heated for at 95 °C, and a fraction was loaded onto a 20% polyacrylamide gel containing m urea in TBE buffer, and electrophoresis was carried out for h After drying, gels were exposed to BioMax MS-1 (Eastman Kodak Co., New York, NY) and the DNA bands were quantified using an image analyzer (image j 1.36b, National Institutes of Health, Bethesda, MD) FEN-1 was used as a positive control following the same procedure and using the conditions described in the figure legends Immunostainning of Drosophila embryos A polyclonal antibody against the DmGEN protein was raised in a rabbit using the purified recombinant DmGEN fragment (amino acid residues 508–680) Animals were fed water and standard rabbit food and maintained on a 12-h light/dark cycle Polyclonal antiserum to the peptide was raised in rabbits by subcutaneous injections of 0.3 mg of the peptide emulsified in Freund’s complete adjuvant Two weeks after the primary injection, boosts of 0.3 mg of the FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3925 Flap endonuclease activity in DmGEN Y Kanai et al peptide in Freund’s incomplete adjuvant were injected every weeks The rabbits were bled one week after the final boost under anesthesia The rabbits were treated in accordance with procedures approved by the Animal Ethics Committee of the Tokyo University of Science Western immunoblot analysis showed that it reacts specifically with the DmGEN protein in a crude extract of 0–3 h Drosophila embryos Embryos of Drosophila melanogaster (Canton S) 0–3 h old were collected, dechorionated, fixed and devitellinized as described by Ashburner [36] The procedure of immunostaining was previously described by Takata et al [37] A polyclonal rabbit anti-DmGEN serum and Alexa488–anti-(rabbit IgG) (Sigma, St Louis, MO) were used as primary and secondary antibodies, respectively The nuclei were stained with DAPI Acknowledgements 10 11 We thank Dr Yukinobu Uchiyama and Dr Kazuki Iwabata (Tokyo University of Science) for helpful discussions 12 13 References Szankasi P & Smith GR (1995) A role for exonuclease I from S pombe in mutation avoidance and mismatch correction Science 267, 1166–1169 Harada YN, Shiomi N, Koike M, Ikawa M, Okabe M, Hirota S, Kitamura Y, Kitagawa M, Matsunaga T, Nikaido O et al (1999) Postnatal growth failure, short life span, and early onset of cellular senescence and subsequent immortalization in mice lacking the xeroderma pigmentosum group G gene Mol Cell Biol 19, 2366–2372 Larsen E, Gran C, Saether BE, Seeberg E & Klungland A (2003) Proliferation failure and gamma radiation sensitivity of Fen1 null mutant mice at the blastocyst stage Mol Cell Biol 23, 5346–5353 Tian M, Jones DA, Smith M, Shinkura R & Alt FW (2004) Deficiency in the nuclease activity of xeroderma pigmentosum G in mice leads to hypersensitivity to UV irradiation Mol Cell Biol 24, 2237–2242 Bardwell PD, Woo CJ, Wei K, Li Z, Martin A, Sack SZ, Parris T, Edelmann W & Scharff MD (2004) Altered somatic hypermutation and reduced class-switch recombination in exonuclease 1-mutant mice Nat Immunol 5, 224–229 Wei K, Clark AB, Wong E, Kane MF, Mazur DJ, Parris T, Kolas NK, Russell R, Hou H, Kneitz B (2003) Inactivation of exonuclease in mice results in DNA mismatch repair defects, increased cancer susceptibility, and male and female sterility Genes Dev 17, 603–614 Ishikawa G, Kanai Y, Takata K, Takeuchi R, Shimanouchi K, Ruike T, Furukawa T, Kimura S & 3926 14 15 16 17 18 19 20 Sakaguchi K (2004) DmGEN, a novel RAD2 family endo-exonuclease from Drosophila melanogaster Nucleic Acids Res 32, 6251–6259 Furukawa T, Kimura S, Ishibashi T, Mori Y, Hashimoto J & Sakaguchi K (2003) OsSEND-1: a new RAD2 nuclease family member in higher plants Plant Mol Biol 51, 59–70 Moritoh S, Miki D, Akiyama M, Kawahara M, Izawa T, Maki H & Shimamoto K (2005) RNAi-mediated silencing of OsGEN-L (OsGEN-like), a new member of the RAD2 ⁄ XPG nuclease family, causes male sterility by defect of microspore development in rice Plant Cell Physiol 46, 699–715 O’Donovan A, Davies AA, Moggs JG, West SC & Wood RD (1994) XPG endonuclease makes the 3¢ incision in human DNA nucleotide excision repair Nature 371, 432–435 Clarkson SG (2003) The XPG story Biochimie 85, 1113–1121 Lieber MR (1997) The FEN-1 family of structure-specific nucleases in eukaryotic DNA replication, recombination and repair Bioessays 19, 233–240 Bibikova M, Wu B, Chi E, Kim KH, Trautman JK & Carroll D (1998) Characterization of FEN-1 from Xenopus laevis cDNA cloning and role in DNA metabolism J Biol Chem 273, 34222–34229 Shen B, Singh P, Liu R, Qiu J, Zheng L, Finger LD & Alas S (2005) Multiple but dissectible functions of FEN-1 nucleases in nucleic acid processing, genome stability and diseases Bioessays 27, 717–729 Genschel J, Bazemore LR & Modrich P (2002) Human exonuclease I is required for 5¢- and 3¢ mismatch repair J Biol Chem 277, 13302–13311 Bedale WA, Inman RB & Cox MM (1993) A reverse DNA strand exchange mediated by recA protein and exonuclease I The generation of apparent DNA strand breaks by recA protein is explained J Biol Chem 268, 15004–15016 Lee BI & Wilson DM (1999) The RAD2 domain of human exonuclease exhibits 5¢- to 3¢ exonuclease and flap structure-specific endonuclease activities J Biol Chem 274, 37763–37769 Lee BI, Nguyen LH, Barsky D, Fernandes M & Wilson DM (2002) Molecular interactions of human Exo1 with DNA Nucleic Acids Res 30, 942–949 Dunand-Sauthier I, Hohl M, Thorel F, Jaquier-Gubler P, Clarkson SG & Scharer OD (2005) The spacer region of XPG mediates recruitment to nucleotide excision repair complexes and determines substrate specificity J Biol Chem 280, 7030–7037 Qiu J, Liu R, Chapados BR, Sherman M, Tainer JA & Shen B (2004) Interaction interface of human flap endonuclease-1 with its DNA substrates J Biol Chem 279, 24394–24402 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS Y Kanai et al 21 Shen B, Nolan JP, Sklar LA & Park MS (1997) Functional analysis of point mutations in human flap endonuclease-1 active site Nucleic Acids Res 25, 3332–3338 22 Harrington JJ & Lieber MR (1994) The characterization of a mammalian DNA structure-specific endonuclease EMBO J 13, 1235–1246 23 Murante RS, Rust L & Bambara RA (1995) Calf 5¢- to 3¢ exo ⁄ endonuclease must slide from a 5¢ end of the substrate to perform structure-specific cleavage J Biol Chem 270, 30377–30383 24 Liu R, Qiu J, Finger LD, Zheng L & Shen B (2006) The DNA–protein interaction modes of FEN-1 with gap substrates and their implication in preventing duplication mutations Nucleic Acids Res 34, 1772–1784 25 Bownes M (1975) A photographic study of development in the living embryo of Drosophila melanogaster J Embryol Exp Morphol 33, 789–801 26 Yamaguchi M, Date T & Matsukage A (1991) Distribution of PCNA in Drosophila embryo during nuclear division cycles J Cell Sci 100, 729–733 27 Constantinou A, Gunz D, Evans E, Lalle P, Bates PA, Wood RD & Clarkson SG (1999) Conserved residues of human XPG protein important for nuclease activity and function in nucleotide excision repair J Biol Chem 274, 5637–5648 28 Hohl M, Dunand-Sauthier I, Staresincic L, JaquierGubler P, Thorel F, Modesti M, Clarkson SG & Scharer OD (2007) Domain swapping between FEN-1 and XPG defines regions in XPG that mediate nucleotide excision repair activity and substrate specificity Nucleic Acids Res 35, 3053–3063 29 Rossi ML, Purohit V, Brandt PD & Bambara RA (2006) Lagging strand replication proteins in genome stability and DNA repair Chem Rev 106, 453–473 30 Kimura S, Tahira Y, Ishibashi T, Mori Y, Mori T, Hashimoto J & Sakaguchi K (2004) DNA repair in higher plants; photoreactivation is the major DNA repair pathway in non-proliferating cells while excision repair (nucleotide excision repair and base excision repair) is active in proliferating cells Nucleic Acids Res 32, 2760–2767 31 Lopes M, Foiani M & Sogo JM (2006) Multiple mechanisms control chromosome integrity after replication Flap endonuclease activity in DmGEN 32 33 34 35 36 37 fork uncoupling and restart at irreparable UV lesions Mol Cell 21, 15–27 Michel B (2000) Replication fork arrest and DNA recombination Trends Biochem Sci 25, 173–178 Mazin AV, Zaitseva E, Sung P & Kowalczykowski SC (2000) Tailed duplex DNA is the preferred substrate for Rad51 protein-mediated homologous pairing EMBO J 19, 1148–1156 Kimura S, Ueda T, Hatanaka M, Takenouchi M, Hashimoto J & Sakaguchi K (2000) Plant homologue of flap endonuclease-1: molecular cloning, characterization, and evidence of expression in meristematic tissues Plant Mol Biol 42, 415–427 Boddy MN, Gaillard PH, McDonald WH, Shanahan P & Yates R (2001) Mus81–Eme1 are essential components of a Holliday junction resolvase Cell 107, 537–548 Ashburner M (1989) Antibody staining of embryos Drosophila, Laboratory Manual, pp 214–216 Cold Spring Harbor Press, New York, NY Takata K, Ishikawa G, Hirose F & Sakaguchi K (2002) Drosophila damage-specific DNA-binding protein (D-DDB1) is controlled by the DRE ⁄ DREF system Nucleic Acids Res 30, 3795–3808 Supplementary material The following supplementary material is available online: Table S1 Oligonucleotides used for constructing the hairpinned-flap substrates shown in Fig S1 Fig S1 Nuclease activity of HsFEN-1 (A) and DmGEN (B) on the flap structure substrate and hairpinned-flap structure substrates This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3927 ... CAGCAACGCAAGCTTG GTCGACCTGCAGCCCAAGCTTGCGTTGCTG ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA CAGCAACGCAAGCTT CAGCAACGCAAGCT CAGCAACGCAAG AGAGATTTTCCACAT CTAGAGATTTTCCACAT... GACGTCATAGACGATTACATTGCTAGGACA TGCTGTCTAGAGACTATCGC GCGATAGTCTCTAGACAGCATGTCCTAGCAA GCCAGAATTCGGCAGCGTC GGACATCTTTGCCCACGTTGACCCG ATCTTTGCCCACGTTGACCCG TTGCCCACGTTGACCCG GCGATAGTCTCTAGACAGCATGTCC... CGGTCAACGTGGGCATACAACGTGGCACTGT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT GTCCTAGCAAAGCGTATGTGATCACTGG GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGTCTATGACGTC GACGTCATAGACGATTACATTGCTAGGACA