Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast Michael Ru¨ tzler*, Andre ´ Reissaus, Magdalena Budzowska and Wolfhard Bandlow Ludwig-Maximilians-Universita ¨ tMu ¨ nchen, Department Biologie I, Bereich Genetik, Munich, Germany SUT2 was found in a screen for multicopy suppressors of the synthetic slow growth phenotype of a Dras2 Dgpa2 double deletion mutant. It failed, however, to cure the lethal phenotype of a Dras1 Dras2 mutant suggesting that it acts upstream of Ras or in a parallel pathway. By testing cAMP- dependent reactions including the accumulation of storage carbohydrates, pseudohyphal differentiation, entry of mei- osis as well as the measurement of FLO11 reporter activity we show that Sut2p modulates the activity of protein kinase A (PKA). Additionally, we demonstrate that cellular levels of Ras2p are affected by Sut2p and that Sut2-GFPp accu- mulates significantly in the nucleus. Based on the observed influence of high SUT2 gene dosage on PKA activity as well as Sut2p’s homology to the presumptive transcription factor Sut1p, we suggest that Sut2p contributes to regulation of PKA activity at the level of transcription. Keywords: Saccharomyces cerevisiae; cAMP/PKA pathway; suppressors; genetic screen. In the yeast Saccharomyces cerevisiae two distinct GTP- binding (G) protein systems have been found to activate adenylate cyclase: (a) The Ras proteins Ras1p and Ras2p [1], which are members of the highly conserved family of small GTP-binding proteins and (b) the Gpr1p/Gpa2p carbohydrate receptor system consisting of the G protein coupled receptor (GPCR), Gpr1p, and its coupled hetero- trimeric G protein composed of Gpa2 (Ga) [2] and the atypical Gb and Gc subunits, Gpb1p, Gpb2p and Gpg1p, respectively [3,4]. ras1 ras2 Double mutants are not viable, indicating a specific role of the Ras proteins that cannot be complemented by Gpa2p, whereas Dgpa2 Dras2 mutants display a very slow growth phenotype [5]. cAMP activates the three protein kinase A (PKA) catalytic subunits, Tpk1p, Tpk2p and Tpk3p [6], via binding to the PKA regulatory subunit, Bcy1p [7] and controls several nutrient-related processes such as glycogen and trehalose homeostasis, entry of meiosis and progression through the G1 phase of the cell cycle [8]. In addition, Ras2p has been found to control a mitogen-activated protein kinase (MAPK) cascade, thereby regulating filamentous growth [9]. Both the cAMP/PKA pathway and the MAPK cascade activity converge at the promoter of FLO11 [10], a key element in establishing filamentation, suggesting that Ras is a major switch in this process. The GPCR system has been shown to control the level of intracellular cAMP in response to glucose or sucrose [2]. The exact downstream signaling events controlled by the carbohydrate receptor system are, however, as yet not well understood. It has been proposed that Gpa2 acts in parallel to the Ras proteins to activate adenylate cyclase to synthesize cAMP. However, no physical interaction of Gpa2p or its recently identified b/c-like interaction partners [3,4] has been described as yet. To gain further insight into the signaling pathway downstream of Gpr1p/Gpa2p and Ras we made use of the synthetic slow growth phenotype displayed by Dgpa2 Dras2 double deletion mutants [5]: we constructed a Dgpa2 Dras2 strain in the CEN.PK2 genetic background and transformed it with a high copy yeast genomic library in order to identify high gene dosage suppressors. In addition to several known suppressors of low Ras/cAMP pathway activity, we have identified SUT2, a homologue of a presumptive transcription activator of sterol biosynthetic genes [11] and describe a possible linkage between cAMP/ PKA activity and SUT2. Experimental procedures Strains and plasmids The S. cerevisiae strains and plasmids used in this study are listed in Table 1. To construct the Dras2 strains MB1 (CEN.PK2) and MR211 (S1278b) the kanMX cassette from plasmid pUG6 [12] was amplified by polymerase chain reaction (PCR) using the primers disRAS2fwd 5¢-TAACCGT TTTCGAATTGAAAGGAGATATACAGAAAAAA AACAGCTGAAGCTTCGTACGC-3¢ and disRAS2rev Correspondence to M. Ru ¨ tzler, Department of Biological Sciences, 6270 Medical Research Building III, Vanderbilt University, Station B 3582, Nashville, TN 37235–3582 USA. Fax: + 1 6159360129, Tel.: +1 6153433718, E-mail: m.ruetzler@vanderbilt.edu Abbreviations:DAPI,4¢,6-diamidino-2-phenylindole; ECL, enhanced chemiluminescence; FOA, 5-fluoroorotic acid; GFP, green fluorescent protein; GPCR, G protein coupled receptor; MAPK, mitogen- activated protein kinase; PKA, protein kinase A; PVDF, poly(vinylidene difluoride). *Present address: Department of Biological Sciences, 6270 Medical Research Building III, Vanderbilt University, Station B 3582, Nashville, TN 37235–3582 USA. (Received 8 December 2003, revised 2 February 2004, accepted 9 February 2004) Eur. J. Biochem. 271, 1284–1291 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04034.x 5¢-AGAGTTCTTTTCGTCTTAGCGTTTCTACAACT ATTTCCTTTTTATTAGCATAGGCCACTAGTGGAT CTG-3¢ and both wild-type strains were transformed with the DNA fragment. For disruption of SUT2 we utilized the loxP-S. pombe his5 + -loxP cassette [13] (the Schizosaccaro- myces pombe his5 gene can complement a S. cerevisiae his3 mutation, but due to sequence divergence integration is preferred at the intended disruption locus). The cassette was amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively. The plasmid pFL38-RAS2 was con- structed by ligating the 3 kb HindIII/EcoRI-RAS2 frag- ment from plasmid YCplac22-RAS2 [14] to the respective sites of pFL38. Plasmid p426MET25-RAS2 was a gift from B. Klebl (Functional Genomics Center Martinsried, Aventis Pharma Deutschland GmbH, Martinsried, Germany). The plasmid was used to transform MB1 Dras2 ura3 prior to disruption of GPA2 in order to reduce the appearance of spontaneous second site suppressors after the disruption of GPA2. GPA2 was disrupted with a TRP1-containing construct allowing deletion of basepairs 237–870 of the GPA2 open reading frame to yield TG1. For construction of MR349 (CEN.PK2 Dras1 Dras2), MB1 [p426MET25- RAS2] was deleted for RAS1 utilizing the S.pombe his5 + construct amplified from plasmid pUG27 as described above using the primers disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in order to confirm the role of SUT2 as a high copy suppressor of the synthetic phenotype Table 1. S. cerevi siae strains and plasmids used in this study. Characteristics Source Yeast strains MB1 CEN.PK2; MATa ras2::kanMX ura3–52 leu2–3, 112 his3-D1 trp1–289 MAL2–8 c SUC2 This study TG1 CEN.PK2; MATa gpa2::TRP1 ras2::kanMX ura3–52 leu2–3, 112 his3-D1 trp1–289 MAL2–8 c SUC2 [p426MET25-RAS2] This study MR349 CEN.PK2; MATa ras1::S.pombe his5 + ras2::kanMX ura3–52 leu2–3, 112 his3-D1 trp1–289 MAL2–8 c SUC2 [pFL38-RAS2] This study AR1 S1278b; MATa ura3–52 his3:hisG leu2::hisG sut2:: S.pombe his5 + This study YHUM214 S1278b; MATa ura3–52 his3:hisG trp1::hisG H.U. Moesch YHUM216 S1278b; MATa ura3–52 his3:hisG leu2::hisG H.U. Moesch MR161 S1278b; MATa/a ura3–52/ura3–52 his3:hisG/his3::hisG trp1::hisG/trp1::hisG This study MR211 S1278b; MATa ura3–52 his3:hisG leu2::hisG ras2::kanMX MR298 S1278b; MATa/a ras2::kanMX/ras2::kanMX ura3–52/ura3–52 his3:hisG/his3:hisG leu2::hisG leu)2::hisG This study AR2 S1278b; MATa/a sut2::S.pombe his5 + /sut2::S.pombe his5 + ura3–52/ura3–52 his3:hisG/his3:hisG leu2::hisG/LEU2 TRP1/trp1::hisG This study MR287 S1278b; MATa ura3–52 his3:hisG leu2::hisG FLO11::lacZ This study AR3 S1278b; MATa ura3–52 his3:hisG leu2::hisG ras2::kanMX FLO11::lacZ This study AR4 S1278b; MATa ura3–52 his3:hisG leu2::hisG sut2::S.pombe his5 + FLO11::lacZ This study Plasmids pFL38 Low copy number, URA3 marker [30] YEp351 High copy number, LEU2 marker [31] p426MET25-RAS2 High copy number, URA3 marker, RAS2 – ORF in p426MET25[32] B. Klebl YEp351-GPA2 High copy number, LEU2 marker, 1.5 kb genomic Sau3A fragment containing full length GPA2 This study YEp351-RAS1 High copy number, LEU2 marker, 4 kb genomic Sau3A fragment containing full length RAS1 This study YEp351-RAS2 High copy number, LEU2 marker, 1.5 kb genomic Sau3A fragment containing full length RAS2 This study pFL38-RAS2 Low copy number, URA3 marker, RAS2 – ORF plus endogenous regulatory regions This study YEp 351-SUT2 High copy number, LEU2 marker, 1.9 kb genomic ScaI–PstI SUT2 fragment, SmaI–PstI in YEp351 This study YEp 351-SUT2-GFP High copy number, LEU2 marker, SUT2 with in-frame C-terminal yEGFP fusion This study YEp 351-TPK2 High copy number, LEU2 marker, 5 kb genomic Sau3A fragment containing full length TPK2 This study pYLZ-6int-Flo11 integration plasmid, URA3 marker, contains 950 bp of FLO11 upstream region in pYLZ-6[15]8] This study GPA2DTRP plasmid, containing a SmaI-SmaI fragment for deletion of bp 237–870 of the GPA2 open reading; sequence see supplementary material This study YEp351-library BamHI-Sau3A yeast genomic library, LEU2 marker, insert size range 0.5–5 kb in YEp351 E. Bogengruber Ó FEBS 2004 SUT2, a multicopy suppressor of low PKA activity (Eur. J. Biochem. 271) 1285 of Dgpa2 Dras2 strains (Results). Hence, a 1.9-kb PstI-ScaI genomic fragment containing SUT2 was ligated into YEp351 (PstI-SmaI). To construct an SUT2-GFP fusion, yEGFP was amplified from pUG35 (U. Gu ¨ ldener & J. H. Hegemann, Institut fu ¨ r Mikrobiologie, Heinrich Heine Univ., Du ¨ sseldorf, Germany; unpublished results; plasmid information available online at http://mips.gsf.de/proj/ yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively. YEp351-SUT2 was linearized with SphI and co-transformed with the yEGFP PCR fragment into YHUM216. Both SUT-GFP primers provide fragments overlapping with SUT2 and YEp351, respectively, thereby allowing recombination resulting in restoration of a replicating plasmid. Positive recombination was identified by selection for LEU2 and GFP fluorescence. In frame recombination of GFP C-terminal to SUT2 was verified by DNA nucleotide sequence analysis of isolated plasmids. To generate Flo11-b galactosidase reporter strains, a 950 bp fragment upstream of the FLO11 open reading frame was amplified using the primers Flo11_lacZ_fwd 5¢-GTTTAGAA TTCGATTGTAGGCAGAA-3¢ and Flo11_lacZ_rev 5¢-AGGATCCAAATAAGCGAGTAGAAAT-3¢,respec- tively. Plasmid pYLZ-6 was converted to an integration plasmid, as suggested [15], and the amplified FLO11- fragment was ligated to the resulting plasmid pYLZ-6int via EcoRI/BamHI-sites, subsequently. The resulting plasmid pYLZ-6int-Flo11 was linearized with XbaI and subse- quently used to transform YHUM216, creating MR287. Two individual transformants were then used to obtain the corresponding Dras2 (AR3) and Dsut2 (AR4) reporter strains by standard genetic methods. High copy suppressor screen The Yep351-based yeast genomic library used for the suppressor screen was a gift from E. Bogengruber (Institute for Genetics and General Biology, University of Salzburg, Austria). The insert size ranges from 0.5 to 5 kb. All yeast transformations were performed by a modified lithium acetate method [12]. Transformation efficiency was opti- mized to yield  500–1000 colonies per plate to facilitate subsequent identification of suppressors. After 2–3 days of growth on selective medium, colonies where replica-plated onto 5-fluoroorotate (FOA) containing medium (0.075%, BioVectra, Canada) to select against plasmid p426MET25- RAS2 URA3. After an additional 2 days of growth, plasmids where isolated from colonies that had formed. To distinguish from spontaneous genomic suppressor mutants, plasmids that accelerated growth of Dgpa2 Dras2 cells were identified after re-transformation into TG1 and FOA-selection against the RAS2 and URA3-harboring plasmid. Yeast culture, sample preparation, biochemical analysis, immunoblots and invasive growth assay For determination of endogenous glycogen or trehalose levels, yeast strains were cultivated overnight in SC medium (0.17% yeast nitrogen base, ammonium free; 0.5% ammonium sulfate; 2% glucose) with required amino acid supplements (0.002%) to a final D 600 of 6 (± 0.5). A fraction of these cultures (equaling approx. 50 mg of wet weight cells) was collected to determine the level of storage carbohydrates after entry of stationary phase. The remainder of the cultures was used to inoculate fresh SC-medium to an D 600 of 0.5. Aliquots from these cultures were collected at the time points indicated in Fig. 3 and the storage carbohydrate levels were determined as described by Lillie and Pringle [16]. Culture conditions for immunoblots were as described for storage carbohy- drate determination. Cells equal to 5 D 600 units (1 unit ¼ 1 D 600 ÆmL )1 ) were harvested by centrifugation, washed once in ice-cold water and resuspended in 1.5% SDS, 1 M 2-mercaptoethanol and disrupted with acid-washed glass beads (0.45–0.55 mm) by vortexing for 3· 1 min between 1-min intervals of cooling at 0 °C. Samples were centri- fuged for 1 min at 800 g, and subsequently supernatants were assayed for protein content by determining A 280 .All sampleswerethendilutedtoanA 280 of 20, 1/2 volume sample buffer (15% glycerol, bromophenol blue, 66 m M Tris/HCl, pH 6.8) was added, and 30 lLofeachsample was subjected to SDS/PAGE and transferred to a poly(vinylidene difluoride) (PVDF)-membrane. Ras pro- teins were detected using ECL after incubation of the membranes with monoclonal anti-H-Ras antibody (259) and peroxidase-labeled chicken anti-rat antibody (both from Santa Cruz Biotechnology, Heidelberg, Germany). Each blot was re-incubated with chicken anti-Aky2p Ig [17] and peroxidase coupled anti-chicken secondary Ig (Sigma-Aldrich, Taufkirchen, Germany) as a loading control. To determine sporulation efficiency, diploid yeast cells were cultured in YPD medium overnight. Aliquots were washed and transferred to sporulation medium (1% potassium acetate, 0.1% yeast extract, 0.05% glucose). Formation of asci was monitored after 3 days in a Thoma cell counting chamber. Invasive growth was assayed after 3 days of growth on YPD medium at 30 °C by washing nonadhering cells from the plates with a squeeze bottle. b-Galactosidase assays Yeast cells were grown in YPD, harvested at an D 600 of 2.5–3, disrupted with glass beads (diameter: 0.5–0.75 mm, Braun, Melsungen, Germany) and total protein concentra- tion was determined as described by Bradford [18]. For b-galactosidase assays, an appropriate amount of pro- tein was incubated in Z-buffer (5· Z-buffer ¼ 300 m M Na 2 HPO 4 ,200m M NaH 2 PO 4 ,50m M KCl, 5 m M MgSO 4 , 250 m M 2-mercaptoethanol) with 0.7 mgÆmL )1 o-nitro- phenyl-b- D -galactopyranoside (ONPG) as substrate. After 30–40 min of incubation at 30 °C, the reaction was terminated by adding 1 M Na 2 CO 3 [19]. The amount of hydrolyzed ONPG was determined (A 420 ) and activity of b-galactosidase (as U per mg protein) calculated as follows: DA 420 · 1000/0.0045 · total protein (lg) · incubation time (min). For statistical analysis of sporulation efficiency and lacZ reporter expression, the SPSS 11.0 software package (SPSSInc.,Chicago,IL,USA)wasused. 1286 M. Ru ¨ tzler et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Microscopy For fluorescence microscopy, YHUM216 [YEp351-SUT2- GFP] cells were grown in selective medium to an D 600 of 1. Cell suspension (100 lL) were added to 1 mL of 70% ethanol ()20 °C), mixed, spun down and re-suspended in mounting solution (0.1 M Pipes/KOH, pH 6.9, 5 m M EGTA, 5 m M MgCl 2 , 50% glycerol, 0.01 mg DAPI). Images were taken with a Zeiss Axioscop equipped with a Spot RT Monochrome CCD camera (Diagnostic Instru- ments Inc., USA) and evaluated by using the SPOT 3.02 software (Diagnostic Instruments Inc., USA). Results SUT2 is a high copy suppressor of synthetic slow growth in D gpa2 D ras2 strains To identify high copy suppressors of the synthetic slow growth phenotype of Dgpa2 Dras2 we produced the double deletion genotype in a CEN.PK2 background. To avoid emergence of spontaneous genomic suppressors, the parental strain TG1 contained plasmid p426MET25- RAS2 URA3 carrying a RAS2 wild-type copy to allow propagation after disruption of the genomic RAS2 copy and a URA3 marker. After transformation with a yeast genomic YEp351-based DNA library, p426MET25-RAS2 URA3 was removed by selection against the URA3 marker using FOA [20]. Using this experimental setup we screened a total of 35 000 colonies and thereby identified a set of plasmids that contained several suppressors (RAS1, RAS2, GPA2, TPK2, SCH9) (Fig. 1A and data not shown) whose relation to the cAMP/PKA pathway has been described before [1,6,21–23]. In addition, we identified a plasmid containing the SUT2 gene, which after sequence analysis was putatively characterized as a homologue of the sterol uptake, biosynthesis and traf- ficking regulator SUT1 [11]. In the present work, we investigate how SUT2 might be linked to the Ras/cAMP pathway. High SUT2 gene dosage does not suppress lethality of a Dras1 Dras2 strain In order to investigate the interaction of Sut2p with the Ras/cAMP pathway, we constructed a strain (denoted as MR349) that was deleted for both RAS genes. This genetic combination is lethal. To test whether SUT2 is able to complement the lethal phenotype of Dras1 Dras2 the Dras2 strain was transformed with a low copy URA3- selectable plasmid construct encoding RAS2,priorto deletion of RAS1. In addition, this mutant strain carried SUT2 on a LEU2 plasmid. Again, we used selection against the RAS2 URA3 plasmidwithFOAtotestfor complementation of lethality by SUT2 (see Fig. 1B). In contrast to TPK2 or RAS2, high copy SUT2-containing plasmids were incapable of rescuing the lethality caused by the Dras1 Dras2 double mutant. Because SUT2 was able to suppress the Dgpa2 Dras2, but not the Dras1 Dras2 phenotype, we concluded that SUT2 action requires at least one of the Ras proteins to sustain its effect on the cAMP pathway. SUT2 modulates PKA-dependent processes We then addressed the question as to whether high SUT2 gene dosage suppresses the slow growth phenotype of Dgpa2 Dras2 cells by increasing PKA activity. Low activity of the PKA pathway leads to accumulation of glycogen and trehalose, arrest of the cell cycle in G0 phase and alleviates entry of meiosis in diploids. Upon partial nutrient limitation, invasive growth may occur in haploids [24] which in the wild type requires high PKA activity. These consequences of PKA-pathway activity were tested subsequently in order to examine the influence of high copy SUT2 on PKA activity. We found that high copy SUT2 significantly reduced glycogen and trehalose levels in a Dras2 mutant background, whereas there was apparently no influence on carbohydrate content in wild type CEN.PK2 cells (Fig. 2, top). We did not investigate the influence of high SUT2 gene dosage on PKA- dependent processes in Dgpa2 Dras2 cells, as it was not possible to propagate these cells without a suppressor- plasmid, such as p426MET25-RAS2.WhenDgpa2 Dras2 cells were grown without a suppressor-plasmid, we noticed frequent appearance of spontaneous mutations that accelerated growth and consequently might have affected PKA activity. As CEN.PK2 has been previously reported to have a mutation in the adenylate cyclase gene that renders it largely insensitive to stimulation by Gpa2p and Ras2p [25], we Fig. 1. Complementation of CEN.PK2 Dgpa2 Dras2 (A) or CEN.PK2 Dras1 Dras2 (B) by different high copy plasmids. Droplets containing the indicated cell numbers (top) of high-copy transformants were applied onto FOA medium. Plasmid inserts are indicated on the left margin. e.p., empty plasmid (YEp351). Note that the parental strains CEN.PK2 Dgpa2 Dras2 and CEN.PK2 Dras1 Dras2 contained plasmid p426MET25-RAS2 (2l plasmid) and pFL38-RAS2 (centromeric plasmid), respectively, prior to FOA selection. Ó FEBS 2004 SUT2, a multicopy suppressor of low PKA activity (Eur. J. Biochem. 271) 1287 re-examined storage carbohydrate levels in the independent genetic background of strain S1278b. In this case, high SUT2 dosage conferred a reduction in PKA activity as judged from storage carbohydrate levels in S1278b cells during vegetative growth on glucose (Fig. 2, bottom) indicating that the strong, nutrient responsive PKA activity of S1278b [26] is modulated by Sut2p. It is reasonable to suppose that the observed differences between the two strains both containing high dosage of SUT2 could be due to the reported difference in PKA pathway activity. On this basis, we hypothesized that (a) high SUT2 gene dosage might increase PKA activity only when it is low, but that (b) it acts inhibitory when PKA activity is high. To gain further insight into SUT2 function we generated a sut2D strain for subsequent analyses. To challenge the first part of the above hypothesis, we used diploid S1278b cells and determined sporulation efficiency, which is inversely correlated with PKA activity [27]. We found that high SUT2 gene dosage drastically diminished sporulation efficiency and, thus, mimics a phenotype of increased PKA activity in S1278b wild type and slightly less in Dras2 cells. While the deletion of SUT2 in wild-type cells slightly decreased sporulation efficiency the difference was not statistically significant (Fig. 3). High SUT2 gene dosage reduces invasive growth To address the assumption that a high level of SUT2 reduces PKA activity only when PKA activity is high we investigated the influence of SUT2 on invasive growth, which requires high PKA activity. We found that after three days of growth on YPD medium, S1278b cells carrying a high copy SUT2 plasmid did not at all adhere to the agar medium in agreement with low cellular PKA activity. On the other hand, S1278b wild-type control cells showed the normal, strong invasive growth. In fact, the extent of the reduction of invasive growth by high copy SUT2 was similar to a Dras2 strain (Fig. 4A). To quantify this observation, we generated a set of FLO11::lacZ reporter strains, which allowed us to study expression of FLO11,the major indicator of invasive growth. In agreement with the observed effect during invasive growth, high SUT2 gene dosage reduced b-galactosidase expression in wild type to a level similar to Dras2 cells. Consistently, Dsut2 displayed an increase in reporter gene expression, suggesting that Sut2p, in fact, negatively regulates high PKA activity (Fig. 4B). Based on the genetic evidence that high SUT2 gene dosage is sufficient to sustain growth in Dgpa2 Dras2 but not Dras1 Dras2 cells and considering that Sut2p has initially been identified as a homologue of the putative transcription factor Sut1p [11], we reasoned that Sut2p might act to modify the transcription of one or both RAS genes. Therefore, we determined the level of total Ras protein in extracts of cells grown as described for the carbohydrate determination experiments using Western blots with an anti-H-RAS (259) antibody which detects both, yeast Ras1p and Ras2p [14]. We found that high SUT2 gene dosage had only a limited effect on Ras protein levels when cells were harvested in stationary phase. However, in cells shifted to fresh glucose medium and re-grown for an additional 4 h, Ras protein levels were strongly reduced by high SUT2 gene dosage (Fig. 4C), thus providing a possible explanation for the observed phenotype of reduced invasive growth sug- gestive of low PKA activity. Sut2p-GFP localizes to the nucleus In order to support the possibility that SUT2 encodes a transcription factor, like its anaerobically expressed isozyme Sut1p [11], we determined the subcellular localization of GFP fused to the C-terminus of Sut2p. Expression was controlled by the authentic SUT2 promoter on a high copy Fig. 2. Levels of glycogen and trehalose in CEN.PK2 Dras2 (top) and R1278b Dras2 (bottom) transformed with different plasmids. Cultures where grown to stationary phase in selective glucose medium over night (D 600 5.5) and shifted to fresh glucose medium (SC 2% glucose) at time point 0. (j) YEp351 + pFL38; (d) YEp351 + pFL38- RAS2;(h) YEp351-SUT2 +pFL38;(s) YEp351-SUT2 + pFL38- RAS2. Experiments were performed three times with similar results. Fig. 3. Sporulation efficiency of R1278b. SUT2 carried on a high copy plasmid reduces sporulation efficiency in wild-type (P<0.001) and Dras2 (P<0.05) cells (Tukey HSD; n ¼ 4). Error bars show ± 1.0 SD; columns show mean values. WT, MR161; h.c. SUT2, YEp351- SUT2; Dras2, MR298; Dsut2,AR2. 1288 M. Ru ¨ tzler et al. (Eur. J. Biochem. 271) Ó FEBS 2004 plasmid. We found that Sut2p-GFP localizes to the entire cytoplasm of the cell with some accumulation in the nucleus of most cells (Fig. 5). To verify that the observed fluorescent signal was, indeed, mainly localized to the nucleus, we carried out DAPI staining of ethanol fixed cells. Cells which retain GFP fluorescence in this procedure show a clear colocalization of DAPI and green fluorescence in agreement with a possible involvement of Sut2p in transcription regulation. Discussion In this report we describe the isolation of SUT2 in a screen for high copy suppressors of the synthetic slow growth phenotype of Dgpa2 Dras2. In addition to SUT2, a number of other suppressors were identified that have been impli- cated to function in the RAS/cAMP pathway. These include the two disrupted genes, GPA2 and RAS2, the second RAS gene RAS1, SCH9, a protein kinase A homologue, which previously has been described as a high copy suppressor of a number of defects in the RAS/cAMP pathway [23] and TPK2, one of the three catalytic subunits of PKA [6]. Interestingly, this screen did not yield any plasmids that contained TPK1 or TPK3, the other two genes encoding catalytic subunits of PKA. Plasmids that contained either RAS1, RAS2 or SUT2 were isolated frequently in the screen (50–100 times each), whereas GPA2, SCH9 and TPK2 were isolated < 10 times. This may indicate that the yeast genomic library utilized in this study did not contain a perfectly random array of DNA fragments and hence the screen was probably not comprehensive. Sut2p has been described previously as a homologue of the putative transcriptional activator Sut1p. When expressed under the control of a strong heterologous promoter both proteins enhance uptake of sterols and, at least Sut1p, also increases the biosynthesis of sterol precursors [11]. In contrast to the exclusively anaerobically expressed SUT1, expression of SUT2 is apparently not controlled by oxygen [28]. In order to establish an epistatic relationship between SUT2 and elements of the RAS/cAMP pathway we determined the effect of high SUT2 gene dosage on the lethal double-deletion of both RAS-genes. In contrast to concomitant deletion of GPA2 and RAS2,highSUT2 gene dosage did not rescue the RAS1 RAS2-double deletion, suggesting that SUT2 either acts upstream or, alternatively, in a parallel pathway to RAS. To further investigate the relation between SUT2 and the RAS/cAMP pathway we studied the influence of high SUT2 gene dosage on storage-carbohydrate homeo- stasis, which is controlled by PKA. Consistent with SUT2’s function as a high copy suppressor of the syn- thetic Dgpa2 Dras2 phenotype, high SUT2 gene dosage resulted in decreased storage-carbohydrate levels in a CEN.PK2 background. However, this effect was only observed in Dras2 mutants. Surprisingly, re-evaluation of this result in an independent genetic background (S1278b) yielded a different result: high SUT2 gene dosage led to increased storage carbohydrate levels, which suggests reduced PKA activity. PKA activity in CEN.PK2 is reduced due to a mutation in adenylate cyclase [25] whereas S1278b is known to contain a particularly strong PKA pathway [26]. We therefore hypothesized that Sut2p may represent a new element in PKA feedback- regulation and, hence, affects these two strains differently: increased SUT2 gene dosage stimulates low PKA activity but Fig. 5. Localization of the Sut2-GFPp chimeric protein. Cells were fixed in 70% ethanol for DAPI staining and imaged as described in Experimental procedures. Fig. 4. Influence of Sut2p on invasive growth, FLO11 expression and Ras protein level in R1278b. (A)CellsweregrownonYPDmediumfor 3 days at 30 °C (top, left) and then washed off the plates with a squeeze bottle to determine invasive growth (top, right). Genotypes are as indicated (center, left). (B) To quantify the influence of Sut2p on invasive growth, Flo11-b galactosidase reporter assays were carried out as detailed in Experimental procedures. YEp351-SUT2 reduces lacZ reporter expression in WT (P<0.01). In contrast, deletion of SUT2 increased reporter expression (P ¼ 0.001; Tukey HSD; n ¼ 9 and 3 for Dras2, respectively. Error bars show ± 1.0 SD. Columns represent mean values. (C) Immunoblot with anti-H-Ras (259) or anti- Aky2 Ig: Total protein was prepared from cells grown overnight in SC medium (stat.) or after shift to fresh SC medium (growth) as indicated in Experimental procedures. WT, YHUM216 and MR287 (lacZ); Dras2, MR211 and AR3 (lacZ); Dsut2, AR1 and AR4 (lacZ); h.c. SUT2, YEp351-SUT2. Ó FEBS 2004 SUT2, a multicopy suppressor of low PKA activity (Eur. J. Biochem. 271) 1289 inhibits high PKA activity. Subsequent experiments on sporulation efficiency and invasive growth of S1278b supported this hypothesis. Sporulation in S. cerevisiae is facilitated by starvation-conditions that result in low PKA activity. High SUT2 gene dosage yielded diminished spor- ulation efficiency, which indicates increased PKA activity relative to wild type. In contrast, invasive growth in haploids requires strong PKA activity and is assayed on rich medium [24]. Under these growth conditions, high SUT2 gene dosage resulted in a strong reduction of agar invasion in a RAS2- wild-type strain, and this reduction was similar to the phenotype of Dras2 mutants. We consistently found that duringgrowthinrichmedium,highSUT2 gene dosage resulted in diminished expression of FLO11, a surface flocculin whose expression is stimulated by PKA and that is essential for invasive growth [10]. As it has been proposed that Sut1p and Sut2p act as transcription factors [11] we investigated if SUT2 affects expression of elements of the RAS/cAMP pathway. Indeed we found that high SUT2 gene dosage reduced Ras2p expression in cells that had been grown in rich medium. Importantly, no reduction in Ras2p was observed in cultures approaching stationary phase, which correlates with a reduction in PKA-activity. Interestingly, a link between sterol-biosynthesis and RAS has previously been established: if yeast cells were starved for mevalonate, an early precursor of isoprenoids and sterols, levels of both RAS-mRNAs were decreased [29]. One possible explanation for the effect of high SUT2 gene dosage on the RAS/cAMP pathway is that Dgpa2 Dras2 and possibly additional mutants reducing PKA activity are simultaneously down-regulated for isoprenoid/sterol bio- synthesis, thereby reducing Ras1p abundance and, hence, impairing the residual G-protein stimulating adenylate cyclase. High copy expression of SUT2 then could, in analogy to its homologue SUT1, relieve this sterol precur- sor-starvation by increasing sterol-biosynthesis. Therefore it will be interesting to determine if genes of the sterol biosynthetic pathway are subject to regulation by Sut2p, which may yield a better understanding of the proposed connection between the nutrient-sensitive activity of PKA and sterol biosynthesis. Acknowledgements This work was supported by a grant from the Deutsche Forschungs- gemeinschaft to W. B. (Ba415/24–1). We thank H. U. Mo ¨ sch, Go ¨ ttingen, for the gift of strains and plasmids. We are also indebted to B. Klebl, Martinsried, for the gift of plasmid p426MET25-Ras2. M. Angermayr and G. Strobel are acknowledged for their help with yeast genetics and valuable discussions. We also acknowledge L. J. Zwiebel for reading the manuscript. Finally, we thank T. Grimm for construction of strain CEN.PK2 Dgpa2 Dras2. References 1. Kataoka, T., Powers, S., McGill, C., Fasano, O., Strathern, J., Broach,J.&Wigler,M.(1984)GeneticanalysisofyeastRAS1 and RAS2 genes. Cell 37, 437–445. 2. Rolland, F., De Winde, J.H., Lemaire, K., Boles, E., Thevelein, J.M. & Winderickx, J. (2000) Glucose-induced cAMP signalling in yeast requires both a G-protein coupled receptor system for extracellular glucose detection and a separable hexose kinase- dependent sensing process. Mol. Microbiol. 38, 348–358. 3. Harashima, T. & Heitman, J. (2002) The Galpha protein Gpa2 controls yeast differentiation by interacting with kelch repeat proteins that mimic Gbeta subunits. Mol. Cell 10, 163–173. 4. Batlle,M.,Lu,A.,Green,D.A.,Xue,Y.&Hirsch,J.P.(2003) Krh1p and Krh2p act downstream of the Gpa2p G (alpha) sub- unit to negatively regulate haploid invasive growth. J. Cell Sci. 116, 701–710. 5. Xue, Y., Batlle, M. & Hirsch, J.P. (1998) GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p Gal- pha subunit and functions in a Ras-independent pathway. EMBO J. 17, 1996–2007. 6. Toda, T., Cameron, S., Sass, P., Zoller, M. & Wigler, M. (1987) Three different genes in S.cerevisiaeencode the catalytic subunits of the cAMP-dependent protein kinase. Cell 50, 277–287. 7. Toda, T., Cameron, S., Sass, P., Zoller, M., Scott, J.D., McMul- len, B., Hurwitz, M., Krebs, E.G. & Wigler, M. (1987) Cloning and characterization of BCY1, a locus encoding a regulatory subunit of the cyclic AMP-dependent protein kinase in Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 1371–1377. 8. Thevelein, J.M. & de Winde, J.H. (1999) Novel sensing mechan- isms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 33, 904–918. 9. Mo ¨ sch, H.U., Roberts, R.L. & Fink, G.R. (1996) Ras2 signals via the Cdc42/Ste20/mitogen-activated protein kinase module to induce filamentous growth in Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA 93, 5352–5356. 10. Rupp, S., Summers, E., Lo, H.J., Madhani, H. & Fink, G. (1999) MAP kinase and cAMP filamentation signaling pathways con- verge on the unusually large promoter of the yeast FLO11 gene. EMBO J. 18, 1257–1269. 11. Ness, F., Bourot, S., Regnacq, M., Spagnoli, R., Berges, T. & Karst, F. (2001) SUT1 is a putative Zn[II]2Cys6-transcription factor whose upregulation enhances both sterol uptake and syn- thesis in aerobically growing Saccharomyces cerevisiae cells. Eur. J. Biochem. 268, 1585–1595. 12. Gu ¨ ldener, U., Heck, S., Fielder, T., Beinhauer, J. & Hegemann, J.H. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24, 2519–2524. 13. Gu ¨ ldener, U., Heinisch, J., Koehler, G.J., Voss, D. & Hegemann, J.H. (2002) A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res. 30, e23. 14. Mo ¨ sch, H.U., Ku ¨ bler, E., Krappmann, S., Fink, G.R. & Braus, G.H. (1999) Crosstalk between the Ras2p-controlled mitogen- activated protein kinase and cAMP pathways during invasive growth of Saccharomyces cerevisiae. Mol. Biol. Cell 10, 1325–1335. 15. Hermann, H., Ha ¨ cker, U., Bandlow, W. & Magdolen, V. (1992) pYLZ. vectors: Saccharomyces cerevisiae/Escherichia coli shuttle plasmids to analyze yeast promoters. Gene 119, 137–141. 16. Lillie, S.H. & Pringle, J.R. (1980) Reserve carbohydrate metabo- lism in Saccharomyces cerevisiae: responses to nutrient limitation. J. Bacteriol. 143, 1384–1394. 17. Schricker, R., Angermayr, M., Strobel, G., Klinke, S., Korber, D. & Bandlow, W. (2002) Redundant mitochondrial targeting signals in yeast adenylate kinase. J. Biol. Chem. 277, 28757–28764. 18. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. 19. Guarente, L. (1983) Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol. 101, 181–191. 20. Boeke, J.D., Trueheart, J., Natsoulis, G. & Fink, G.R. (1987) 5-Fluoroorotic acid as a selective agent in yeast molecular genetics. Methods Enzymol. 154, 164–175. 21. Colombo, S., Ma, P., Cauwenberg, L., Winderickx, J., Crauwels, M.,Teunissen,A.,Nauwelaers,D.,deWinde,J.H.,Gorwa,M.F., 1290 M. Ru ¨ tzler et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Colavizza, D. & Thevelein, J.M. (1998) Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acid- ification-induced cAMP signalling in the yeast Saccharomyces cerevisiae. EMBO J. 17, 3326–3341. 22. Toda, T., Uno, I., Ishikawa, T., Powers, S., Kataoka, T., Broek, D., Cameron, S., Broach, J., Matsumoto, K. & Wigler, M. (1985) In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell 40, 27–36. 23. Toda, T., Cameron, S., Sass, P. & Wigler, M. (1988) SCH9, a gene of Saccharomyces cerevisiae that encodes a protein distinct from, but functionally and structurally related to, cAMP-dependent protein kinase catalytic subunits. Genes Dev. 2, 517–527. 24. Gancedo, J.M. (2001) Control of pseudohyphae formation in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25, 107–123. 25. Vanhalewyn, M., Dumortier, F., Debast, G., Colombo, S., Ma, P., Winderickx, J., Van Dijck, P. & Thevelein, J.M. (1999) AmutationinSaccharomyces cerevisiae adenylate cyclase, Cyr1K1876M, specifically affects glucose- and acidification- induced cAMP signalling and not the basal cAMP level. Mol. Microbiol. 33, 363–376. 26. Stanhill, A., Schick, N. & Engelberg, D. (1999) The yeast ras/cyclic AMP pathway induces invasive growth by suppressing the cellular stress response. Mol. Cell. Biol. 19, 7529–7538. 27. Matsumoto, K., Uno, I. & Ishikawa, T. (1983) Initiation of meiosis in yeast mutants defective in adenylate cyclase and cyclic AMP-dependent protein kinase. Cell 32, 417–423. 28. ter Linde, J.J., Liang, H., Davis, R.W., Steensma, H.Y., van Dijken, J.P. & Pronk, J.T. (1999) Genome-wide transcriptional analysis of aerobic and anaerobic chemostat cultures of Saccharo- myces cerevisiae. J. Bacteriol. 181, 7409–7413. 29. Dimster-Denk,D.,Schafer,W.R.&Rine,J.(1995)Controlof RAS mRNA level by the mevalonate pathway. Mol. Biol. Cell 6, 59–70. 30. Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G.Y., Labouesse, M., Minvielle-Sebastia, L. & Lacroute, F. (1991) A family of low and high copy replicative, integrative and single-stranded S. cerevisiae/E. coli shuttle vectors. Yeast 7, 609–615. 31. Hill, J.E., Myers, A.M., Koerner, T.J. & Tzagoloff, A. (1986) Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2, 163–167. 32. Mumberg, D., Muller, R. & Funk, M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156, 119–122. Ó FEBS 2004 SUT2, a multicopy suppressor of low PKA activity (Eur. J. Biochem. 271) 1291 . 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢,. disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351 -SUT2 was constructed to contain SUT2 as the only