animal models for research and development of insect repellents for human use

Báo cáo sinh học: " Research Article Development of the Database for Environmental Sound Research and Application " pot

Ngày tải lên : 21/06/2014, 16:20

... Projected Users of the Database The structure and functionality of the database are driven by the users and their needs The expected users of this database are described below 3.1 Researchers ... evaluate, and make available a large collection of environmental sounds comprising multiple tokens (exemplars) of a wide variety of common sound sources The collection of sounds and development of the ... Furthermore users can specify multiple criteria on any of the ﬁelds (e.g., search for sound types “horse” and “train” in either mp3 or wav format), and the number of tokens returned for each criterion,...

12
352
0

Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf

Ngày tải lên : 22/06/2014, 06:20

... compression rate for video signal CBR and VBR stand for constant bit rate and variable bit rate, respectively SIF stands for source input format HalfD1 stands for video size of 352 × 480 pixels for one ... Cordova, P Boets, and L Van Biesen, “Analysis and applications of Wi-MAX standard: forecasting the trends” J Crouse, M D’alessandro, and F Lengerich, “WiMAX and the future of wireless technology,” ... pairs of encoders and decoders were used All encoders and decoders used in each system encode and decode MPEG-2 video and sound streams Figure 10(a) shows the encoder and decoder units we mainly used...

13
318
0

Báo cáo sinh học: "Inequality of maximum a posteriori estimators with equivalent sire and animal models for threshold traits" pps

Ngày tải lên : 09/08/2014, 18:22

... case of an animal model, making very restrictive supositions For continuously distributed traits, the use of an animal model is currently the state of the art for genetic evaluation of breeding animals ... continuously distributed traits the use of an animal model is the state of the art for the genetic evaluation of breeding animals A logical step would be to use an animal model as well to describe ... !i)/!! and or the 0’ error standard deviation (sire model) environmental standard deviation (animal model) For the heritability value of 0.20 the estimators from the sire model and the animal...

13
302
0

Báo cáo y học: "New animal models for evolution and development" pdf

Ngày tải lên : 14/08/2014, 14:21

... advantage of, or to make possible, its long germ-band mode of development Michalis Averof (Institute of Molecular Biology and Biotechnology (IMBB), Crete, Greece) presented an analysis of the posterior ... the growth zone and in posterior segmentation is ancestral for bilaterians (animals with bilateral symmetry, including both insects and vertebrates) Averof also reported work of Tassos Pavlopoulos ... long germ-band insect with simultaneous segment formation However, bicoid is a phylogenetically young gene that evolved late and only in flies It does not exist in other long-germ band insects,...

3
213
0

RESEARCH ON THE GROWTH AND DEVELOPMENT OF TARO VARIETIES AND CULTIVATION TECHNIQUES FOR THE POTENTIAL VARIETY IN YEN BAI PROVINCE

Ngày tải lên : 06/10/2014, 11:46

... titled "Research on the growth and development of taro varieties and cultivation techniques for the potential variety in Yen Bai province" 2 The purpose of study Through the activities of study and ... growth and development of some taro varieties on single-crop-land and lowland in Yen Bai province, finding out the most potential and suitable variety for the local; Identifying a number of cultivation ... (Control); CT 2: tons of manure; CT 3: 10 tons of manure; CT 4: 15 tons of manure; CT 5: 20 tons of manure; CT 6: 25 tons of manure - Norms and methods of monitoring: Monitoring of yield and yield components:...

27
552
0

Tài liệu 50 Software Tools for Speech Research and Development doc

Ngày tải lên : 27/01/2014, 03:20

... handled, and that complicated algorithms execute efficiently For teaching, on the other hand, these features are less important than simplicity, quick experimentation, and ease -of- use Because of ... compression formats in a variety of standard and specialized formats Sphere works well for sampled data files, but is limited for more general speech data files A general purpose, public-domain format ... a large number of CDs containing speech and linguistic data 50.12 Summary of Characteristics and Uses In Section 50.1, we mentioned that the three most common uses for speech software are teaching,...

13
412
0

Thermionics Quo Vadis? An Assessment of the DTRA’s Advanced Thermionics Research and Development Program pot

Ngày tải lên : 06/03/2014, 15:20

... understandable, because the goals of a thermionics research and development program not coincide with the stated mission of the DTRA Finding: The thermionics research and development effort does ... Design and proof of concept Russian research facilities Microminiature thermionic converter (MTC) Proof of performance and theory Low work function coating validation development device testing Sandia ... systems for both space and terrestrial applications • Recommend a prioritized set of objectives for a future research and development program for advanced thermionic systems for space and terrestrial...

85
418
0

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20

... conditions for the production of the I7 OR in yeast and used biochemical and immunological methods to estimate the levels of receptor expression and its cellular localization Results Yeast transformations ... threshold concentration of · 10)8 m, and maximal amplitude for · 10)6 m As in the case of I7 OR, this curve is bell shaped, and ﬁnely tuned for helional concentrations between · 10)5 m and · 10)7 m In ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40...

14
473
0

Báo cáo khoa học: " a Movie Dialogue Corpus for Research and Development" potx

Ngày tải lên : 07/03/2014, 18:20

... Sisters and All About Eve In the lower-left corner of the figure we can find movies with few dialogues and few turns, as for instance: 1492 Conquest of Paradise and The Cooler In the right side of ... of Benjamin Button and Jennifer’s Body Figure 5: Distribution of number of speakers per dialogue Finally, in Figure 6, we present a cross-plot between the number of dialogues and the number of ... number of dialogues and turns within each movie script 206 Conclusions and Future Work In this paper, we have described Movie-DiC a Movie Dialogue Corpus that has been collected for research and development...

5
424
0

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and speciﬁc substrate pdf

Ngày tải lên : 23/03/2014, 09:20

... conjugation of the quencher and the fluorophore influenced neither the rate nor the site of hydrolysis of the peptide Sensitivity and selectivity of the Dabcyl– EVYAVES–Edans substrate and the activity of ... sets of natural substrates, and make difficult the development of selective and sensitive substrates for measuring enzyme activity during infection To date, the best Substrate specificity of a ... the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity on the new substrate Results and Discussion Identification of...

11
424
0

Researching Design Learning: Issues and Findings from Two Decades of Research and Development pot

Ngày tải lên : 24/03/2014, 02:20

... reflect on and evaluate present and past design and technology, its uses and effects Through design and technology, all pupils can become discriminating and informed users of products, and become ... workshops, studios and classrooms This book tells the story of this research and of the issues and themes that have intertwined through the projects and formed the understandings that we now ... process of imaging and modelling is central to the development of capability and in stating this we wish to be clear about our use of the label capability and the difference between it and other...

340
234
0

REVIEW OF DOE’S VISION 21 RESEARCH AND DEVELOPMENT PROGRAM—PHASE I potx

Ngày tải lên : 29/03/2014, 13:20

... many of the proprietary models and databases developed and used by its contractors for process development and systems evaluation The committee recognizes that the development of an in-house capability ... promise and value of various projects and technologies from the perspective of Vision 21 It should develop the in-house ability to use credible engineering performance and cost models for all ... currently have access to all of the proprietary models and databases developed and used by its contractors for process development and systems evaluation Systems integration and engineering analysis...

108
296
0

báo cáo hóa học:" Quality of data collection in a large HIV observational clinic database in sub-Saharan Africa: implications for clinical research and audit of care" docx

Ngày tải lên : 20/06/2014, 08:20

... missing and incorrect items) of 67% for OIs, 52% for ART-related toxicities, and 83% and 58% for ART discontinuation Page of and modification, respectively Nineteen of the 559 patients in the research ... database was 124 (55%) and 27 (12%) of 127 OIs identified; 220 (49%) and 15 (3%) of 453 toxicities, and 18 (51%) and 11 (32%) of the 86 cited reasons for ART discontinuation and modification This ... implications for the use and interpretation of data derived from routine HIV observational databases for research and audit, and they highlight the need for ongoing regular validation of key data items...

7
455
0

Báo cáo hóa học: "Research Article Development of a Testbed for Wireless Underground Sensor Networks" ppt

Ngày tải lên : 21/06/2014, 23:20

... without any loss of accuracy Naturally, the value for d0 will vary for diﬀerent models of sensor nodes and their antennas Moreover, the use of multiple receivers will improve the quality of the results ... be performed The rest of this section is composed of the presentation and the analysis of the results of WUSN experiments These results are presented as examples of the successful use of the ... challenges of burying and unburying sensor nodes are presented, and the use of paper and plastic pipes is described in Section 3.1 The analysis of the soil texture and soil moisture of the WUSN testbed...

14
248
0