an example of serialization in which you need to store objects that are linked by a circuitous route

An Account of the Diseases which were most frequent in the British military hospitals in Germany pptx

An Account of the Diseases which were most frequent in the British military hospitals in Germany pptx

Ngày tải lên : 06/03/2014, 20:20
... in Bilanders 353, 2, for the least Appearance of the Malignant Fever, read the Malignant Fever appearing OF THE MALIGNANT and PETECHIAL FEVER A Malignant Fever, and Fluxes, began to appear among ... drink In the Malignant Fever at Paderborn, many complained of a Dysuria, and some of a Suppression of Urine, especially towards the Decline of the Fever; and others, of a Scalding and Pain in ... lauri, and Half a Drachm of the tinctura thebaica; a Scruple of Castor, and Half a Drachm of Spirit of Lavender, to be added to each of his Draughts; and a Blister to be prepared, in case these...
  • 119
  • 401
  • 0
Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt

Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt

Ngày tải lên : 21/06/2014, 06:20
... analysis of semi-volatile pollutants by means of gas chromatography-mass spectrometry operating in scan an SIM mode, in conjunction with appropriate data analysis applications and chemometric tools ... groups - AQUATOX (supervised by Dr Ludek Blaha and Dr Klara Hilschlerova) and SOILTOX (supervised by Dr Jakub Hofman) - was to get know-how in several aquatic and terrestrial acute and chronic toxicity ... subsessions, (a) legislative aspect; (b) emerging substances and nanomaterials: analyses, environmental fate, effects, ERA; and (c) incorporating omic information into risk assessment and policy) and (2)...
  • 9
  • 374
  • 0
Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)

Structuring an advertising business in Vietnam (an example of FPT media - the corporation for financing and promoting technology)

Ngày tải lên : 26/03/2015, 08:55
... conducting research, promoting and managing special events, and managing crises As companies adopt an IMC approach to promotional planning, they are coordinating their PR activities with advertising ... level decrease, as does their area of responsibility A flat of organization has fewer managers and hierarchical levels than a tall organization, so a flat organization’s managers possess relatively ... changing needs or contingencies become important Designing a structure that fit a company’s need is a large challenge Each structure has advantages and disadvantages, and managers have to be ready...
  • 104
  • 1.5K
  • 2
An example of table content

An example of table content

Ngày tải lên : 15/10/2013, 03:11
... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...
  • 2
  • 347
  • 0
An analysis of modality in some commentaries on global financial crisis 2008   2009

An analysis of modality in some commentaries on global financial crisis 2008 2009

Ngày tải lên : 18/12/2013, 10:07
... on modal auxiliaries and four word classes carrying modal meanings as main means to express modality in data analyzed 22 CHAPTER 2: AN ANALYSIS OF MODALITY IN SOME COMMENTARIES ON GLOBAL CRISIS ... p.117) modality or interpersonal meaning is one of four meanings of sentences: structural meaning, representational meaning, interpersonal meaning and textual meaning 1.3.1 Definition of Modality ... Kenneth Rogoff The statistics of the data analyzed are also stated Chapter 3: Some Applications of Modality in English Teaching and Learning Some applications for English teaching and learning are the...
  • 79
  • 403
  • 4
An analysis of modality in some speeches of the president obama = phân tích tính hình thái trong một số bài phát biểu của tổng thống obama luận văn tốt nghiệp đại học

An analysis of modality in some speeches of the president obama = phân tích tính hình thái trong một số bài phát biểu của tổng thống obama luận văn tốt nghiệp đại học

Ngày tải lên : 18/12/2013, 10:08
... it Language conveys meaning One of the dominant meaning of language is modal meaning Modality is one of basic meaning type of language considered as means of communication Behind a word, a sentece ... there are many different ways of understanding and defining modality Many researchers are interested in studying modality One of the authors who are interested in defining modality is V Vinogradov ... language and spoken language, those distinctions are not absolute and the characteristics that we tend to associate with written language can sometimes occur in spoken language and vice versa.This...
  • 78
  • 848
  • 5
Tài liệu An Example of Using the Get* Methods phần 1 pdf

Tài liệu An Example of Using the Get* Methods phần 1 pdf

Ngày tải lên : 24/12/2013, 01:17
... productsSqlDataReader.GetOrdinal("UnitsInStock"); int discontinuedColPos = productsSqlDataReader.GetOrdinal("Discontinued"); // use the GetFieldType() method of the DataReader object // to obtain the ... int type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID ... productsSqlDataReader.GetDataTypeName(productNameColPos)); Console.WriteLine("UnitPrice database type = " + productsSqlDataReader.GetDataTypeName(unitPriceColPos)); Console.WriteLine("UnitsInStock database...
  • 6
  • 594
  • 0
Tài liệu An Example of Using the Get* Methods phần 2 docx

Tài liệu An Example of Using the Get* Methods phần 2 docx

Ngày tải lên : 24/12/2013, 01:17
... Discontinued bit GetSqlBoolean() SqlBoolean Let's assume that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table ... SqlString GetSqlString() binary SqlBinary GetSqlBinary() varbinary SqlBinary GetSqlBinary() image SqlBinary GetSqlBinary() sql_varient object GetSqlValue() timestamp SqlBinary GetSqlBinary() ... earlier For example, the ProductID column is a SQL Server int, and looking up that type in Table 9.7, you can see you use the GetSqlInt32() method to obtain the column value as a C# SqlInt32 Table 9.8...
  • 6
  • 471
  • 0
Tài liệu An Example of Communal Currency pdf

Tài liệu An Example of Communal Currency pdf

Ngày tải lên : 17/02/2014, 19:20
... being abandoned to individual bankers or joint stock companies, to the great financial loss of the community as a whole; and (b) of the whole business of banking which means the organising of ... surplus as shall remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not ... Isle of Sark and other purposes After asking Nicolas Maingy, Jean Lukis and Daniel de Lisle "to sign the said Notes in the name and under the guarantee of the States," it goes on to say, "and in...
  • 37
  • 485
  • 0
C# in Depth: What you need to master C# 2 and 3 pptx

C# in Depth: What you need to master C# 2 and 3 pptx

Ngày tải lên : 14/03/2014, 20:20
... programming book two hundred years later The collection was purchased by a Manning editor at an antiquarian flea market in the “Garage” on West 26th Street in Manhattan The seller was an American ... the fastest-moving areas of that change Computing in particular seems to push itself constantly, both in hardware and in software Although many older computer languages are like bedrocks, rarely ... three parts and a single appendix The first part serves as an introduction, including a refresher on topics in C#1 that are important for understanding C#2 and 3, and that are often misunderstood...
  • 424
  • 5.8K
  • 1
Blood Cell – An Overview of Studies in Hematology pptx

Blood Cell – An Overview of Studies in Hematology pptx

Ngày tải lên : 16/03/2014, 21:20
... on anticoagulant RBC and plasma are then separated in different tubes Plasma is used as a ligand in immune-affinity chromatography to separate hemolysate antigens that can bind to plasma antibodies ... Cristiana, Zamosteanu Nina, Albu Elena, Ambreen Shaikh, Deepa Bhartiya, Moneer Faraj, Nihaya Salem, Junko Takahashi, Akiko Takatsu, Masaki Misawa, Hitoshi Iwahashi, Osamu Hayashi, Karen A Selz, ... biological barriers and can cause disease in animals but not in humans and vice versa [15] The role of RBC antigens transport in inducing tolerance to self-antigens is a feature that can be considered...
  • 360
  • 622
  • 1
What You Need To Know About - Cancer of the Pancreas docx

What You Need To Know About - Cancer of the Pancreas docx

Ngày tải lên : 22/03/2014, 16:21
... pancreatic cancer increases the risk of developing the disease • Inflammation of the pancreas: Pancreatitis is a painful inflammation of the pancreas Having pancreatitis for a long time may increase ... Learning that you have cancer of the pancreas can change your life and the lives of those close to you These changes can be hard to handle It’s normal for you, your family, and your friends to ... suggest ways to relieve or reduce pain You may want to ask if your hospital has a palliative care team There are many ways to relieve or reduce pain: • Pain medicine: Your health care team can suggest...
  • 48
  • 438
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20
... change of Val to Phe may result in a better interaction in terms of an increased contact area Changes at CDRs and in clone 61 0A had a synergistic effect on the affinity constant leading to a 176-fold ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC ... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC...
  • 11
  • 679
  • 0
What You Need To Know About - Cancer of the Esophagus ppt

What You Need To Know About - Cancer of the Esophagus ppt

Ngày tải lên : 28/03/2014, 23:20
... body that contains the pancreas, stomach, intestines, liver, gallbladder, and other organs Adenocarcinoma (A- den-oh-KAR-sih-NOH-muh): Cancer that begins in cells that line certain internal organs ... oncologists Your health care team may also include an oncology nurse and a registered dietitian If your airways are affected by the cancer, you may have a respiratory therapist as part of your team If you ... page for information about esophageal cancer that has spread Types of Esophageal Cancer There are two main types of esophageal cancer Both types are diagnosed, treated, and managed in similar...
  • 51
  • 464
  • 0
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx

Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx

Ngày tải lên : 29/03/2014, 09:20
... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow [11] ... synthesis and kinetic studies of a bicyclic and bifunctional proteinase peptidic inhibitor consisting of 16 amino acids The inhibitor was designed by combining two binding loops of BBI As postulated by ... (Ka) of SFTI-1 analogues based on the double-sequence of SFTI-1 Ch and T in parenthesis indicate that the inhibitory activity was determined after preincubation of the inhibitor with bovine a- chymotrypsin...
  • 9
  • 307
  • 0
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Ngày tải lên : 30/03/2014, 16:20
... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... and warm subsurface waters, which are crucial for ice shelf breakup Reducing their buttressing effect induces a large iceberg discharge and an ice-stream acceleration that tranlates into up to ... weak Atlantic overturning and NADW south of Iceland, similar to a stadial period The assumption under which the ocean needs to shift into a stadial condition as a precursor for triggering Heinrich...
  • 10
  • 566
  • 0
the stonehenge people an exploration of life in neolithic britain, 4700-2000 bc

the stonehenge people an exploration of life in neolithic britain, 4700-2000 bc

Ngày tải lên : 31/05/2014, 02:00
... farmstead at Bishopstone in Sussex was sustained in 3220 BC by cereal farming and later by pastoral farming The increasing area under pasture does not mean that the area under arable was declining; ... Midlands too Far from remaining a huge and intractable expanse of continuous oak-alder forest, the Midlands had a substantial farming population exploiting the easily managed and fertile soils of the ... population levels rising and areas of unproductive raised bog and leached heathland increasing, farmers tended to focus on specific areas of farmland to which they applied more careful management...
  • 297
  • 406
  • 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx

báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx

Ngày tải lên : 18/06/2014, 22:20
... Exploratory Factor Analysis Data were initially examined through Exploratory Factor Analysis (Principal Component Analysis with Varimax Rotation) Extraction strategy included selecting factors ... item and subscale correlations and internal reliability No missing values were found in any of the 44 items in the Brazilian sample The analysis of the pooled international data indicated the need ... cross-cultural measures In conclusion, the Brazilian version of the AAQ instrument is a reliable, valid and consistent tool to assess attitudes to aging and can be applied in international cross-cultural...
  • 10
  • 871
  • 0

Xem thêm