a speculated mechanism of dhea by which this agent exerts its protective role in oa

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Ngày tải lên : 16/03/2014, 06:20
... GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated ... hRhoA )799 hRhoA +166 hRhoB sense hRhoB antisense hRhoA sense hRhoA antisense GAPDH-F GAPDH-R Sequence (5¢- to 3¢) GGGATCAGAGTTCATAGTGAAAAGAG GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTC GCGGGTACCAATGTGATGGGTGGACTGGT ... total actin ratio in each condition These data are representative of three independent experiments Sample G ⁄ total actin ratio Standard error ad-LacZ ad-LacZ + TGFb1 ad-Smad2 ad-Smad2 + TGFb1 ad-Smad3...
  • 14
  • 420
  • 0
Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Ngày tải lên : 24/03/2014, 03:21
... lM, and NFAT binding was abolished in the presence of 1.0 lM all-trans-RA In contrast, SP-1 binding was similar at all concentrations of all-trans-RA tested All-trans-RA blocks NFAT translocation ... inhibits the DNA binding activity of NFAT To understand the molecular mechanism of RA-induced inhibition of NFAT activity, we investigated whether the DNA-binding activity of NFAT was changed by ... pTK-luc, which contains a minimal promoter of thymidine kinase, was also used in the transfection assay mutated NFAT sequence These results indicated that alltrans-RA repressed the FasL promoter, mainly...
  • 9
  • 481
  • 0
Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Tài liệu Báo cáo khoa học: Hypoxic resistance to articular chondrocyte apoptosis – a possible mechanism of maintaining homeostasis of normal articular cartilage pdf

Ngày tải lên : 18/02/2014, 14:20
... radiographic examination of the articular cartilage after experimentally induced OA Articular cartilage of the femoral condyles from the experimental joints was examined to assess any macroscopic damage ... inhibits articular chondrocyte death A A B B Fig Evaluation of articular cartilage after experimentally induced osteoarthritis (A) Photomicrographs of articular cartilage (B) The evaluation of ... normal sample was calculated using Student’s t-test OA, osteoarthritis sample; Ubi, ubiquitin degradation in canine chondrocytes, proteasome activity was assayed in cell lysates as a measure of...
  • 11
  • 461
  • 0
Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

Tài liệu Báo cáo Y học: Tissue factor pathway inhibitor A possible mechanism of action doc

Ngày tải lên : 22/02/2014, 04:20
... factor X activation in the absence of factor Xa at the initiation point of the reaction Yet this mechanism based on the hypothesis of the interaction between TFPI and Xa–VIIa–TF cannot explain ... ;VIIaÀTF M k X ;VIIaÀTF cat VIIaÀTF ;Xa ka k XaÀVIIaÀTF d k Xa;TFPI a k XaÀTFPI d k XaÀTFPI;VIIaÀTF a k XaÀTFPI;VIIaÀTF d Value (experimental) No data No data 238 nM 420 min)1 No data No data 0.054 ... product factor Xa TFPI has three Kunitztype domains The first domain binds to and inhibits factor VIIa, the second inhibits factor Xa Inhibition of VIIa can proceed only after preliminary Xa binding...
  • 16
  • 415
  • 0
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc

Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc

Ngày tải lên : 05/03/2014, 23:20
... addition of zinc to enzyme alone causes a small increase in thermal stability which when glutamate is present is largely negated by the small increase in stability caused by glutamate Norvaline, to a ... with alternative amino acid substrates GDH from mammalian sources is highly regulated by a diverse array of small molecules, with ADP, GTP, leucine and the combination of malate and palmitoyl CoA ... is clearly not due to a lack of zinc binding, again supporting the concept that zinc inhibits by interfering with cooperative interactions in the enzyme that are not supported by norvaline The...
  • 12
  • 544
  • 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Ngày tải lên : 07/03/2014, 05:20
... hypophosphatasia, (b) infantile hypophosphatasia, (c) childhood hypophosphatasia, (d) adult hypophosphatasia and (e) odonto hypophosphatasia [1–4] Perinatal and infantile forms of hypophosphatasia are ... (Hilden, Germany); antipain, chymostatin, elastatinal, leupeptin and pepstatin A were obtained from Protein Research Foundation (Osaka, Japan); and hygromycin B and (p-amidinophenyl) methanesulfonylfluoride ... Cai G, Michigami T, Yamamoto T, Yasui N, Stomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada S et al (1998) Analysis of localization of mutated tissue-nonspecific alkaline phosphatase...
  • 11
  • 500
  • 0
A SIMPLE EXPLANATION OF MONEY By Isuru Abeysinghe potx

A SIMPLE EXPLANATION OF MONEY By Isuru Abeysinghe potx

Ngày tải lên : 27/06/2014, 23:20
... only as valuable as the quantity and quality of the goods and services that are available in exchange for it Having a lot of money, a quantity of money with a lot of zeros behind it, does not intrinsically ... have a half-chicken and an apple, Jane would have an axe and a half-chicken and Peter would have an axe and a cup It’s getting complicated – and there are only three people involved! Additionally, ... that, nobody will trade today, because between Adam and Jane (and also between Jane and Peter) there are no items of barter that each party is happy with Now, we are all thinking the same thing:...
  • 4
  • 227
  • 0
Báo cáo y học: "Apolipoprotein A-I infiltration in rheumatoid arthritis synovial tissue: a control mechanism of cytokine production" pot

Báo cáo y học: "Apolipoprotein A-I infiltration in rheumatoid arthritis synovial tissue: a control mechanism of cytokine production" pot

Ngày tải lên : 09/08/2014, 01:24
... exacerbation The alterations in apoA-I infiltration may also explain fluctuations of disease activity The finding that apoA-I can infiltrate inflamed tissue, together with its newly emerging anti-inflammatory ... with disease activity The observation that apoA-I can infiltrate and be retained at the inflammatory site suggests that apoA-I may inhibit the local triggering of IL-1β and TNF-α release by monocyte–macrophages ... cells This mechanism may have a role in regulating monocyte activation in the bloodstream [5] This study demonstrated that apoA-I infiltrated perivascular regions of the synovium where A- SAA, which...
  • 4
  • 290
  • 0
Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx

Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx

Ngày tải lên : 12/08/2014, 23:22
... et Tat2:1→) TatXbaI rev 5' TAATAATTCTAGAAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3 reverse for Tat1:← 1718 and for Tat2:← 1770) (111)NcoI rev 5' TATATACCATGGGGCACACACTACTTTGAGCACTCAAGG 3' (exon1:reverse:← ... TATAATAGAATTCATGGAGCCAGTAGATCCTAGACTAGAG 3' (exon2: sense for Tat1:343 → and for Tat2:396 →) TatNcoI sense 5' TAATATACCATGGGGTCTCTCTGGTTAGACCAGATC 3' (exon1: sense for Tat1 and for Tat2:1→) TatSmaI ... TatSmaI rev 5' TATATACCCGGGAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3: reverse for Tat1:← 1718 and for Tat2:← 1770) TatXbaI sense 5' ATATATTCTAGAGGTCTCTCTGGTTAGACCAGATC 3' (exon 1:for Tat1 et Tat2:1→)...
  • 18
  • 240
  • 0
Báo cáo y học: "Platelet-derived exosomes induce endothelial cell apoptosis through peroxynitrite generation: experimental evidence for a novel mechanism of septic vascular dysfunction" pot

Báo cáo y học: "Platelet-derived exosomes induce endothelial cell apoptosis through peroxynitrite generation: experimental evidence for a novel mechanism of septic vascular dysfunction" pot

Ngày tải lên : 13/08/2014, 08:20
... microparticles could activate intracellular signaling pathways such as ERK and Akt, inducing angiogenesis and metastasis in lung cancer and promoting the survival and proliferation of normal human ... is a cytokine released in the early phases of the septic response and is believed to have a central role in its initial steps, promoting the further release of other inflammatory and anti-inflammatory ... anti-inflammatory cytokines and altering the vascular wall, leading to increased endothelial stickiness and permeability [22] It is also well known that part of the vascular dysfunction arising during...
  • 12
  • 290
  • 0
A contrastive analysis of apologizing by english and vietnamese speakers

A contrastive analysis of apologizing by english and vietnamese speakers

Ngày tải lên : 17/07/2015, 10:56
... offended want to offer an apology, it means they express their goal of humiliating the partner In this situation, an apology is regarded as a face-threatening act for the speaker and a face-saving act ... ‗face‘ was introduced by Brown and Levinson with the purpose of illustrating ‗politeness‘ in the broad sense During interactions, the interactants are interested in maintaining two states of ‗face‘: ... noises of certain types belonging to and as belonging to a certain vocabulary, in a certain grammar, with certain intonation‖ The rhetic act generally performs ―the act of using those vocables...
  • 84
  • 930
  • 7
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Ngày tải lên : 15/02/2014, 01:20
... cellular location For all these reasons we wanted to develop an in vivo system to investigate its role by making use of the generation and characterization of an unmarked deletion in nirF The unmarked ... structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also ... to seek accumulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily detectable amounts of an intermediate of d1 synthesis...
  • 12
  • 613
  • 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

Ngày tải lên : 05/03/2014, 12:20
... convey rather strong feelings of approval, disapproval or surprise In terms of functions of intonation in English, there are four main functions namely attitudinal, grammatical, accentual and discourse ... speak a foreign language are almost always carry-overs from their native languages Through a comparison of the intonation of Vietnamese with that of English, an EFL instructor can anticipate ... conversation T 2.2 Vietnamese tones Vietnamese is a tonal language in which changes of the pitch level and/or contour signal a change in meaning The nature of tone in Vietnamese has been a subject of...
  • 10
  • 2K
  • 17
Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Báo cáo khoa học: Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference pptx

Ngày tải lên : 23/03/2014, 07:20
... TAGGGAGAAACATCCTGGACAGCAAATGCAGGG-3¢) and reverse primer (5¢-CCGGCATTGAGGATGCTGAT3¢) for the sense-strand template, the other with forward primer matGIHF (5¢-AACATCCTGGACAGCAAATGCA GGG-3¢) and ... TCGTATAAAAGGTCTGCG-3¢) and GIHR (5¢-GGTCG ACTTTATTTTAACGGAAAATTAAT-3¢) primers in a 25 lL reaction containing 1· Phusion HF buffer including 1.5 mm MgCl2, 500 nm of each primer, 200 lm each of dATP, ... eyestalk ganglia and abdominal nerve cords as early as h after incubating with GIH-dsRNA This silencing was not affected by irrelevant dsRNA, thus indicating that Pem-GIH knockdown occurred in a...
  • 11
  • 369
  • 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx

báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx

Ngày tải lên : 18/06/2014, 15:20
... CAGCCCCAGCA T .TATGGCTACACC .CAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGXX X .CAGCCCCAGXX X .CAGCCCCAGCA T TTCACCCCT CCAC TCAGCCCCAGXX X TCAGCCCCAGXX X TCAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGCA ... GCCAGCAGT G T .ACAGGGG CTCGG D/b GCCAGTAGTAT GACAGGG CTAGGG AGTGC GCCCGAT .ACAGGG CTTGGC GCCAGCAG ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT CAGGG ATTGGG 16 GCCAGCA ... selective use of certain TRBJ and TRBV segments, indicates an important role of the TRB chain in fine-tuning TR affinity of Melan -A- specific T cells of melanoma patients and argues against the hypothesis...
  • 14
  • 532
  • 1
Báo cáo sinh học: " Downregulation of APOBEC3G by Xenotropic Murine Leukemia-Virus Related Virus (XMRV) in Prostate Cancer Cells docx

Báo cáo sinh học: " Downregulation of APOBEC3G by Xenotropic Murine Leukemia-Virus Related Virus (XMRV) in Prostate Cancer Cells docx

Ngày tải lên : 18/06/2014, 18:20
... analysis We detected A3 G in LNCaP and DU145 cells (Figure 1A) using a polyclonal antibody (antiApoC29) raised against the 29 amino acid (aa) of the C-terminal end of A3 G protein (NIH AIDS Reagent ... that A3 B, A3 D and A3 F have molecular weights similar to A3 G However, the molecular weights of A3 A, A3 C and A3 H (~23 kDa) are substantially lower than A3 G and detection of A3 A /A3 C /A3 H in the A3 G ... Program AntiApoC17 was raised against a synthetic peptide comprising of the 17 C-terminal residues of A3 G (Cat No 10082), while the other was (Anti-ApoC29) Anti -A3 G C-terminal antisera raised against...
  • 12
  • 367
  • 0
Báo cáo sinh học: "A case study of the College English Test and ethnic minority university students in China: negotiating the final hurdle" pptx

Báo cáo sinh học: "A case study of the College English Test and ethnic minority university students in China: negotiating the final hurdle" pptx

Ngày tải lên : 18/06/2014, 18:20
... instruction as well as the lingua franca for social interaction (Adamson & Feng 2009) English is taught from Primary as a means to facilitate the international economic modernization of China The linguistic ... status of English, its embedding in many facets of society in China, and the use of benchmarks such as the CET for assuring the desirable attributes of graduates all constrain the flexibility of ... School of Foreign Languages for International Business at the Shanghai Institute of Foreign Trade, and a doctoral student in the Faculty of Languages at Hong Kong Institute of Education Her research...
  • 11
  • 649
  • 0
Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc

Báo cáo hóa học: " A validation study using a modified version of Postural Assessment Scale for Stroke Patients: Postural Stroke Study in Gothenburg (POSTGOT)" doc

Ngày tải lên : 19/06/2014, 08:20
... SwePASS in the acute stage Page of after stroke, both in clinical and research settings In addition, the SwePASS was easy to apply and fast to administer in clinic Additional material Additional file ... PASS validation should be performed with a statistical analysis aimed for calculations of non-parametric data, besides traditional statistical methods As far as we know, newer statistical analysis ... (agreements/(agreements + disagreements)) * 100 = P% [15] PA measures exact agreement (diagonal) Additionally, due to this fact and to the ordinal nature of data, the rank-invariant method for inter-scale...
  • 8
  • 408
  • 0

Xem thêm