Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases Lina Vardouli 1 , Eleftheria Vasilaki 1,2 , Elsa Papadimitriou 1 , Dimitris Kardassis 1,2 and Christos Stournaras 1 1 Department of Biochemistry, School of Medicine, University of Crete, Heraklion, Greece 2 Institute of Molecular Biology and Biotechnology, Foundation for Research & Technology-Hellas, Heraklion, Greece It is well established that reorganization of the actin cytoskeleton is one of the earliest cellular responses to various extracellular stimuli [1–5]. Binding of ligands to the appropriate receptors triggers specific signaling cascades, which may generate rapid and long-term modifications of actin polymerization dynamics and microfilament organization [6–9]. Transforming growth factor b (TGFb) is a pleiotropic cytokine that regulates homeostasis in various cell types such as epithelial and endothelial cells, and regulates other cell functions such as growth, differentiation and apoptosis [10–12]. In addition, TGFb influences epithe- lial–mesenchymal transitions, events critical for normal embryogenesis and also for tumorigenesis, tumor-cell invasiveness and metastasis [13–15]. The classical TGFb signaling apparatus consists of a plasma membrane complex of type I (TbRI) and type II (TbRII) receptors and downstream Smad signaling effectors [16]. Activa- tion of TbRI by TGFb leads to phosphorylation of the receptor-regulated Smad proteins (R-Smad proteins) Smad2 and Smad3, which in turn oligomerize with the common partner Smad4 and rapidly translocate to the Keywords actin; Rho GTPases; Smad; TGFb; a-SMA Correspondence C. Stournaras, Department of Biochemistry, School of Medicine, University of Crete, GR-71110 Heraklion, Greece Fax: +30 2810 394530 Tel: +30 2810 394563 E-mail: cstourn@med.uoc.gr (Received 22 April 2008, revised 1 June 2008, accepted 12 June 2008) doi:10.1111/j.1742-4658.2008.06549.x In previous studies, we have demonstrated that RhoA ⁄ B-dependent signal- ing regulates TGFb-induced rapid actin reorganization in Swiss 3T3 fibro- blasts. Here we report that TGFb regulates long-term actin remodeling by increasing the steady-state mRNA levels of the RhoB gene in mouse Swiss 3T3 fibroblasts and human hepatoma HepG2 cells. We show that this regu- lation is specific for the RhoB gene and is facilitated by enhanced activity of the RhoB promoter. Adenovirus-mediated gene transfer of Smad2 and Smad3 in Swiss 3T3 fibroblasts induced transcription of the endogenous RhoB gene but not the RhoA gene. Interestingly, in JEG-3 choriocarcinoma cells that lack endogenous Smad3, TGFb-induced transcriptional up-regu- lation of the RhoB gene was not observed, but it was restored by adeno- viral Smad3 overexpression. In addition, Smad2 and Smad3 triggered activation of RhoA and RhoB GTPases and long-term actin reorganization in Swiss 3T3 fibroblasts. Finally, Smad3, and to a lesser extent Smad2, induced transcription of the a-smooth muscle actin (a-SMA) gene, and enhanced the incorporation of a-SMA into microfilaments in Swiss 3T3 fibroblasts. These data reveal a novel mechanism of cross-talk between the classical TGFb ⁄ Smad pathway and Rho GTPases, regulating the rapid and the long-term actin reorganization that may control the fibroblast– myofibroblast differentiation program. Abbreviations ALK5, activin like kinase 5; ca, constitutively active; FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GEF, guanine nucleotide exchange factor; GST, glutathione S-transferase; luc, luciferase; RBD, Rho binding domain; RT-PCR, reverse transcription-polymerase chain reaction; SBE, Smad binding element; a-SMA, a-smooth muscle actin; TbRI, TGFb receptor type I; TGFb, transforming growth factor b; TI, Triton X-100 insoluble; TS, Triton X-100 soluble. 4074 FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS nucleus where they bind to promoters and regulate the expression of various target genes in a positive or a negative manner [16]. This pathway is negatively regu- lated by multiple signaling inputs. The best understood is a feedback loop that involves Smad7, an inhibitory Smad, which blocks R-Smad phosphorylation by TbRI and directs lysosomal degradation of the receptor, thus ensuring termination of the pathway [17,18]. Further- more, TGFb was shown to modulate cell morphology and growth in a concerted manner via mechanisms that control the actin cytoskeleton in a variety of cell types [19–22]. In Swiss 3T3 fibroblasts, TGF b has been shown to induce rapid actin polymerization and formation of stress fibers via a non-genomic RhoA ⁄ B ⁄ ROCK ⁄ Limk2 ⁄ cofilin signaling cascade downstream of TbRI [23]. Similarly, in other studies, it has been reported that RhoA signaling is activated early follow- ing TGFb treatment in smooth muscle cells [24], while RhoA and Rac1 are regulated by TGFb during aortic endothelial morphogenesis [25]. However, the mecha- nisms controlling the cross-talk between the classical TGFb ⁄ Smad pathways, regulation of Rho GTPases and long-term actin cytoskeleton reorganization have not been addressed so far. In the present work, we focus on the regulatory role of the TGFb ⁄ Smad pathway in the activation and ⁄ or transcriptional regulation of the Rho GTPases and long-term actin cytoskeleton restructuring. Using vari- ous cell models, we analyzed the TGFb-induced tran- scriptional regulation of the RhoA ⁄ B GTPases. Using adenoviral overexpression of Smad2 ⁄ 3, we studied the role of Smad proteins in regulation of the RhoA ⁄ B genes, activation of these small GTPases and the induction of actin reorganization. Finally, to address the biological significance of the TGFb-induced actin reorganization, we assessed the Smad-induced tran- scriptional regulation of a-SMA, and its expression and incorporation into the microfilamentous network of fibroblasts. Our results provide evidence for a novel signaling mechanism in TGFb-induced actin cytoskele- ton reorganization mediated by Smad proteins and Rho GTPases that may regulate fibroblast–myofibro- blast differentiation. Results TGFb1 induces transcription of the gene coding for the small GTPase RhoB in Swiss 3T3 fibroblasts and hepatoma HepG2 cells We have shown previously that TGFb induces rapid and sustained activation of the small GTPases RhoA and RhoB, and that this activation is essential for TGFb-induced actin cytoskeleton reorganization in fibroblasts [23]. In the present study, we sought to examine whether TGFb, in addition to inducing Rho protein activation, regulates the expression of these two Rho GTPases. First, we investigated the requirement for active gene transcription in TGFb-induced actin cytoskeleton poly- merization. For this purpose, Swiss 3T3 fibroblasts were treated with TGFb for 24 h in the absence or presence of the general inhibitor of transcription actinomycin D, and changes in the actin cytoskeleton were monitored by fluorescence using rhodamine phalloidin staining. As shown in Fig. 1A, TGFb caused potent actin cytoskele- ton reorganization as evidenced by the formation of stress fibers. Importantly, long-term TGFb-induced cytoskeleton reorganization was abolished in the pres- ence of actinomycin D, suggesting that, in addition to short-term activation events, TGFb elicits long-term actin cytoskeleton regulation requiring transcriptional induction of TGFb target genes (Fig. 1A). We then examined the effect of the TGFb signaling pathway in transcriptional regulation of the genes coding for the human Rho GTPases A and B by two different approaches: measuring the mRNA levels and measuring the activity of the promoters of the two genes in response to TGFb stimulation. First, we determined the effect of TGFb on the mRNA levels of the RhoA and RhoB genes in Swiss 3T3 fibroblasts by RT-PCR experiments. For this purpose, Swiss 3T3 cells were serum-starved for 24 h and then stimulated with 5 ngÆmL )1 TGFb1 for various time periods (from 30 min up to a maximum of 24 h). As shown in Fig. 1B, treatment of Swiss 3T3 cells with TGFb1 resulted in a rapid increase (1.6-2.2-fold) in the steady- state mRNA levels of the RhoB gene, which was initiated at 30 min and persisted for a period of 24 h post-induction (top panel). In contrast, transcriptional activation of the RhoA gene by TGFb1 was not observed (Fig. 1B, middle panel). As expected, TGFb did not affect the mRNA levels of the glyceraldehyde- 3-phosphate dehydrogenase (GAPDH) gene used as a control (Fig. 1B, bottom panel). In a similar manner, we showed that TGFb induces transcription of the RhoB gene but not the RhoA gene in human hepatoma HepG2 cells. In this experiment, HepG2 cells were serum-starved for 24 h, treated with TGFb1(5ngÆmL )1 ) for various time periods (from 1 h up to a maximum of 24 h), and then subjected to RT-PCR analysis for determination of the RhoB and RhoA mRNA levels. As shown in Fig. 1C (top panel), treatment of HepG2 cells with TGFb1 resulted in rapid transcriptional activation of the RhoB gene. The induc- tion of transcription started at 1 h of treatment with L. Vardouli et al. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS 4075 TGFb1, reached a maximum (2.6-fold) at 2 h, and declined thereafter (1.4-fold activation at 24 h). In agreement with the findings in Swiss 3T3 fibroblasts, no transcriptional activation of the RhoA gene by TGFb1 was observed in HepG2 cells (Fig. 1C, middle panel). Overexpression of the Smad3 protein via adenovirus-mediated gene transfer induced transcription of the human RhoB gene By using recombinant adenoviruses expressing Smad2 and Smad3 proteins, we investigated the role of Smad proteins in TGFb-induced transcriptional activation of the RhoA and RhoB genes. For this purpose, Swiss 3T3 cells were infected with recombinant adenoviruses expressing Smad2 (ad-Smad), Smad3 (ad-Smad3) or a control adenovirus expressing the b-galactosidase gene (ad-LacZ), and were treated with TGFb1(5ngÆmL )1 ) for 2 h or left untreated. RT-PCR analysis revealed that overexpression of Smad3 caused a significant increase in RhoB mRNA levels (2.1-fold) even in the absence of TGFb stimulation (Fig. 2A, top panel, lane 5), and treatment with TGFb1 slightly enhanced this effect (2.3-fold) (Fig. 2A, top panel, lane 6). In contrast, adenovirus-mediated overexpression of the Smad2 protein did not significantly upregulate expres- sion of the RhoB gene either in the absence (1.3-fold) or presence of added TGFb (1.9-fold) (Fig. 2A, top panel, lanes 3 and 4). In line with our findings in Fig. 1, transcription of the RhoA gene was not affected by overexpression of Smad proteins in Swiss 3T3 cells (Fig. 2A, middle panel). Smad3 is required for TGFb1-induced transcriptional activation of the RhoB gene The results presented in Fig. 2A indicate that Smad3, and to a much lesser extent Smad2, are transcriptional activators of the human RhoB gene. To further evalu- ate these findings, we used the JEG-3 human chorio- carcinoma cell line that does not express endogenous Smad3 protein [26]. We first determined mRNA levels for the RhoA and RhoB genes following treatment of JEG-3 cells with TGFb1 in the absence or presence of exogenous Smad3 expressed via adenovirus-mediated gene transfer. For this purpose, JEG-3 cells were adenovirally infected with ad-Smad3 or ad-LacZ as a negative control, serum-starved for 24 h and stimulated or not with 5 ngÆmL )1 TGFb1 for 24 h. Cells were then lysed and processed for total RNA extraction and RT-PCR. As shown in Fig. 2B (top panel), treatment of JEG-3 cells with TGFb1 resulted in minor (1.6-fold) transcriptional activation of the endogenous RhoB gene. Importantly, TGFb caused a potent (4.5-fold) induction of RhoB gene expression when JEG-3 cells were infected with an adenovirus expressing Smad3, Fig. 1. TGFb1 induces rapid and sustained transcriptional upregula- tion of the RhoB gene but not the RhoA gene in Swiss 3T3 and HepG2 cells. (A) Active transcription is required for TGFb-induced actin cytoskeleton reorganization. Swiss 3T3 fibroblasts were trea- ted with 5 ngÆmL )1 TGFb for 24 h in the absence or presence of actinomycin D (5 lgÆmL )1 ). Changes in actin cytoskeleton were monitored using rhodamine phalloidin staining. (B,C) TGFb induces the transcription of the RhoB gene but not of the RhoA gene. Swiss 3T3 (B) or HepG2 (C) cells were serum-starved for 24 h and stimulated with TGFb 1 for the indicated time points or left untreated. RT-PCR analysis was performed with primers specific for the mRNA of the RhoB or RhoA genes. The bottom panels rep- resent the mRNA levels of the housekeeping gene GAPDH at the same time points. The RhoB and RhoA mRNA levels were normal- ized to the intensity of the corresponding GAPDH mRNA of each sample. Data are representative of two independent experiments. The fold increase in mRNA levels is shown below each PCR image. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization L. Vardouli et al. 4076 FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS indicating that Smad3 is required for TGFb1-induced transcriptional upregulation of the RhoB gene. In agreement with the mRNA data, levels of RhoB pro- tein were also potently increased by TGFb1 only in the presence of adenovirally expressed Smad3 (Fig. 2C, top panel). In line with our initial findings in Swiss 3T3 and HepG2 cells, the transcription levels of the RhoA gene were not affected by Smad3 overexpression in JEG-3 cells (Fig. 2B, middle panel). TGFb and Smad proteins activate the promoter of the RhoB gene To further characterize the mechanism of transcrip- tional upregulation of the RhoB gene by TGFb1, we cloned the promoters of the human RhoB and RhoA genes in fusion with the firefly luciferase gene (Fig. 3A) and used them in transactivation experiments in order to determine their responsiveness to the TGFb ⁄ Smad signaling cascade. For this purpose, HepG2 cells were transiently transfected with the reporter plasmids )726 ⁄ +86 RhoB-Luc and )799 ⁄ +166 RhoA-Luc in the absence or the presence of expression vectors for the constitutively active form of the TGFb receptor I (ALK5ca) and the TGFb signaling mediators Smad2, Smad3 and Smad4. As shown in Fig. 3B, the constitu- tively active form of the TGFb receptor type I (ALK5ca) enhanced the activity of the )726 ⁄ +86 RhoB promoter 2.2-fold. The activity of this promoter was also enhanced by overexpression of Smad3 and Smad4 proteins (3.4-fold) and to a lesser extent by overexpression of Smad2 and Smad4 proteins (2.3-fold), and this activity was stimulated further by simultaneous expression of the ALK5ca receptor (3.6- and 2.6-fold, respectively). In contrast, ALK5ca, Smad2 ⁄ Smad4 and Smad3 ⁄ Smad4 proteins had a minor effect (1.2-1.6-fold) on the activity of the human )799 ⁄ +166 RhoA promoter (Fig. 3C). In conclusion, the combined data in Figs 2 and 3 indicate that transcriptional activation of the RhoB gene by TGFb is mediated, at least in part, by TGFb- Fig. 2. Adenovirus-mediated overexpression of Smad proteins in Swiss 3T3 cells and JEG-3 choriocarcinoma cells that lack endoge- nous Smad3 confirmed the important role of Smad3 in transcrip- tional upregulation of the RhoB gene. (A) RT-PCR analysis of Swiss 3T3 cells infected with ad-LacZ as control (lanes 1 and 2), ad-Smad2 (lanes 3 and 4) or ad-Smad3 (lanes 5 and 6). Cells were serum-starved for 24 h and stimulated with 5 ngÆmL )1 TGFb1 (lanes 2, 4 and 6) for 2 h. The bottom panel represents the mRNA levels of the housekeeping gene GAPDH at the same time points. The RhoB and RhoA mRNA levels were normalized to the intensity of the corresponding GAPDH mRNA of each sample. Data are rep- resentative of two independent experiments. The fold increase in mRNA levels is shown below each PCR image. (B) RT-PCR analysis of JEG-3 (Smad3) ⁄ )) cells infected with ad-LacZ as control (lanes 1 and 2) or ad-Smad3 (lanes 3 and 4). Cells were serum-starved for 24 h and stimulated with 5 ngÆmL )1 TGFb1 (lanes 2 and 4) for 24 h. RT-PCR analysis was performed with primers specific for the RhoB or RhoA mRNA. The bottom panel represents the mRNA levels of the housekeeping gene GAPDH. The RhoB and RhoA mRNA levels were normalized to the intensity of the corresponding GAPDH mRNA of each sample. Data are representative of two independent experiments. (C) Immunoblotting analysis of RhoB and adenovirally overexpressed Smad2 and Smad3 proteins in JEG-3 cells. Follow- ing adenovirus infection, cells were serum-starved for 24 h and stimulated with 5 ngÆmL )1 TGFb1 for 24 h (+) or left unstimulated ()). Total extracts from the infected cells were analyzed by SDS– PAGE and Western blotting using antibodies against RhoB and against total or phosphorylated forms of Smad2 and Smad3. L. Vardouli et al. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS 4077 regulated Smad proteins, which act as transcriptional regulators of the activity of the RhoB promoter. Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganization in Swiss 3T3 fibroblasts To examine whether Smad proteins, in addition to serving as transcriptional regulators of RhoB gene expression in response to TGFb, also play a role in the activation of Rho proteins as GTPases by this cyto- kine, we performed affinity precipitation assays using the rhotekin Rho-binding domain fused to glutathione S-transferase (GST–RBD). For this purpose, cells were infected with Smad2- or Smad3-expressing adeno- viruses or with a LacZ-expressing adenovirus as a neg- ative control. Following serum deprivation for 24 h, cells were treated with 5 ngÆmL )1 TGFb1 for 10 min, and GST–RBD was used to isolate GTP-loaded RhoA and RhoB from cell lysates. Both proteins were moni- tored by immunoblotting using anti-RhoA and anti- RhoB specific serum, and the protein band intensities were normalized relative to the total RhoA or RhoB content of non-adsorbed cell lysates. As shown in Fig. 4A (top panel), RhoA was activated by TGFb (3.2-fold) or by overexpression of Smad2 or Smad3 (3.9-fold) in Swiss 3T3 fibroblasts. In contrast, RhoB was activated only slightly by Smad2 (1.2-fold) or Smad3 (1.9-fold) compared to the activation of RhoA (Fig. 4B, top panel). The activation of GTPase activity of RhoA and RhoB proteins and the transcriptional induction of the RhoB gene by Smad proteins suggest that the TGFb– Smad pathway may contribute to the long-term actin reorganization induced by TGFb in Swiss 3T3 fibro- blasts. To test this hypothesis, we analyzed actin archi- tecture in Swiss 3T3 cells infected with adenoviruses expressing Smad2 and Smad3. In these double staining experiments, the actin cytoskeleton organization was assessed by direct fluorescence using rhodamine phal- loidin, and indirect immunofluorescence against the Flag epitope of Smad2 and Smad3 revealed R-Smad staining. Cells were serum-starved for 24 h, and then stimulated, or not, with 5 ngÆmL )1 TGFb1 for 24 h. As shown in Fig. 5, control starved cells expressing the LacZ gene exhibited typical morphology, i.e. their actin cytoskeleton was restricted to cortical actin and the main cell body was devoid of stress fibers (Fig. 5B). Treatment with TGF b1 resulted in cell Fig. 3. TGFb1 increases the activity of the promoter of the RhoB gene in human hepatoma HepG2 cells. (A) Schematic representation of the reporter plasmids )726 ⁄ +86 RhoB-Luc and )799 ⁄ +166 RhoA-Luc that were used in the transactivation experiments shown in (B) and (C). Numbers refer to the transcription start site of each gene (+1). (B,C) HepG2 cells were transiently transfected with the )726 ⁄ +86 RhoB-Luc or the )799 ⁄ +166 RhoA-Luc plasmid (1 lg) together with the expression vector for the constitutively active form of TGFb recep- tor I (ALK5ca) independently or in combination with expression vectors for Smad2, Smad3 and Smad4 (1 lg each) as indicated beneath each histogram. The CMV-b-gal plasmid expressing b-galactosidase (1 lg) was included in each sample for normalization of transfection variability. Luciferase activity was determined in cell lysates at 48 h after transfection, and the mean values and SEM from at least two independent experiments performed in duplicate are shown as percentage relative luciferase activity. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization L. Vardouli et al. 4078 FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS flattening and scattering, supported by changes in the organization of the actin cytoskeleton (Fig. 5D). In contrast to control adenovirus (LacZ), ectopic expres- sion of Smad2 in serum-starved cells resulted in increased actin polymerization, even in the absence of TGFb1 stimulation (Fig. 5F). Likewise, adenoviral overexpression of Smad3 resulted in even more pro- found changes in the organization of the actin cyto- skeleton, resulting in cell flattening and cell shape change. Cells appeared elongated or spindle-shaped, with a parallel arrangement of actin bundles (Fig. 5J). Addition of TGFb did not cause any additional changes in actin cytoskeleton organization in the ad-Smad3-infected cells (Fig. 5, panels J and L), but enhanced the formation of stress fibers in the ad-Smad2-infected cells (Fig. 5, panels F and H). These morphological findings were further corrobo- rated by quantitative immunoblot analysis of the Tri- ton X-100-soluble (TS) and -insoluble (TI) actin cytoskeleton fractions of cells overexpressing the R-Smad proteins (Table 1). As calculated from the rel- ative band intensities, the G ⁄ total actin ratio of Swiss 3T3 fibroblasts treated with TGFb 1 for 24 h was clearly and reproducibly decreased in comparison with control cells serum-starved for 24 h. Furthermore, cells ectopically expressing Smad2 or Smad3 revealed a greater decrease in the G ⁄ total actin ratio, correspond- ing to a clear shift of the dynamic equilibrium towards polymerized actin. Thus, quantitative analysis of actin dynamics revealed that Smad2 and Smad3 overexpres- sion in Swiss 3T3 fibroblasts induces actin polymeriza- tion and microfilament reorganization. To address the contribution of Smad3 protein to the actin reorganization induced by TGFb, we infected JEG-3 cells with adenoviruses expressing Smad3 (or LacZ as a negative control), and assessed the polymeri- zation dynamics of the actin cytoskeleton by quantita- Fig. 4. Overexpression of Smad2 and Smad3 proteins via adeno- virus-mediated gene transfer induced activation of Rho GTPases in Swiss 3T3 fibroblasts. Rho–GTP loading assay with Swiss 3T3 cells infected with ad-LacZ as control (lanes 1 and 2), ad-Smad2 (lanes 3 and 4) or ad-Smad3 (lanes 5 and 6). Cells were serum-starved for 24 h and stimulated with 5 ngÆmL )1 TGFb1 (lanes 2, 4 and 6) for 15 min. Immunoblots of the GST–RBD pulldown (RhoA–GTP or RhoB–GTP), or total cell extracts with RhoA antibody (A) or RhoB antibody (B) and Flag-M5 antibody (Smad2 and Smad3) are shown. Densitometric analysis of the RhoA–GTP and RhoB–GTP immuno- blots was performed, and the fold increase of the active ⁄ total ratio values of each condition is shown. These data are representative of two independent experiments. Fig. 5. Smad2 and Smad3 induce actin reor- ganization in Swiss 3T3 fibroblasts. Swiss 3T3 cells infected with the adenoviruses ad-LacZ, ad-Smad2 or ad-Smad3 were sub- sequently serum-starved for 24 h and stimu- lated (+) or not ()) with 5 ngÆmL )1 TGFb1 for 24 h (+). Indirect immunofluorescence against the Flag epitope of Smad2 and Smad3 is shown in the left panels (FITC, fluorescein isothiocyanate) and direct fluorescence of actin is shown in the right panels. The bar represents 10 lm. L. Vardouli et al. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS 4079 tive immunoblot analysis of the Triton X-100-soluble (TS) and -insoluble (TI) actin cytoskeleton fractions of cells (Table 2). The G ⁄ total actin ratio of JEG-3 cells treated with TGFb1 for 24 h was decreased compared to control serum-starved cells, indicating slight actin polymerization. Furthermore, the G ⁄ total actin ratio decreased in cells overexpressing Smad3, and this ratio decreased further following treatment with TGFb1, corresponding to a clear shift of the dynamic equilib- rium toward actin polymerization. These results indi- cate that Smad3 is crucial for the TGFb1-induced actin reorganization mediated by Rho GTPases. Smad3 (and to a lesser extent Smad2) induces the expression of a-smooth muscle actin TGFb stimulation of various cell types, including Swiss 3T3 fibroblasts, resulted in increased a-smooth muscle actin (a-SMA) expression [24,27–29 and unpublished data]. Having established that overexpres- sion of R-Smad proteins results in long-term actin polymerization, we investigated the involvement of Smad2 and Smad3 in TGFb1-induced a-SMA gene regulation and protein incorporation into the actin network of Swiss 3T3 fibroblasts. For this purpose, we transiently overexpressed Smad2 and Smad3 using adenoviral cell infections. Swiss 3T3 fibroblasts expressing Smad2, Smad3 or LacZ (as a negative con- trol) were serum-starved for 24 h, then stimulated with 5ngÆmL )1 TGFb1 for 24 h, and the levels of expres- sion of a-SMA were analyzed. As shown in Fig. 6A, control cells infected with the LacZ adenovirus and stimulated with TGFb1 for 24 h showed a 5.4-fold upregulation of a-SMA gene expression. In agreement with previous findings, Smad2 overexpression resulted in a moderate (1.5-fold) increase in a-SMA mRNA levels, whereas stimulation with TGFb1 led to a robust 4.6-fold upregulation of a-SMA mRNA (Fig. 6A). Interestingly, cells infected with ad-Smad3 showed a stronger upregulation of a-SMA mRNA (2.4-fold), which was even more prominent with TGFb1 treat- ment (5.4-fold). Analysis of a-SMA protein levels under the same experimental conditions as described in Fig. 6A provided very similar results (Fig. 6B). These data indicated that Smad3 rather that Smad2 is involved in a-SMA transcriptional upregulation in Swiss 3T3 fibroblasts. To further evaluate incorporation of the newly synthesized a-SMA to the actin cytoskeleton, we performed immunoblot analysis of the Triton X-100- soluble (TS) and -insoluble (TI) preparations after sub- cellular fractionation of Swiss 3T3 fibroblasts treated or not with TGFb and overexpressing Smad2, Smad3 or LacZ (as a negative control). Smad3 overexpression led to incorporation of a-SMA into the insoluble (fila- mentous) part (Fig. 6D, compare lanes 1 ⁄ 2 and 5 ⁄ 6). In line with the weaker induction of a-SMA protein expression in Smad2-transfected cells, a-SMA incorpo- ration into the insoluble cytoskeleton fraction was very low (Fig. 6C, compare lanes 1 ⁄ 2 and 5 ⁄ 6). These con- clusions were fully supported by the morphological analysis shown in Fig. 6E. Indirect immunostainning of Swiss 3T3 fibroblasts with an antibody against a-SMA, and subsequent analysis by fluorescence microscopy revealed increased a-SMA structures after Smad3 (but not Smad2) overexpression, similar to the control cells stimulated with TGFb1 for 24 h (Fig. 6E). These results indicate that ectopic expression of Smad3 (and to a lesser extent Smad2) leads to increased a-SMA expression in Swiss 3T3 fibroblasts. Interestingly, however, the newly synthesized a-SMA Table 1. Effect of the ectopic expression of Smad2 and Smad3 on the polymerization state of actin in Swiss 3T3 fibroblasts. Swiss 3T3 fibroblasts were infected with the adenoviruses indicated, serum-starved for 24 h, and then stimulated with 5 ngÆ mL )1 TGFb1 for 24 h. Triton-soluble (TS) and Triton-insoluble (TI) actin cytoskele- ton fractions were prepared as described in Experimental proce- dures, and their actin content was analyzed by immunoblotting. Data presented correspond to the G ⁄ total actin ratio in each condi- tion. These data are representative of three independent experi- ments. Sample G ⁄ total actin ratio Standard error ad-LacZ 0.42 0.01 ad-LacZ + TGFb1 0.38* 0.01 ad-Smad2 0.35* 0.00 ad-Smad2 + TGFb1 0.34* 0.01 ad-Smad3 0.35* 0.00 ad-Smad3 + TGFb1 0.34* 0.02 * Statistically different from ad-LacZ (control) at P < 0.05. Table 2. Effect of the ectopic expression of Smad3 on the poly- merization state of actin in JEG-3 cells. JEG-3 (Smad3) ⁄ )) cells were infected with the adenoviruses indicated, serum-starved for 24 h, and then stimulated with 5 ngÆmL )1 TGFb1 for 24 h. Triton- soluble (TS) and Triton-insoluble (TI) actin cytoskeleton fractions were prepared as described in Experimental procedures, and their actin content was analyzed by immunoblotting. Data presented correspond to the G ⁄ total actin ratio in each condition. These data are representative of five independent experiments. Sample G ⁄ total actin Standard error ad-LacZ 0.45 0.01 ad-LacZ + TGFb1 0.37* 0.05 ad-Smad3 0.40* 0.03 ad-Smad3 + TGFb1 0.34* 0.05 * Statistically different from ad-LacZ (control) at P < 0.05. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization L. Vardouli et al. 4080 FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS can be incorporated into the newly formed stress fibers only when Smad3 is overexpressed, even in the absence of TGFb. Discussion In the present study, we provide evidence for the essential role of Smad proteins and Rho GTPases in long-term TGFb-induced actin cytoskeleton reorgani- zation in various cell models. We also show that acti- vation of Smad and Rho proteins by TGFb in fibroblasts is correlated with potent induction of a-SMA gene expression and subsequent incorporation of a-SMA into microfilamentous structures. As a-SMA expression is indicative of a myofibroblast phenotype [30], our findings suggest that these proteins control a TGFb-induced fibroblast to myofibroblast differentia- tion program. Fibroblast to myofibroblast conversion is a pathophysiological feature of various fibrotic dis- eases such as idiopathic pulmonary fibrosis, asthma and chronic obstructive pulmonary diseases (COPD) [31–33]. Given that enhanced TGFb concentrations have been detected in patients with various fibrotic dis- eases including idiopathic pulmonary fibrosis [34,35], sarcoidosis [36] and cystic fibrosis [37], in-depth under- standing of the mechanism that underlies this TGFb- induced conversion program, identification of the molecules involved and elucidation of their role or their Fig. 6. Smad3 (and to a lesser extent Smad2) induce the expression of a-smooth muscle actin (a-SMA). (A) RT-PCR of Swiss 3T3 cells infected with control (LacZ) adenovirus or adenoviruses expressing Smad2 and Smad3. Cells were serum-starved for 24 h and stimulated with 5 ngÆmL )1 TGFb1 for 3 h. RT-PCR analysis was performed with primers specific for the mRNA of the a-SMA gene. The bottom panel represents the mRNA levels of the housekeeping gene GAPDH. The a-SMA mRNA level was normalized to the intensity of the correspond- ing GAPDH mRNA for each sample. Data are representative of two independent experiments. The fold increase in a-SMA mRNA levels is shown below each image. (B) Immunoblot analysis of total cell extracts of Swiss 3T3 cells infected with control (LacZ) adenovirus or adeno- viruses expressing Smad2 and Smad3. Cells were starved for 24 h and stimulated (+) or not ()) with 5 ngÆmL )1 TGFb1 for 24 h. Immuno- blotting of the corresponding total extracts with the a-SMA antibody and control b-tubulin antibody is shown. The fold increase in a-SMA protein levels is shown below each image. (C,D) Immunoblot analysis of the Triton-soluble (TS) and Triton-insoluble (TI) actin cytoskeleton fractions of Swiss 3T3 cells infected with adenoviruses expressing LacZ (lanes 1-4, both panels), Smad2 (lanes 5-8, C) or Smad3 (lanes 5-8, D). Following adenovirus infection, cells were starved for 24 h and stimulated (+) or not ()) with 5 ngÆmL )1 TGFb1 for 24 h (+). Immunoblot- ting of the corresponding total extracts with the a-SMA antibody is shown. (E) Indirect fluorescence microscopy of Swiss 3T3 cells infected with the indicated adenoviruses using an antibody against a-SMA. Following adenovirus infection, cells were serum-starved for 24 h and stimulated (+) or not ()) with 5 ngÆmL )1 TGFb1 for 24 h. Bars correspond to 10 lm. L. Vardouli et al. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS 4081 modes of regulation may lead to the development of novel therapeutic approaches for these diseases. We show here that TGFb stimulation of fibroblasts or hepatic cells causes differential regulation of expres- sion of the genes encoding the two small GTPases RhoA and RhoB (Fig. 1). Thus, treatment of these cells with TGFb1 resulted in a rapid increase in steady-state mRNA levels of the RhoB gene that was initiated at 30 min (Swiss 3T3) or 1 h (HepG2) and persisted for a period of 24 h post-induction, whereas no transcriptional activation of the RhoA gene by TGFb1 was observed (Fig. 1). These findings confirm previous experimental evidence which suggested that RhoB is the only member of the Rho-related subfamily of small GTPases that is regulated at the transcrip- tional level, and this regulation may be important for its function due to the short half-life of this protein in the cell [38,39]. Of interest was the periodic pattern of induction of RhoB gene transcription by TGFb.As shown in Fig. 1B, TGFb induced RhoB gene expres- sion 2.6-fold at 2 h of treatment in HepG2 cells, and this induction declined to 1.8-fold at 4 h, increased again to 2.2-fold at 8 h and dropped back to 1.4-fold at 24 h after TGFb addition. A similar periodic pat- tern of RhoB gene transcriptional induction was observed in Swiss 3T3 cells (Fig. 1A). These findings could account for our previously reported observations that regulation of the RhoB GTPase activity by TGFb in Swiss 3T3 cells follows a periodic pattern [23]. The periodic decrease in expression of the RhoB gene during TGFb stimulation strongly suggests that RhoB is subject to an auto-inhibitory loop. In agree- ment with this hypothesis, we have shown that over- expression of RhoB causes a potent reduction in the activity of its own promoter (E. Vasilaki, unpublished observations). We speculated that the differential effect of TGFb on expression of these two genes reflects a difference in the mechanism by which the TGFb-regulated Smad proteins (Smad2 and Smad3) regulate the activity of the two promoters. To address this hypothesis, we cloned the promoters of the human RhoA and RhoB genes in front of the firefly luciferase gene, and, using transient transfection experiments and luciferase assays, did indeed show that the TGFb–Smad pathway specifically targets the RhoB gene (Fig. 3). A mechanis- tic explanation for this RhoB-specific transcriptional response to the TGFb–Smad pathway could be that the promoter of the human RhoA gene lacks Smad binding elements that could serve as sites of Smad recruitment in response to TGFb stimulation. A search for transcription factor binding sites in the two promoters revealed that the human RhoB promoter contains three putative Smad binding elements (sequence 5¢-CAGAC-3¢) [40] in the proximal )726 ⁄ +86 region that was used in the transactivation experiments (at positions )294 ⁄ )290, )278 ⁄ )274 and +20 ⁄ +24), whereas the human RhoA promoter, which is not homologous to the human RhoB promoter, does not contain any of these putative Smad binding ele- ments. We are in the process of characterizing these sites further and studying their role and participation in the transcriptional upregulation of the RhoB promoter in response to TGFb stimulation or Smad overexpression. Our preliminary experiments have shown that regulation of the RhoB promoter by the TGFb–Smad pathway is more complex than initially suspected, and that elements additional to the Smad binding elements are required for this regulation (E. Vasilaki, E. Papadimitriou, C. Stournaras & D. Kardassis, unpublished data). An interesting finding during this work was that Smad proteins, in addition to serving as specific tran- scriptional activators of the RhoB gene, can also act as activators of Rho GTPase function. This is in line with previous studies that had provided indications of the involvement of the Smad pathway in the activation of Rho protein activity, and specifically that of RhoA, by TGFb [23,24], We have shown recently that overex- pression of Smad7, a known and potent inhibitor of the TGFb signaling pathway and of Smad function that operates in the context of a feedback inhibitory loop [41], was able to block both the activation of RhoA GTPase activity and reorganization of the actin cytoskeleton by TGFb1 in Swiss 3T3 fibroblasts, sug- gesting cross-talk between Smad signaling and RhoA activation [23]. In line with these observations, it was recently reported that dominant-negative RhoA inhib- its the nuclear translocation of Smad2 and Smad3 dur- ing the smooth muscle cell differentiation induced by TGFb, indicating that RhoA is a modulator of Smad activation [24]. Moreover, by studying the signaling properties of a type I TGFb receptor with a mutation in the L45 loop that contains the Smad docking site [16], it was demonstrated that interaction of the recep- tor with Smad proteins is required for signaling to Rho GTPases and the actin cytoskeleton [23]. These data suggest that Smad proteins, in addition to their role in long-term RhoB transcriptional regulation, might be directly involved in activation of Rho GTP- ases and the regulation of actin dynamics. The results presented in this study clearly support this assumption. Indeed, adenovirus-mediated Smad2 and Smad3 over- expression triggered activation of RhoA, and to a lesser extent RhoB, and caused potent long-term actin reorganization (Figs 4 and 5). Activation of Rho Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization L. Vardouli et al. 4082 FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS proteins by Smad proteins could be facilitated by dif- ferent, not necessarily mutually exclusive mechanisms, as discussed below. Another interesting finding arising from this work was the differential involvement of the two TGFb-reg- ulated Smad proteins (Smad2 and Smad3) in TGFb- induced Rho gene regulation and actin restructuring. While adenovirus-mediated overexpression of Smad3 largely mimicked the TGFb effects on transcriptional upregulation of the RhoB and a-SMA genes, as well as on RhoA and RhoB activation and actin reorgani- zation, Smad2 was consistently less effective in all of these processes (Figs 2–6). This may reflect a specific requirement for Smad3 in transcriptional regulation of both RhoB and a-SMA genes by TGFb. This hypothe- sis is supported by experiments in a cellular model that lacks endogenous Smad3 expression (JEG-3 choriocar- cinoma cells). We found that TGFb treatment of this cell line had no effect on transcriptional upregulation of the RhoB gene, but RhoB gene expression was rescued after adenovirus-mediated ectopic expression of Smad3 (Fig. 2B). Taken together, these findings support a key role for Smad3 in mediating Rho ⁄ actin regulation by TGFb. The combined data from this as well as previous studies suggest a model of short- and long-term TGFb-induced actin cytoskeleton reorganization in fibroblasts and other cell types. This model is shown schematically in Fig. 7, and can be summarized as follows. In the short-term activation process, TGFb receptor activation by its ligand induces rapid activa- tion of RhoA and RhoB GTPases (1), which is fol- lowed by activation of the ROCK ⁄ LIMK ⁄ cofilin pathway (2–4) and actin cytoskeleton restructuring (5), as shown previously [23]. The mechanism by which Rho activation is linked to activation of the type I TGFb receptor (TbRI) is currently unknown. It may be that the phosphorylated TbRI activates very rapidly, by phosphorylation, a specific guanine nucleo- tide exchange factor (GEF), which in turn activates Rho proteins. In a previous study, we showed that dominant-negative forms of either RhoA or RhoB are equally effective in blocking TGFb-induced actin cyto- skeleton reorganization in Swiss 3T3 cells, suggesting that these two GTPases are in the same pathway and activation of the one may precede activation of the other [23]. Gene silencing experiments may shed some light into the details of this activation process and the specific role of each Rho protein, but it seems reason- able to suggest, based on the available data, that RhoA protein plays a more critical role in this short- term activation event. The long-term actin cytoskeleton response to TGFb stimulation involves the Smad pathway and transcrip- tional activation events. Thus, TGFb rapidly induces the phosphorylation of R-Smad proteins (a), the for- mation of R-Smad(P)–Smad4 complexes (b), transloca- tion of these complexes to the nucleus (c), and their Fig. 7. Mechanisms of short-term and long- term actin cytoskeleton reorganization induced by TGFb in fibroblasts. Schematic representation of the proposed mechanisms regulating actin cytoskeleton reorganization in fibroblasts following TGFb stimulation. Numbers in parentheses (1–5) indicate the successive steps that lead to short-term actin reorganization immediately after TGFb stimulation. Letters in parentheses (a–g) indicate events that contribute to long-term actin cytoskeleton reorganization. Solid arrows indicate events that have been experimentally proven in this or previous studies. Dashed arrows indicate hypotheti- cal events. L. Vardouli et al. Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization FEBS Journal 275 (2008) 4074–4087 ª 2008 The Authors Journal compilation ª 2008 FEBS 4083 [...]... and for the cloning of the RhoA and RhoB promoter regions Name of primer hRhoB -825 hRhoB +86 hRhoA )799 hRhoA +166 hRhoB sense hRhoB antisense hRhoA sense hRhoA antisense GAPDH-F GAPDH-R Sequence (5¢- to 3¢) GGGATCAGAGTTCATAGTGAAAAGAG GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTC GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC... expression of the RhoB gene as well as the activity of the RhoB promoter can be induced by TGFb-regulated Smad proteins Furthermore, we provide direct evidence of a key role for Smad proteins, and more specifically Smad3 , in mediating Rho activation and actin regulation by TGFb Finally, we demonstrate that, in fibroblasts, activation of RhoB gene expression by TGFb is associated with the stimulation of a- SMA... (f) Smad proteins may contribute to long-term Rho GTPase activity by various mechanisms, such as transcriptional activation of a gene coding for a Rho GEF (e), physical interactions with an existing GEF, or finally by acting as GEFs themselves Finally, in fibroblasts, the TGFb Smad pathway causes transcriptional activation of the a- SMA gene and its incorporation into the cytoskeleton (g), a process that.. .Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization recruitment to various TGFb-responsive genes (d) Two genes that were shown in this study to be activated by this pathway are the RhoB and a- SMA genes The preferential transcriptional activation of the RhoB gene over the RhoA gene strongly suggests an exclusive role of RhoB GTPase in long-term actin cytoskeleton reorganization by TGFb... characteristic of a fibroblast to myofibroblast differentiation program [30] In conclusion, in the present work, we have elucidated a novel regulatory mechanism for the long-term actin restructuring controlled by TGFb and mediated by Smad proteins We show for the first time that the RhoB gene (but not the RhoA gene) is a direct transcriptional target of the TGFb Smad signal transduction pathway, and that... (2002) Transforming growth factor-beta-induced mobilization of actin cytoskeleton requires signaling by small GTPases Cdc42 and RhoA Mol Biol Cell 13, 902–914 Moustakas A & Stournaras C (1999) Regulation of actin organisation by TGF-beta in H-ras-transformed fibroblasts J Cell Sci 112, 1169–1179 Piek E, Moustakas A, Kurisaki A, Heldin CH & ten Dijke P (1999) TGF-(beta) type I receptor ⁄ ALK-5 and Smad proteins. .. cDNA strand was synthesized by Superscript reverse transcriptase The sequences of the primers used for the PCR amplification of RhoB and RhoA cDNA are shown in Table 3 For normalization of the samples, the cDNA of the housekeeping glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was also amplified by PCR Quantification of the results was performed by measuring the intensity of the bands using tina... Pollard TD & Borisy GG (2003) Cellular motility driven by assembly and disassembly of actin filaments Cell 112, 453–465 2 Raftopoulou M & Hall A (2004) Cell migration: Rho GTPases lead the way Dev Biol 265, 23–32 3 Gourlay CW & Ayscough KR (2005) Identification of an upstream regulatory pathway controlling actin- mediated apoptosis in yeast J Cell Sci 118, 2119–2132 4 Yamazaki D, Kurisu S & Takenawa T... cleanup system were purchased from Promega (Madison, WI, USA) The Super Signal West Pico chemiluminescent substrate was purchased 4084 L Vardouli et al from Pierce (Rockford, IL, USA) Anti -Smad2 (SC-6200) and anti -Smad3 (SC-8332), mouse monoclonal anti-RhoA (SC-26C4) and rabbit polyclonal anti-RhoB (SC-119) were purchased from Santa Cruz Biotechnology Inc (Santa Cruz, CA, USA) Anti-P -Smad2 (3101S) was... purchased from Cell Signalling Technology (Danvers, MA, USA) Anti-P -Smad3 (9514L) was a generous gift from A Moustakas (Ludwig Institute for Cancer Research, Uppsala, Sweden) Secondary anti-mouse IgG and anti-rabbit IgG coupled to horseradish peroxidase were from Chemicon International Inc (Temecula, CA, USA) GST–RBD was purchased from Millipore (Billerica, MA, USA) Mouse anti -a- SMA ( 1A4 ), mouse anti-Flag . GGGATCAGAGTTCATAGTGAAAAGAG hRhoB +86 GCG AAGCTTCGGCCTAGCTCTCTCCCGGGTCTC hRhoA )799 GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB. In addition, Smad2 and Smad3 triggered activation of RhoA and RhoB GTPases and long-term actin reorganization in Swiss 3T3 fibroblasts. Finally, Smad3 , and