Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis Hongbo Shen 1, *, Feifei Wang 1, *, Ying Zhang 2 , Qiang Huang 1 , Shengfeng Xu 1 , Hairong Hu 1 , Jun Yue 3 and Honghai Wang 1 1 State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai, China 2 Department of Molecular Microbiology and Immunology, Bloomberg School of Public Health, Johns Hopkins University, Baltimore, MD, USA 3 Department of Clinical Laboratory, Shanghai Pulmonary Hospital, China Tuberculosis (TB) is the leading cause of infectious morbidity and mortality worldwide, with nine million new cases and two million deaths per year (http:// www.tballiance.org). Approximately two billion people are latently infected with Mycobacterium tuberculosis, comprising a critical reservoir for disease reactivation Keywords drug resistance; indole-3-glycerol phosphate synthase; inhibitor; Mycobacterium tuberculosis Correspondence H. Wang, State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China Fax: +86 21 65648376 Tel: +86 21 65643777 E-mail: hhwang@fudan.edu.cn J. Yue, Department of Clinical Laboratory, Shanghai Pulmonary Hospital, Shanghai 200433, China Fax: +86 21 65648376 Tel: +86 21 65643777 E-mail: yuejunnan@yahoo.com.cn *These authors contributed equally to this work (Received 19 June 2008, revised 19 October 2008, accepted 28 October 2008) doi:10.1111/j.1742-4658.2008.06763.x Tuberculosis (TB) continues to be a major cause of morbidity and mortal- ity worldwide. The increasing emergence and spread of drug-resistant TB poses a significant threat to disease control and calls for the urgent devel- opment of new drugs. The tryptophan biosynthetic pathway plays an important role in the survival of Mycobacterium tuberculosis. Thus, indole- 3-glycerol phosphate synthase (IGPS), as an essential enzyme in this path- way, might be a potential target for anti-TB drug design. In this study, we deduced the structure of IGPS of M. tuberculosis H37Rv by using homol- ogy modeling. On the basis of this deduced IGPS structure, screening was performed in a search for novel inhibitors, using the Maybridge database containing the structures of 60 000 compounds. ATB107 was identified as a potential binding molecule; it was tested, and shown to have antimyco- bacterial activity in vitro not only against the laboratory strain M. tubercu- losis H37Rv, but also against clinical isolates of multidrug-resistant TB strains. Most MDR-TB strains tested were susceptible to 1 lg ÆmL )1 ATB107. ATB107 had little toxicity against THP-1 macrophage cells, which are human monocytic leukemia cells. ATB107, which bound tightly to IGPS in vitro, was found to be a potent competitive inhibitor of the sub- strate 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phosphate, as shown by an increased K m value in the presence of ATB107. The results of site- directed mutagenesis studies indicate that ATB107 might inhibit IGPS activity by reducing the binding affinity for substrate of residues Glu168 and Asn189. These results suggest that ATB107 is a novel potent inhibitor of IGPS, and that IGPS might be a potential target for the development of new anti-TB drugs. Further evaluation of ATB107 in animal studies is warranted. Abbreviations CdRP, 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phosphate; CFU, colony-forming unit; DOPE, discrete optimized potential energy; IGPS, indole-3-glycerol phosphate synthase; MDR-TB, multidrug-resistant tuberculosis; MIC, minimum inhibitory concentration; mIGPS, indole-3- glycerol phosphate synthase of Mycobacterium tuberculosis ; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide; SPR, surface plasmon resonance; TB, tuberculosis. 144 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS [1]. The alarming increase in drug-resistant TB, espe- cially multidrug-resistant TB (MDR-TB, resistant to at least isoniazid and rifampin), poses a significant threat to effective TB control [2]. Therefore, there is an urgent need to develop novel drugs for the treatment of TB, especially MDR-TB (http://www.who.int/gtb). It was reported that auxotrophs of M. tuberculosis that are knocked out in the leucine, proline and tryp- tophan biosynthetic pathways show attenuation in their ability to infect mice [3,4]. This indicates that these amino acids might be unavailable for uptake by the bacterium in vivo [5]. The attenuation of virulence is especially marked in the tryptophan auxotrophic trpD knockout strain, which is essentially avirulent, even in immunodeficient mice [4]. This suggests that the tryptophan biosynthetic pathway might play an important role in the survival of M. tuberculosis in vitro and in vivo. Additionally, tryptophan is not synthesized by mammals, making enzymes from this biosynthetic pathway viable targets for new anti-TB drugs [5]. Indole-3-glycerol phosphate synthase (IGPS) catalyzes the fourth step in this biosynthetic pathway, the indole ring-closure reaction, in which the substrate 1-(o-carboxyphenylamino)-1-deoxyribulose-5¢-phospha- te (CdRP) is converted to the product indole 3-glycerol phosphate (IGP) [6]. The trpC gene, encoding IGPS, was demonstrated to be essential for the growth of M. tuberculosis in vitro by inactivation by transposon mutagenesis [7]. In addition, there is no homolog of IGPS in humans [8]. Thus, IGPS of M. tuberculosis (mIGPS) could be a good drug target for the design of new anti-TB agents. Virtual high-throughput in silico screening is an important tool in drug discovery [9]. It aims to identify chemical ligands that bind strongly to key regions of important enzymes. Consequently, identi- fied ligands may provide excellent inhibition of enzyme activities. Several drugs discovered using this approach have been tested clinically [10–12]. In this study, we have identified a high-affinity inhibitor, ATB107, of mIGPS, using the virtual screening approach. The inhibitor was found to be a competi- tive inhibitor of mIGPS, as it reduced the binding affinity for substrate to residues required for enzyme activity and effectively inhibited the growth of not only the virulent M. tuberculosis H37Rv labora- tory strain but also of drug-resistant clinical isolates in vitro. The inhibitory effect of ATB107 could not be reversed by the addition of tryptophan, as it might affect not only the biosynthesis of tryptophan but also other essential pathways. Results and Discussion Homology modeling of mIGPS structure IGPS is a key enzyme in the tryptophan biosynthetic pathway, which is widely present in bacteria [13]. There has been significant interest in its structure [14]. More than 20 crystal structures of bacterial IGPS have been determined (http://www.rcsb.org) [15]. Six possi- ble templates (Protein Data Bank codes: 1A53, 1H5Y, 1I4N, 1JCM, 1PII and 1VC4) for homology modeling were identified through a homology search. The struc- ture of 1VC4 was selected as the template, because of the highest sequence identity of 45.6%. Furthermore, sequence alignment analysis (Fig. 1) revealed a higher sequence similarity of 55.43% between the 1VC4 and mIGPS sequences. Using homology modeling, five models, M1, M2, M3, M4 and M5, for mIGPS were obtained, and their modeller objective function [16] values were 1633.37, 1745.01, 1681.45, 1650.79 and 1611.09, respectively. The last value is the lowest one, which means that M5 is the ‘best’ model. Furthermore, the discrete optimized potential energy (DOPE) score [17] profile of M5 (Fig. 2A) is very similar to that of the template (Fig. 2B), which also indicates that M5 is a reasonable model. Figure 2C shows that the mIGPS structure (M5) has one typical (b ⁄ a) 8 -barrel structure, which is the most common enzyme fold in nature [18]. Fig. 1. Amino acid sequence alignment of IGPS from M. tuberculosis H37Rv and that from Thermus thermophilus reveals high sequence similarity (55.43%). The second- ary structures of T. thermophilus IGPS are shown under the sequences. The a-helices are shown as red helices, and the b-sheets as blue arrows. The sequence alignment was performed using BIOEDIT software [39]. H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthase FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 145 Virtual selection of mIGPS inhibitors To obtain a more reasonable structure, we performed nanosecond timescale molecular dynamics simulations for the structure of M5. The plots of potential energy fluctuation (Fig. 3A) and protein backbone rmsd (Fig. 3B) from simulations show that the structure was equilibrated after 1 ns of simulation. Thus, we selected the last 9 ns simulation results to obtain an average structure using the g_rmsf program of gromacs. The equilibrated structure of mIGPS was used in the virtual selection of inhibitors, using the autodock approach. The docking dummy center was arranged in the middle of the barrel composed of C-termini of b-sheets. The radius of the docking region was 22.5 A ˚ , and it was beyond the width of the cavity in mIGPS, which was about 15–18 A ˚ . This ensured that the ligands could reach the mIGPS catalytic cavity during the docking process. Figure 4A shows that the ligands with low docking energy values mostly bound in the region surrounded by the ba-loops. One hundred ligands with the lowest docking energy values were selected from the 60 000 ligands, and 50 of them were purchased and used in further evaluation of their antimycobacterial activities. Antimycobacterial activities of the selected ligands in vitro We first evaluated the antibacterial activity of 50 ligands against M. tuberculosis H37Ra, which is a A B C Fig. 2. Structure of IGPS. The DOPE score profile of M5 (A) is highly similar to that of the template (B), which confirms that M5 is a reasonable model. The structure (C) of IGPS from M. tuberculosis H37Rv (M5) has one typical (b ⁄ a) 8 -barrel structure. Fig. 3. Plots of the potential energy fluctuation (A) and protein backbone rmsd (B) in mIGPS molecular dynamics simulations. The results showed that the structure was equilibrated after 1 ns of simulation. Thus, the last 9 ns simulation results were selected to obtain an average structure of mIGPS using the G_RMSF program of GROMACS. Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al. 146 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS highly attenuated M. tuberculosis strain [19]. The mini- mum inhibitory concentration (MIC) of ATB107 (Fig. 4B) is 0.1 lgÆmL )1 for M. tuberculosis H37Ra and also vaccine strain BCG (Table 1). ATB107 is a nitrogen heterocyclic ligand fused with polycyclic rings. Its molecular formula is C 21 H 28 N 8 , its chemical name is 1-azabicyclo[2.2.2]octan-3-one[4-(phenylamino)-6-(1- piperidinyl)-1,3,5-triazin-2-yl]hydrazone, and its molec- ular mass is 392.5 Da. There are four hydrogen bond donors, eight acceptors, and six rotatable bonds, and its xlogP (partition coefficient in octanol ⁄ water) is 4.46 (http://www.maybridge.com). This suggests that the ligand obeys Lipinski’s ‘rule of five’ [20]. ATB107 also had high activity against M. tuberculosis H37Rv, with an MIC of 0.1 lgÆmL )1 (Table 1). Using the BACTEC culture system, we observed inhibition of bacterial growth when clinical isolates of M. tuberculo- sis were exposed to two concentrations of ATB107. All 50 fully susceptible clinical isolates tested were suscep- tible to ATB107 at 1 lgÆmL )1 ; of these, 41(82%) were susceptible to ATB107 at 0.1 lgÆmL )1 (Table 2). Using the same approach, we evaluated the activity of ATB107 against 80 clinical MDR-TB isolates. The results showed that 67 (83.8%) MDR-TB isolates were susceptible to ATB107 at 1 lgÆmL )1 , and 25 (31.3%) isolates were susceptible to ATB107 at 0.1 lgÆmL )1 (Table 2). Interaction of ATB107 with mIGPS We performed a surface plasmon resonance (SPR) analysis to identify the interaction of ATB107 with mIGPS. Kinetic analysis of the binding interaction between ATB107 and mIGPS (Fig. 5) showed that the binding ability of ATB107 was well correlated with its concentrations. The equilibrium dissociation contant Fig. 4. Ligands with low docking energy values binding to the region surrounded by the ba-loops of mIGPS (A). The deep yellow ball is the dummy center of the docking region. The colored mole- cules are the ligands. The most effective ligand, ATB107 (B), is a nitrogen heterocyclic ligand fused with polycyclic rings. Table 1. MICs of ATB107 for different M. tuberculosis strains. Bacteria (10 5 CFUÆmL )1 ) were inoculated in Middlebrook 7H9 broth with OADC. ATB107 was added to obtain concentrations ranging from 0.01 to 200 lgÆmL )1 . After 3 weeks of incubation, the cul- tures were diluted and plated on agar plates for CFU determination. The MIC was defined as the lowest concentration that inhibited 99% of growth. The tests were repeated three times for each strain. Mycobacterial species No. strains MIC (lgÆmL )1 ) M. tuberculosis H37Ra 1 0.10 M. tuberculosis H37Rv 1 0.10 M. bovis BCG 1 0.10 Table 2. Susceptibility of M. tuberculosis clinical isolates to ATB107 measured by the BACTEC radiometric system. The tests were repeated twice for each strain. M. tuberculosis strains Total number of strains No. (%) strains inhibited by 1.0 lgÆmL )1 No. (%) strains inhibited by 0.1 lgÆmL )1 M. tuberculosis, fully susceptible clinical isolates 50 50 (100) 41 (82) MDR-TB strains (resistant to at least isoniazid and rifampin) 80 67 (83.8) 25 (31.3) H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthase FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 147 (k D ) was 3 · 10 )3 m. These results indicate that ATB107 can bind tightly to mIGPS in vitro. To elucidate the effect of ATB107 binding on enzyme activity, we tested the catalytic activity of mIGPS in the presence of this ligand. A plot of the ligand concentrations against mIGPS activity (Fig. 6A) showed that the activity decreased significantly with increase in ligand concentration. The 50% inhibitory concentration was about 0.41 lm. The results indicate that binding of ATB107 reduces the catalytic activity of mIGPS, and that ATB107 is a high-affinity inhi- bitor of mIGPS. Mechanism of inhibition by ATB107 To identify whether ATB107 is a competitive or non- competitive inhibitor, we tested the effect of inhibitor on the Michaelis constant K m of the substrate CdRP. Inhibitors were added to the reaction solutions to achieve concentrations of 0.2 and 2 lm, respectively. A plot of reciprocal velocity versus reciprocal substrate concentration (Fig. 6B) showed that the inhibitor increased the K m , and that the K m increase was corre- lated with higher concentrations of inhibitors. It is concluded that ATB107 might be a competitive inhibi- tor of mIGPS. In order to ascertain the mechanism by which ATB107 inhibits the catalytic activity of mIGPS, we mutated the residues close to the ATB107-binding sites in mIGPS (Fig. 7A) and tested the enzyme activities of these mutants. There are 11 residues surrounding ATB107 within a distance of 5 A ˚ . Ten of them were mutated to alanine, with a methyl group side chain, except for Ala190. The enzyme activities of mutants were assayed under the same conditions. The results (Table 3) demonstrate that mutations of Glu168 and Asn189 greatly affected the activities of the enzymes and increased the K m values 19-fold and 18-fold, respectively. These results suggest that the above resi- dues might play an important role in the catalytic pro- cess of mIGPS and may be related to the inhibition mechanism of ATB107. To investigate the role of these residues in the inhib- itory effect of ATB107, we compared the binding sites of CdRP and of ATB107. The substrate-binding sites were also calculated using autodock software. The results showed that eight of the 11 residues surround- ing ATB107 (yellow) within 5 A ˚ in mIGPS (Fig. 7A) are the same as eight of the 14 residues surrounding the substrate (red) within 5 A ˚ (Fig. 7B). This suggests that CdRP might bind to a similar region as the inhib- itor. Structure superposition results (Fig. 7C) con- firmed this conclusion. Therefore, these results suggest that the inhibitor competes with substrate in binding 150 100 50 Resp. diff. (RU) 0 –50 –100 50 60 70 80 90 100 110 120 130 a b c d e f 140 150 160 Time (s) Fig. 5. Kinetic analysis of ATB107 binding to mIGPS by SPR tech- nology using BIAcore 3000. The results show that the binding abil- ity of ATB107 is well correlated with its concentrations, which means that ATB107 binds well to mIGPS in vitro. Representative sensorgrams obtained from injection of ATB107 at concentrations of: (A) 0.50 · 10 )5 M; (B) 0.25 · 10 )5 M; (C) 0.13 · 10 )5 M; (D) 0.31 · 10 )6 M; (E) 0.78 · 10 )7 M; (F) 0.39 · 10 )7 M. Fig. 6. Effect of ATB107 binding on mIGPS activity. ATB107 inhib- ited mIGPS enzyme activity (A), and the catalytic activity of mIGPS decreased significantly with the increase in ATB107 concentrations. The results of reciprocal velocity plotted versus reciprocal substrate concentration (r, no inhibitor; , 0.2 lM inhibitor; , 2.0 lM inhibi- tor) (B) demonstrated that ATB107 increased the K m value of sub- strate, and that the increase in K m value correlated with larger amounts of inhibitor. Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al. 148 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS to mIGPS, which is consistent with the conclusion that ATB107 is a competitive inhibitor of the enzyme. Among the residues surrounding CdRP within 5 A ˚ in mIGPS (Fig. 7B), there are four hydrogen bonds between the substrate and these residues, including two bonds formed with the atoms in the backbone and another two bonds formed with side chains of Glu168 and Asn189. Interestingly, they are the residues that have been shown to play an important role in the cata- lytic process of mIGPS by site-directed mutagenesis. Thus, we conclude that ATB107 is a substrate compet- itive inhibitor, and that it inhibits mIGPS catalytic activity through reducing the binding affinity for substrate of Glu168 and Asn189. Evaluation of the cytotoxicity of ATB107 To determine the cytotoxicity of ATB107, we exam- ined its effect on the proliferation of THP-1 macro- phage cells. The important first-line TB drugs isoniazid and ethambutol were included as controls in the exper- iments. The results (Fig. 8) showed that at the highest concentration of 200 lgÆmL )1 , the drugs and ATB107 could inhibit cell proliferation, with cell survival of about 60%. With the lower concentration of 50 lgÆmL )1 , cell survival was more than 80% for ATB107 and both isoniazid and ethambutol. These results indicate there is no obvious difference in cyto- toxicity between ATB107 and isoniazid and ethambu- tol. Thus, ATB107 did not have obvious cytotoxicity. Effect of tryptophan on inhibition of activity of ATB107 against M. tuberculosis strains To identify whether the inhibitory effect of ATB107 could be reversed by the addition of tryptophan, we evaluated the inhibitory effect of ATB107 against M. tuberculosis H37Ra strains in the presence of trypto- phan. The results (Fig. 9) showed that tryptophan inhibited the growth of M. tuberculosis H37Ra at high concentrations, even without ATB107. The numbers of bacteria decreased significantly with increases in tryp- tophan concentrations, and there were few bacteria in Fig. 7. Comparison between the binding region of ATB107 and that of CdRP in the mIGPS structure. (A) Residues surrounding ATB107 (yellow) within 5 A ˚ in mIGPS. (B) Residues surrounding substrate (yellow) within 5 A ˚ in mIGPS. Dashed lines (green) represent the hydrogen bonds. The comparison result revealed that eight (num- bering in red) of the 11 residues surrounding ATB107 within 5 A ˚ in mIGPS (A) were also included in the 14 residues surrounding sub- strate within 5 A ˚ (B). (C) Binding regions of substrate (red) and ATB107 (yellow) in mIGPS. H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthase FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 149 the medium when the tryptophan concentration was more than 5%. The results also showed that there was no obvious difference among the inhibitory effects of ATB107 against M. tuberculosis H37Ra in media with different concentrations of tryptophan. These results suggest that IGPS’s role in M. tuberculosis might not be confined to tryptophan synthesis, or that ATB107 might affect not only the biosynthesis of tryptophan but also other essential pathways. Further studies are needed to determine the mechanism of action of ATB107. Conclusion In conclusion, through the combination of computa- tional prescreening and biological studies, we identified ATB107 as a high-affinity inhibitor of mIGPS. ATB107 was found to be highly active against M. tuberculosis, including MDR-TB clinical isolates with MICs of 0.1–1 lgÆmL )1 . mIGPS represents a novel drug target that is different from those of exist- ing TB drugs. Enzymology and site-directed mutagene- sis studies have identified Glu168 and Asn189 as key residues affecting enzyme activity. Further evaluation of ATB107 in vivo in animal models in terms of toxic- ity, pharmacology and activity against M. tuberculosis is warranted. Experimental procedures Homology modeling The 3D structure of mIGPS was generated by homology modeling using modeller 8.0 software [21]. The mIGPS amino acid sequence (GI:15608749) was put into the PIR format that is readable by modeller. Subsequently, a search for potentially related sequences of known structures was performed by the profile.build() command of model- ler, using default parameters. We assessed the structural and sequence similarities between the possible templates to select the most appropriate template for the query sequence over other similar structures. We finally picked the A-chain of 1VC4 as a template, because of its better crystallogophic resolution (1.8 A ˚ ) and higher overall sequence identity to the query sequence (45.6%). Then, the query sequence was aligned with the template, and the model was constructed and evaluated. Table 3. K m values of wild-type and mutant enzymes for the substrate CdRP. ND, not determined. Protein type K m (mM) K m (mutant) ⁄ K m (wild-type) Protein type K m (mM) K m (mutant) ⁄ K m (wild-type) Wild type 1.13 Asn189 fi Ala 20.34 18.00 Pro63 fi Ala 2.49 2.20 Ala190 fi Ala ND ND Ser64 fi Ala 1.53 1.40 Arg191 fi Ala 6.63 5.87 Glu168 fi Ala 21.67 19.17 Asn192 fi Ala 2.57 2.28 Val169 fi Ala 1.53 1.40 Leu193 fi Ala 1.42 1.25 His170 fi Ala 1.19 1.10 Leu196 fi Ala 1.81 1.61 Fig. 8. Effect of ATB107 on the growth of THP-1 macrophages. The effect was detected with the MTT method. The results sug- gest that ATB107 is not very toxic and has a similar toxicity pattern to the first-line TB drugs. The tests were repeated five times. INH, isoniazid; ETH, ethambutol. Fig. 9. Effect of tryptophan on the growth of M. tuberculosis strains in culture media with ATB107. Bacteria (10 5 CFUÆmL )1 ) were inoculated in Middlebrook 7H9 broth with OADC. ATB107 at three concentrations (0 · MIC, 1 · MIC and 0.1 · MIC; MIC is 0.1 lgÆmL )1 ) was added to the culture media with tryptophan at six concentrations. After 3 weeks of incubation, the cultures were diluted and plated on agar plates for CFU determination. The results show that tryptophan at high concentrations had definite inhibitory activity against M. tuberculosis but did not antagonize the activity of ATB107. The tests were repeated three times. Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al. 150 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS Molecular dynamics simulations Nanosecond timescale molecular dynamics simulation with explicit solvent representation was performed with the gromacs suite of programs (Version 3.3) [22,23], using the all-hydrogen force fields OPLS-AA [24]. A simulation sys- tem was built for mIGPS. The mIGPS was solvated with TIP4P [25] water molecules in a rectangular box, with the thickness of the water layer between the protein and the closest box boundary being 1.5 nm. Counterpart ions were placed into the box to make the system neutral. The simu- lation was performed using an ensemble of constant num- ber of molecules, pressure, and temperature (N–P–T ensemble), with the pressure P = 1 bar and the tempera- ture T = 300 K. The Berendsen temperature coupling method [26] was used, with a constant coupling of 0.1 ps. The cutoff distance for van der Waals forces was 1.0 nm. Electrostatic forces were treated with the particle mesh Ewald method [27]. The lincs algorithm [28] was used to constrain the bonds containing hydrogen. The simulation was run under periodical boundary conditions, using a time step of 2 fs. The period for each simulation run was 10 ns. The simulation was completed on the Lenovo Shenteng1800 computer with 32 Intel 2.8 GHz Xeon CPUs in the State Key Laboratory of Genetic Engineering, Fudan University. Molecular graphics were created using the programs pymol (http://pymol.sourceforge.net) and vmd [29]. Docking studies Protein–ligand docking simulations were carried out using the software autodock 3.0.5 [30], which combines a rapid energy evaluation through precalculated grids of affinity potentials with a variety of search algorithms to find suitable binding positions for a ligand on a given macromolecule. The 3D structure of mIGPS was built by homology modeling. Polar hydrogens were added to the macromolecule, and par- tial charges were assigned to the macromolecule using auto- docktools [31]. The ligands from the Maybridge database were transformed using a modified autodocktools program (written by Q. Huang) to 3D structures, adding partial atomic charges for each atom, and defining the rigid root and rotatable bonds for each ligand automatically. The 3D struc- ture and parameters of CdRP were generated by the program prodrg (http://davapcl.bioch.dundee.ac.uk/programs/prod- rg) [32]. Mass-centered grid maps were generated with the default 0.375 A ˚ spacing by the autogrid program for the whole protein target. The sigmoidal distance-dependent dielectric permittivity of Mehler and Solmajer [33] was used for the calculation of the electrostatic grid maps. The Lamarckian genetic algorithm [31] and the pseudo-Solis and Wets methods were applied for minimization, using default parameters. Random starting positions on the entire protein surface, random orientations and torsions (flexible ligands only) were used for the ligands. Mycobacterial strains and culture conditions M. tuberculosis H37Rv, M. tuberculosis H37Ra and clinical isolates of M. tuberculosis were provided by Shanghai Pul- monary Hospital of China. M. tuberculosis and Mycobacte- rium bovis BCG strains were grown in Middlebrook 7H9 broth and on Middlebrook 7H10 agar supplemented with 10% oleic acid ⁄ albumin ⁄ dextrose ⁄ catalase-enriched Middle- brook (OADC). The other plasmids and strains used in this study were purchased from Novagen (Madison, WI, USA). Effect of ligands on inhibition of bacterial growth in vitro Stock solutions of 5 mgÆmL )1 for each ligand were pre- pared in sterile dimethylsulfoxide. Appropriate dilutions for each ligand were added to 1 mL cultures to obtain concen- trations ranging from 0.01 to 200 lgÆmL )1 . The bacteria were inoculated at about 10 5 colony-forming units (CFUs) ⁄ mL. After incubation at 37 °C for 3 weeks, the cul- tures were diluted and plated on agar plates for CFU deter- mination. The MIC was defined as the lowest concentration inhibiting 99% of growth. The radiometric BACTEC 460 method [34] (Becton Dickinson, Sparks, MD, USA) was used to determine sus- ceptibility to 0.1 lgÆmL )1 and 1.0 lgÆmL )1 ATB107 for 50 clinical isolates of drug-sensitive and 80 clinical isolates of MDR-TB (resistant to at least isoniazid and rifampin) M. tuberculosis, with M. tuberculosis H37Rv as a control. Effect of ATB107 on mIGPS activity in vitro The concentration of mIGPS was determined with the Bradford method, using the kit from Bio-Rad (Hercules, CA, USA) [35]. The substrate CdRP was chemically synthe- sized, with a yield of 30 mm [36]. Ten microliters of 30 mm CdRP and 10 l L of 1.24 lm IGPS were added to 480 lL of 5 mm Tris ⁄ HCl (pH 7.0), and incubated at 37 °C for 20 min. The enzyme activity was measured with a spectro- photometer by following the increase in absorbance of the solution at 280 nm [37,38]. ATB107 was added to the assay mixture to obtain concentrations of 10 )4 m, 7.5 · 10 )5 m, 5 · 10 )5 m, 2.5 · 10 )5 m, and 10 )5 m, respectively. The 50% inhibitory concentration (IC50) of ATB107 was calcu- lated from the equation fitted by the curve of enzyme activ- ity versus ATB107 concentration. SPR analysis The interaction of mIGPS and ATB107 was investigated through SPR analysis, using a BIAcore 3000 instrument with software version 4.0 and Sensor Chip CM5 (carbo- xymethylated dextran surface). mIGPS was directly immo- bilized to the preactivated chip surface via amine groups. H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthase FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 151 The concentrations of ATB107 were 0.50 · 10 )5 m, 0.25 · 10 )5 m, 0.13 · 10 )5 m, 0.31 · 10 )6 m, 0.78 · 10 )7 m, and 0.39 · 10 )7 m. All assays were carried out at 25 °C. Site-directed mutagenesis Residues surrounding ATB107 within 5 A ˚ distance in mIGPS were mutated. Site-directed mutagenesis was carried out according to the protocol described in the QuikChange Site-Directed Mutagenesis Kit (Catalog #200518; Strata- gene, Cedar Creek, TX, USA). The primers for site-directed mutagenesis are listed in Table 4. The wild-type trpC gene- encoding plasmid was constructed as previously described [8]. This plasmid was used as the template in the construc- tion of the mutant IGPS plasmids. The plasmids were puri- fied and transformed into Escherichia coli strain BL21 (DE3) for expression of IGPS proteins. The conditions for protein purification and enzyme assay were as described previously [8]. Cell proliferation assay The tetrazolium dye reduction assay [3-[4,5-dim- ethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT); Sigma-Aldrich, USA] was used to determine the effect of ATB107 on cell survival and growth. At first, the THP-1 macrophage cells were inoculated at 8 · 10 4 cellsÆmL )1 into 96-well plates and incubated at 37 °Cina5% CO 2 ⁄ 95% air atmosphere for 24 h. ATB107, isoniazid and ethambutol were each added to give concentrations of 50, 100, 150 and 200 lgÆmL )1 . After incubation of cells trea- ted with compounds for 12 h, 20 lL(5gÆL )1 ) of MTT solution was added to each well; this was followed by incubation for another 4 h to allow the formation of for- mazan crystals. Finally, 10% SDS was added to dissolve the formazan crystals, and the plates were read on a Dy- natech MR600microplate reader at 570 nm. Controls were included in which only culture media were added to wells containing cells. Effect of tryptophan on activity of ATB107 M. tuberculosis H37Ra was cultured in Middlebrook 7H9 broth with 10% OADC containing ATB107 at three concen- trations (0 · MIC, 1 · MIC and 0.1 · MIC; MIC is 0.1 lgÆ mL )1 ). Tryptophan was added to the media to give concentrations of 10%, 5%, 2.5%, 1%, and 0.5%. After incubation for 3 weeks, the cultures were diluted to different extents and plated on Middlebrook 7H10 agar with 10% OADC. The CFUs were counted after another 2–3 weeks. Acknowledgements This work was supported by the National Natural Science Foundation of China (30670109), the China Postdoctoral Scientific Program (20060390605), and the National Basic Research Program of China (973 Program) (2009CB918604). References 1 Keshavjee S & Becerra MC (2000) Disintegrating health services and resurgent tuberculosis in post-soviet Tajiki- stan: an example of structural violence. JAMA 283, 1201. 2 Lenaerts A, Degroote M & Orme I (2008) Preclinical testing of new drugs for tuberculosis: current challenges. Trends Microbiol 16, 48–54. 3 Hondalus MK, Bardarov S, Russell R, Chan J, William R, Jacobs J & Bloom BR (2000) Attenuation of and protection induced by a leucine auxotroph of Mycobac- terium tuberculosis. Infect Immun 68, 2888–2898. 4 Smith DA, Parish T, Stoker NG & Bancroft GJ (2001) Characterization of auxotrophic mutants of Mycobacte- rium tuberculosis and their potential as vaccine candi- dates. Infect Immun 69, 1142–1150. 5 Lee CE, Goodfellow C, Javid-Majd F, Baker EN & Lott JS (2006) The crystal structure of TrpD, a metabolic enzyme essential for lung colonization by Mycobacterium tuberculosis, in complex with its substrate phosphoribo- sylpyrophosphate. J Mol Biol 355, 784–797. 6 Creighton TE & Yanofsky C (1966) Indole-3-glycerol phosphate synthetase of Escherichia coli, an enzyme of the tryptophan operon. J Biol Chem 241, 4616–4624. Table 4. Primers used in site-directed mutagenesis studies. Changes in DNA sequences are expected to change the amino acids to alanine. Mutation type Mutagenic primers (5¢-to3¢) Pro63 fi Ala Up: CAAGCGCGCTAGTGCTTCGGCAGGCG Down: CGCCTGCCGAAGCACTAGCGCGCTTG Ser64 fi Ala Up: CGCTAGTCCTGCGGCAGGCGCATTGG Down: CCAATGCGCCTGCCGCAGGACTAGCG Glu168 fi Ala Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG Val169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG His170 fi Ala Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Asn189 fi Ala Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC Arg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACG Down: CGTCATGAGGTGCCGGGCGTTAACGC Asp192 fi Ala Up: CGTTAACGCCCGCGCCCTCATGACGC Down: GCGTCATGAGGGCGCGGGCGTTAACG Leu193 fi Ala Up: CGCCCGCGACGCCATGACGCTGGACG Down: CGTCCAGCGTCATGGCGTCGCGGGCG Leu196 fi Ala Up: GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Inhibitor of indole-3-glycerol phosphate synthase H. Shen et al. 152 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 7 Sassetti CM, Boyd DH & Rubin EJ (2003) Genes required for mycobacterial growth defined by high density mutagenesis. Mol Microbiol 48, 77–84. 8 Yang Y, Zhang M, Zhang H, Lei J, Jin R, Xu S, Bao J, Zhang L & Wang H (2006) Purification and characteriza- tion of Mycobacterium tuberculosis indole-3-glycerol phosphate synthase. Biochemistry (Moscow) 71, S38– S43. 9 Amzel L (1998) Structure-based drug design. Curr Opin Biotechnol 9, 366–369. 10 Greer J, Erickson J, Baldwin J & Varney M (1994) Application of the three-dimensional structures of protein target molecules in structure-based drug design. J Med Chem 37, 1035–1054. 11 Hilpert K, Ackermann J, Banner DW, Gast A, Guber- nator K, Hadva ´ ry P, Labler L, Mu ¨ ller K, Schmid G & Tschopp TB (1994) Design and synthesis of potent and highly selective thrombin inhibitors. J Med Chem 37, 3889–3901. 12 Varghese J, Smith P, Sollis SL, Blick TJ, Sahasrabudhe A, McKimm-Breschkin JL & Colman PM (1998) Drug design against a shifting target: a structural basis for resistance to inhibitors in a variant of influenza virus neuraminidase. Structure 6, 735–746. 13 Ely B & Pittard J (1979) Aromatic amino acid biosynthesis: regulation of shikimate kinase in Escherichia coli K-12. J Bacteriol 138, 933–943. 14 Hennig M, Darimont BD, Jansonius JN & Kirschner K (2002) The catalytic mechanism of indole-3-glycerol phosphate synthase: crystal structures of complexes of the enzyme from Sulfolobus solfataricus with substrate analogue, substrate, and product. J Mol Biol 319, 757– 766. 15 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN & Bourne PE (2000) The protein data bank. Nucleic Acids Res 28, 235–242. 16 Braun W & Go ˜ N (1985) Calculation of protein conformations by proton–proton distance constraints: a new efficient algorithm. J Mol Biol 186, 611–626. 17 Eramian D, Shen MY, Devos D, Melo F, Sali A & Marti-Renom MA (2006) A composite score for pre- dicting errors in protein structure models. Protein Sci 15, 1653–1666. 18 Gerlt J & Raushel F (2003) Evolution of function in (alpha ⁄ beta)8-barrel. Enzymes 7, 252–264. 19 Soto CY, Andreu N, Gibert I & Luquin M (2002) Simple and rapid differentiation of Mycobacterium tuberculosis H37Ra from M. tuberculosis clinical isolates through two cytochemical tests using neutral red and nile blue stains. J Clin Microbiol 40, 3021– 3024. 20 Lipinski C, Lombardo F, Dominy B & Feeney P (2001) Experimental and computational approaches to estimate solubility and permeability in drug discovery and devel- opment settings. Adv Drug Deliv Rev 46, 3–26. 21 Marti-Renom MA, Stuart A, Fiser A, Sa ´ nchez R, Melo F & Sali A (2000) Comparative protein structure mod- eling of genes and genomes. Annu Rev Biophys Biomol Struct 29, 291–325. 22 Spoel DVD, Lindahl E, Hess B, Groenhof G, Mark AE & Berendsen HJC (2005) GROMACS: fast, flexible and free. J Comp Chem 26, 1701–1718. 23 Lindahl E, Hess B & Spoel DVD (2001) GRO- MACS 3.0: a package for molecular simulation and trajectory analysis. J Mol Mod 7, 306–317. 24 Jorgensen WL (1998) OPLS force field. In The Encyclo- pedia of Computational Chemistry (Schleyer PVR, ed.), pp. 1986–1989. Wiley, New York. 25 Jorgensen WL & Madura JD (1985) Temperature and size dependence for Monte Carlo simulations of TIP4P water. Mol Phys 56, 1381–1392. 26 Berendsen HJC, Postma JPM, van Gunsteren WF, DiNola A & Haak JR (1984) Molecular dynamics with coupling to an external bath. J Chem Phys 81, 3684– 3690. 27 Essmann U, Perera L, Berkowitz ML, Darden T, Lee H & Pedersen LG (1995) A smooth particle mesh Ewald method. J Chem Phys 103, 8577–8593. 28 Hess B, Bekker H, Berendsen H & Fraaije J (1997) LINCS: a linear constraint solver for molecular simula- tions. J Comp Chem 18, 1463–1472. 29 Humphrey W, Dalke A & Schulten K (1996) VMD – visual molecular dynamics. J Mol Graphics 14, 33–38. 30 Goodsell DS & Olson AJ (1990) Automated docking of substrates to proteins by simulated annealing. Proteins 8, 195–202. 31 Morris GM, Goodsell DS, Halliday RS, Huey R, Hart WE, Belew RK & Olson AJ (1998) Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function. J Comput Chem 19, 1639– 1662. 32 Aalten DMF, Bywater R, Findlay JBC, Hendlich M, Hooft RWW & Vriend G (1996) PRODRG, a program for generating molecular topologies and unique molecu- lar descriptors from coordinates of small molecules. J Comput Aided Mol Des 10, 255–262. 33 Mehler EL & Solmajer T (1991) Eletrostatic effects in proteins: comparison of dielectric and charge models. Protein Eng 4, 903–910. 34 Siddiqi SH, Libonati JP & Middlebrook G (1981) Eval- uation of rapid radiometric method for drug susceptibil- ity testing of Mycobacterium tuberculosis. J Clin Microbiol 13, 908–912. 35 Bradford MM, McRorie RA & Williams WL (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248–254. 36 Kirschner K, Szadkowski H, Jardetzky TS & Hager V (1987) Phosphoribosylanthranilate isomerase-indoleglyc- H. Shen et al. Inhibitor of indole-3-glycerol phosphate synthase FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS 153 [...].. .Inhibitor of indole-3-glycerol phosphate synthase H Shen et al erol -phosphate synthase from Escherichia coli Methods Enzymol 142, 386–397 37 Anderotti G, Cubellis MV, Palo MD, Fessas D, Sannia G & Marino G (1997) Stability of a thermophilic TIMbarrel enzyme: indole-3-glycerol phosphate synthase from the thermophilic archaeon Sulfolobus solfataricus Biochem J 323, 259–264 154 38 Pino MMS & Fersht AR... MMS & Fersht AR (1997) Nonsequential unfolding of the beta ⁄ alpha barrel protein indole-3-glycerol- phosphate synthase Biochemistry 36, 5560–5565 39 Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95 ⁄ 98 ⁄ NT Nucleic Acids Symp Ser 41, 95–98 FEBS Journal 276 (2009) 144–154 ª 2008 The Authors Journal compilation ª 2008 FEBS . CTCGGTATGGACCGCGACGAGTGCTG Val169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG His170 fi Ala Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down:. CTTCCTGCTCGGTAGCGACCTCGACG Asn189 fi Ala Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC Arg191 fi Ala Up: GCGTTAACGCCCGGCACCTCATGACG Down: CGTCATGAGGTGCCGGGCGTTAACGC Asp192