Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
... against a shifting target: a structural basis for resistance to inhibitors in a variant of influenza virus neuraminidase. Structure 6, 735–746. 13 Ely B & Pittard J (1979) Aromatic amino acid biosynthesis: ... 18.00 Pro63 fi Ala 2.49 2.20 Ala190 fi Ala ND ND Ser64 fi Ala 1.53 1.40 Arg191 fi Ala 6.63 5.87 Glu168 fi Ala 21.67 19.17 Asn192 fi Ala 2.57 2.28 Val169 fi Ala 1.53 1.40 Leu193 fi...
Ngày tải lên: 07/03/2014, 03:20
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt
... & Brade, H. (1994) Preparation and structural analysis of oligosaccharide monophosphates obtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota and Escherichia coli ... Gram-negative bacteria, and their adaptability to many different pollutants [1]. Pseudomonas stutzeri OX1 is a Gram-negative bacterium isolated from the activated sludge of a wastew...
Ngày tải lên: 19/02/2014, 13:20
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc
... 3), allowing both an amplitude and rate constant for the pre-steady state phase to be calculated. The parameters for both the steady state phase and the pre-steady state phase are given in Table ... JE & Dalziel K (1973) A conformational transition of the oligomer of glutamate dehydrogenase induced by half-saturation with NAD+ or NADP+. Biochim Biophys Acta 309, 237–242. 8 Alex S...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: A novel isoform of pantothenate synthetase in the Archaea potx
... of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans. Also, they are absent from the Bacteria and Eukaryota. All of the Archaea that have archaeal-type PS ... both ATP and ADP have a strong effect on the rate of the MM2281-catalyzed pantothenate–b-alanine exchange reaction. The simplest explanation for this behavior is that pantoate, A...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ACCACAGTCCATGCCATCAC GAPDH-R TCCACCACCCTGTTGCTGTA L. Vardouli et al. Rho GTPases ⁄ Smad proteins ... GGGATCAGAGTTCATAGTGAAAAGAG hRhoB +86 GCG AAGCTTCGGCCTAGCTCTCTCCCGGGTCTC hRhoA )799 GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTA...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf
... with buffer A. The desalted extract wasappliedtoa5mLAmersham/PharmaciaHi-trapQ anion exchange column that had previously been equili- brated with buffer A. The protein was eluted with a linear KCl ... m M phosphoenolpyru- vate 2 , and appropriate concentrations of UDP-glucose and fructose. Pyruvate kinase and lactate dehydrogenase were each added to a final activity of 4 UÆmL...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
... Gb3 synthase gene; Gb4, globotetraosylceramide (GalNAcb1,3Gala1,4LacCer); GD 1a, NeuAca2,3Galb1,3GalNAcb1,4(NeuAca2,3)LacCer; GD1b, Galb1,3GalNAcb1,4(NeuAca2,8NeuAca2,3)LacCer; GM1, Galb1,3GalNAcb1,4 (NeuAca2,3)LacCer; ... functional char- acterization of human cDNA for ganglioside GM3 synthase. J Biol Chem 273, 31652–31655. 26 Nomura T, Takizawa M, Aoki J, Arai H, Inoue K, Wakisaka E,...
Ngày tải lên: 30/03/2014, 01:20
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ (antisense). Caspase 3 activity Cells ... caspase assay were seeded on a 24-well plate and transfected with FuGENE 6. The caspase assay was performed using the CaspACE colorimetric assay kit as described by the manufacturer (Promega...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: A novel tachykinin-related peptide receptor of Octopus vulgaris – evolutionary aspects of invertebrate tachykinin and tachykinin-related peptide ppt
... receptors, and invertebrate tachykinins: a review. Zool Sci 5, 533–549. 7 Satake H, Ogasawara M, Kawada T, Masuda K, Aoy- ama M, Minakata H, Chiba T, Metoki H, Satou Y & Satoh N (2004) Tachykinin and ... vulgaris). Biochem J 387, 85–91. 25 Kanda A, Takahashi T, Satake H & Minakata H (2006) Molecular and functional characterization of a novel gonadotropin-releasing-hormone rec...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... only as a carbon source, but also as a nitrogen source for g rowth of the assimilating bacteria. Deaminases, which catalyze the release of ammonia, are a key enzyme in the metabolic pathways of ... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) w as from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydra...
Ngày tải lên: 19/02/2014, 16:20