... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... predictors of response to LAM and ADV therapies are similar to those for IFN except that baseline HBV DNA may not be very important Individualization of HBV Treatment As summarized in Table and ... important for planning and monitoring HBV treatment A low level of pre-treatment serum HBV DNA, high levels of ALT and histological activity, a history of adulthood HBV infection, and non-Asian...
... tableau a3 a5 a2 a2 T= a1 a1 a1 a4 is w(T ) = a3 a2 a1 a5 a2 a1 a1 a4 Note that applying the column insertion to the mirror image ofa tableau word w(T ) yields the tableau T Observe also (see ... Permutation, matrices and generalized Young tableaux, Pacific J Math., 34, 709–727, 1970 [13] D Krob, E .A Vassilieva, Performance analysisof demodulation with diversity – A combinatorial approach ... one to decide what was the value of the transmitted bit, and is also essential for various decoding algorithms such as MAP and its variants and Soft Output Viterbi Algorithm (SOVA) (see for example...
... {ACC) ( ACC ACT) {ACC ACT) {ACC ACT STA) (ACH ACT ACC ( ACC ACT) ) (STA ACC ACT ACH) (A C T ACC) (ACC) (ACC) (STA ACC ACT ACH) ~STA ACC ACT ACH) (ACC ACT) Figure 9: Aspectual Classification Results ... figure to determine 263 Aspectual Category(s) (ACC) (ACC ACT) (ACC ACT) (ACC) ~ACC ACT) (STA A C C A C T ACH) (STA A C C A C T A C H ) (ACC ACT STA) (ACC) (ACC) ~ACC ACT) ~ACC) ~ACC) (ACC ACT) {ACC) ... is an acceptable translation for (7)0) However, the same is not true of (7)(it): (9) (i) (it) Juan le dio pufialadaa a Maria Juan le dio una pufialada a Maria Juan h a b f a i d o a la tienda...
... Communications Research Laboratory of McMaster University as a Postdoctoral Fellow Since September 1997, he has been working in Ottawa, Canada He was a Research Scientist at Telexis Corporation and ... Intrinsix Canada, and a Research Consultant for Calian Corporation Currently, he works with Defence R & D Canada – Ottawa (DRDC Ottawa) His more recent research has focused on FFT filter-bank-based ... via two simple permutations A detailed analysisof the BCJR and the four modified BCJR MAP algorithms formulated in this paper shows that they all have identical computational complexities and...
... central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation:...
... derivln~ statistics for disambiguating parsing information A sample databank of constituent structures has therefore been manually compiled for initial trials of T-tag assignment and disambiguation ... of the T-tag look up procedure against samples of the corpus that have been manually parsed accordiug to the rules contained in the Case Law Manual ~here alternative T-tags are assigned for any ... prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either close a previously opened adjective phrase and continue an already...
... and a semantic role ofa head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... analysis (abbreviated to DBA hereafter) for semantic-role relations Semantic feature-based analysis (abbreviated to SBA hereafter) for some semanticrole relations and all other relations After briefly ... Meeting of ACL, pages 123-130, Stanford, California Eiichiro Sumita, Hitoshi Iida, and Hideo Kohyama 1990 Translating with examples: A new approachto machine translation In Proceedings of the...
... which accompany a current word may reveal that it could be a possible indicator ofa main clause, or subordinate clause, or a phrase If such is the case, an appropriate signal is added to the profile ... suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the translation task ... 34 (It is planned to expand this information to include diacritical material designed to aid in the semantic analysisof the sentence.) PART I Our program is being coded in two parts Of these only...
... step towards thermal analysis was man's realization that some materials are flammable Despite a reference to the power of fire, that is evident from early records, man at an early stage learned ... be capable of resorting overlapping data We can even joke that the best way to make some data inaccessible is to file them in a large database Curiously, large databases may be even seen to act ... cooling law in an effort to estimate the age of the Earth based upon an approximation of cooling rates of various substances He arrived to the value of 75 000 years Leibnitz in his 'Protogaea' assumed...
... so as to assign as accurately as possible new applicants to one of the two class labels For instance, a rule frequently applied is that a new applicant belongs to the class that contains the majority ... scores from external bureaus, data from application forms and data related to repayment histories and usages The latter are extra information that is not available when performing the credit ... estimates of the net present value and its variance for each risk category are key indicators for managers to make a decision of acceptance 2.3.2 Recent Developments Similar approaches were adopted...
... Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor public management model A Need for Transformation ... senior administrators and be great enough to send a message that a change is absolutely necessary Interested parties then come together to formulate a policy of transformation and to hammer out a ... attempting to impose a transformational change into their organizations (Slavin and Woodard 2006, 23): We close with a caution and a challenge Transformation has many elements, and the failure of any...
... orbital frontal cortex was greater for stimuli classified as beautiful, and the authors argued that this activation in the orbital frontal cortex was due to the reward value of beautiful paintings ... network than before, again including the occipital, temporal, and the frontal lobes, but in particular bilateral orbital frontal corlex What the results of Kawabata and Zeki (2004) and Skov ef al (2005) ... pictures, beautiful pictures activated a Wide A Biological Approachtoa Model of Aesthetic Experience 438 439 Chapter Twenty One network of areas including the occipital, parietal, and frontal lobes...
... analysisAnalysisof processes and operations within the organisation to identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure ... respect of all types of risk, and some organisations have produced a risk appetite statement that is applicable to all classes of risk It is fairly easy for an organisation to confirm that it has ... features of learning from experience include evaluation of audit reports and an assessment of the sources of risk assurance available to the Board and the audit committee An evaluation of the level of...
... GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter ... OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG ... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass...
... essential in bootstrapping to evaluate the quality of the patterns automatically IE and QA approaches, due to uniqueness assumptions of the real-world relations that these methods search for, have an ... non-interpolated Mean Average Precision (MAP), a standard measure for evaluating ranked information retrieval runs, which combines precision and recall and ranges from to 15 We use pairs of 2-tuples as ... Scholar to perform better than BNC as source for finding hypotheses for lexical variants, which may be due to the larger amount of data available to Google Scholar This seems to outweigh the disadvantage...
... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... Council of Canada [1] Reduplication is a word formation process involving the repetition ofa word or a part ofa word As an example, in Warlpiri there is a process of nominal reduplication to form ... here, although designed and implemented for Warlpiri, is intended to be a general approachto morphological parsing A number of extensions can easily be made and a number of design improvements are...
... health information to create an overall health index of use as an indicator of sustainable development IX APPROACHES TO SUSTAINABLE DEVELOPMENT INDICATORS This report spells out an approachto ... represents an attempt to reconcile or establish a balance among economic, social, and environmental factors As part of efforts to give the term operational meaning, many proposals for indicators of sustainable ... themselves may overlap (Resilience and stability, for instance, are similar.) The approach has been applied in an illustrative way to calculate an overall index for Costa Rica over a period of years...
... Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences, to meet new colleagues, and to see some unforgettable ... Monografia Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t) ... phenomena in paper, and to the properties of paper as a material In this thesis of basic research, an approach derived primarily from adsorption, adhesion, and polymer sciences was applied to study...
... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ... to them As a matter of fact, it turns out that the name Eatalian is actually used by at least one real Italian restaurant located in Los Angeles, CA3 For the same set of stimuli, the model also...
... design and Windows application programming It uses standard object-class libraries for screen management, standard relational database tools for control of the lexicon and standard code for FFT as ... basis of manner-class information alone and checks its conformance to the universal principles of grammar in GP as well as to languagespecific constraints In cases of conflict with either, a ... defining a quadratic discriminant based on the variance-covariance Figure Stagewise cue invocation strategy This launches the calculation of cues 4)5 (for the automatic segmentation process) and 4)6...