Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB ´ Jimmy Borloo*, Bjorn Vergauwen*, Lina De Smet, Ann Brige, Bart Motte, Bart Devreese and Jozef Van Beeumen Laboratory for Protein Biochemistry and Protein Engineering, Ghent University, Belgium Keywords kinetic enzyme parameters; metal reduction; outer membrane cytochromes c OmcA and OmcB; Shewanella oneidensis MR-1; terminal reductases Correspondence J Borloo, Laboratory for Protein Biochemistry and Protein Engineering, Ghent University, K.L Ledeganckstraat 35, B-9000 Ghent, Belgium Fax: +32 264 52 73 Tel: +32 264 51 26 E-mail: jimmy.borloo@ugent.be Website: http://www.eiwitbiochemie.ugent be/index.html *These authors contributed equally to this work (Received 28 April 2007, revised 25 May 2007, accepted 30 May 2007) doi:10.1111/j.1742-4658.2007.05907.x The Gram-negative bacterium Shewanella oneidensis MR-1 shows a remarkably versatile anaerobic respiratory metabolism One of its hallmarks is its ability to grow and survive through the reduction of metallic compounds Among other proteins, outer membrane decaheme cytochromes c OmcA and OmcB have been identified as key players in metal reduction In fact, both of these cytochromes have been proposed to be terminal Fe(III) and Mn(IV) reductases, although their role in the reduction of other metals is less well understood To obtain more insight into this, we constructed and analyzed omcA, omcB and omcA ⁄ omcB insertion mutants of S oneidensis MR-1 Anaerobic growth on Fe(III), V(V), Se(VI) and U(VI) revealed a requirement for both OmcA and OmcB in Fe(III) reduction, a redundant function in V(V) reduction, and no apparent involvement in Se(VI) and U(VI) reduction Growth of the omcB– mutant on Fe(III) was more affected than growth of the omcA– mutant, suggesting OmcB to be the principal Fe(III) reductase This result was corroborated through the examination of whole cell kinetics of OmcA- and OmcBdependent Fe(III)-nitrilotriacetic acid reduction, showing that OmcB is $ 11.5 and $ 6.3 times faster than OmcA at saturating and low nonsaturating concentrations of Fe(III)-nitrilotriacetic acid, respectively, whereas the omcA– omcB– double mutant was devoid of Fe(III)-nitrilotriacetic acid reduction activity These experiments reveal, for the first time, that OmcA and OmcB are the sole terminal Fe(III) reductases present in S oneidensis MR-1 Kinetic inhibition experiments further revealed vanadate (V2O5) to be a competitive and mixed-type inhibitor of OmcA and OmcB, respectively, showing similar affinities relative to Fe(III)-nitrilotriacetic acid Neither sodium selenate nor uranyl acetate were found to inhibit OmcA- and OmcB-dependent Fe(III)-nitrilotriacetic acid reduction Taken together with our growth experiments, this suggests that proteins other than OmcA and OmcB play key roles in anaerobic Se(VI) and U(VI) respiration Shewanella oneidensis MR-1 is a Gram-negative c-proteobacterium with an extremely versatile anaerobic respiratory metabolism Under anaerobic conditions, this organism reduces a variety of organic and inorganic substrates, including fumarate, nitrate, trimethylamine N-oxide, dimethylsulfoxide, sulfite and thiosulfate, as well as various polyvalent metal ions and radionuclides, including iron(III), manganese(IV), chromium(VI), vanadium(V), selenium(VI), uranium(VI), and tellurium(VI) [1–7] Bacterial dissimilatory metal Abbreviation FR, fumarate reductase 3728 FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS J Borloo et al reduction is known to account for the majority of the valence transitions of Fe(III) to Fe(II) in anoxic, nonsulfidogenic and low-temperature environments Furthermore, microbial metal reduction represents a potential strategy for the in situ immobilization and containment of contaminant metals and radionuclides in aqueous waste streams and subsurface environments, as some of these metals precipitate upon reduction [6,8] Although the importance of bacterial dissimilatory metal reduction in controlling the fate and transport of metals and their potential for remediation purposes are well recognized, the terminal reductases involved are not yet identified, and nor are they sufficiently characterized, as kinetic information on metal reduction is scarce The electron transport chain involved in the reduction of either Fe(III) or Mn(IV) in MR-1 is thought to be composed of cytochromes and a quinone, located in both the cytoplasmic membrane (CymA and menaquinone) and the outer membrane (OmcB, and a partial role for OmcA) [4,9–11] The 21 kDa tetraheme cytochrome c CymA (SO_4591) and menaquinone are believed to be common central components in the electron transport chain that branch to several reductases downstream, as cymA– or menaquinone-deficient strains lose their ability to grow anaerobically on Fe(III), Mn(IV), V(V), nitrate, fumarate and dimethylsulfoxide [9,10,12] OmcA (SO_1779) and OmcB (SO_1778) are outer membrane decaheme lipoprotein cytochromes c [13,14] that are specifically involved in metal reduction, although distinct functions have been proposed OmcB-negative MR-1 mutants are heavily affected in either Fe(III), Mn(IV) or V(V) reduction, whereas the absence of OmcA results in metal reduction rates that are 55% and 62% of those of the MR-1 parent strain for Mn(IV) and V(V), respectively [10] Purified and dithionite-reduced preparations of both outer membrane proteins were recently shown to directly transfer electrons to chelated Fe(III) at comparable rates (kcat values ranging between 1.5 and 4.1 s)1), whereas only reduced OmcB was shown to be oxidized by uranyl acetate (kcat < 0.01 s)1) [15] Taken together, OmcA and OmcB function as metal reductases in MR-1, albeit apparently behaving kinetically differently and displaying a rather undefined metal specificity To address these latter issues, we constructed omcA, omcB and omcA ⁄ omcB insertion mutants of MR-1, and analyzed them in terms of dissimilatory reduction of a variety of metals, i.e Fe(III), V(V), U(VI), and Se(VI) A ‘whole cell’ kinetics approach was used to determine the kinetic parameters for OmcA- and OmcB-dependent chelated Fe(III) reduction, which are Shewanella oneidensis MR-1 OmcA and OmcB kinetics shown to corroborate the results of inhibition and liquid growth experiments These results identify OmcA and OmcB, for the first time to our knowledge, as the sole terminal Fe(III) reductases, and additionally provide novel insights into the dependence of dissimilatory metal reduction by MR-1 on OmcA and OmcB Results Growth analyses of anaerobically metal-respiring omcA–, omcB– and omcA– omcB– MR-1R mutants relative to their MR-1R parent To study the substrate specificities of the outer membrane decaheme cytochromes OmcA and OmcB in the process of dissimilatory metal reduction, omcA–, omcB– and omcA– omcB– MR-1R mutants were constructed and evaluated in liquid broth growth experiments with lactate as electron donor and either Fe-nitrilotriacetic acid, Fe-citrate, V2O5, Na2SeO4 or UO2(CH3COO)2.2H2O as the terminal electron acceptor Complete growth curves were recorded for each experiment; those of MR-1R grown on the different metals are shown in Fig 1B, whereas the increases in density at day of MR-1R and of all mutants are summarized in Fig 1A For chelated forms of Fe(III) and for V2O5, culture turbidities gradually decreased > in the order MR-1R > omcA– > omcB– > omcA– omcB–, with the greatest effect being caused by the omcB disruption OmcA and OmcB are collectively essential for chelated Fe(III) dissimilatory reduction, as the omcA– omcB– double mutant cannot grow on either Fe(III)-nitrilotriacetic acid or Fe(III)-citrate, whereas they appear to have an important, although redundant, function as a terminal V(V) reductase, as the omcA– omcB– double mutant still reaches $ 50% of the MR-1R turbidity Knocking out either omcA or omcB turned out to have no significant growth phenotype with either U(VI) or Se(VI) as the terminal electron acceptor These results therefore provide evidence that there are differences between the electron transfer pathways towards chelated Fe(III) on the one hand and either U(VI) or Se(VI) on the other Redundancy between these pathways may explain the growth curves observed for V(V) reduction Decaheme cytochrome c quantification of anaerobically Fe(III)-respiring omcA–, omcB– and omcA– omcB– MR-1R mutants relative to their MR-1R parent The major impact on Fe(III) respiration by OmcB relative to OmcA can be explained by one or a combination FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS 3729 Shewanella oneidensis MR-1 OmcA and OmcB kinetics J Borloo et al Fig Anaerobic liquid growth experiments assess the role of OmcA and OmcB in dissimilatory metal reduction Anaerobic liquid growth of MR-1R, omcA–, omcB– and omcA– omcB– mutant cultures with either Fe(III)-nitrilotriacetic acid, Fe(III)-citrate, V(V), U(VI) or Se(VI) as terminal electron acceptor is represented as the increase in density reached after days of growth (A) Complete curves of MR-1R grown on the different metals are provided in (B) of the following possibilities: (a) the steady-state OmcB concentration is greater than that of OmcA; (b) OmcB is differentially produced (upregulated) by the omcA insertional inactivation, but not vice versa; (c) OmcA and OmcB show different behavior patterns in terms of kinetics; and (d) OmcB is required to obtain functional OmcA These possibilities are discussed below A heme-staining approach was used to reveal the decaheme cytochrome c pools present in Fe(III)-respiring MR-1 omcA–, omcB– and omcA– omcB– mutants relative to their MR-1R parent Figure 2B shows the absence of mature OmcA (83 kDa) and OmcB (78 kDa) in an omcA– and an omcB– background, respectively, a complete lack of both proteins in the omcA– omcB– double mutant, and approximately equal amounts of either decaheme cytochrome c in an MR-1R extract Relative to MR-1R, Fig 2B does not 3730 suggest compensatory induction of either OmcB or OmcA in an omcA– or omcB– background, respectively To calculate the OmcA and OmcB content in Fe(III)-respiring MR-1R and single mutants, differential absorption spectra for reduced-minus-oxidized heme were recorded (Fig 2D) As these spectra are based on total heme content, it is imperative that all the other heme-containing proteins in the cells are not subjected to regulation in the respective mutants Figure 2B,C shows that, apart from OmcA and OmcB, the periplasmic fumarate reductase (FR), the cytoplasmic CymA and other, smaller (< 20 kDa), cytochromes are highly abundant c-type cytochromes in MR-1R, and thus contribute substantially to the 554 nm absorbance Although not fully linear and saturating with increasing cytochrome content, the heme staining experiments are indicative of the fact that these cytochromes are not subjected to upregulation or downregulation in the analyzed mutants We furthermore monitored and compared FR activities in wildtype MR-1R and mutants The enzyme assay yielded activity values of (in lmolỈmin)1Ỉmg)1) 43.8 ± 0.90, 42.9 ± 0.58, 43.0 ± 0.24 and 44.3 ± 0.70 for MR-1R, omcA–, omcB– and omcA– omcB–, respectively, indicating no upregulation or downregulation of FR (P ¼ 0.83) On the basis of the fact that FR is not subjected to regulation under the applied conditions, and deducing from Fig 2C that all other c-type cytochromes are also invariantly produced in the respective mutants, we feel safe to extract OmcB and OmcA concentrations from omcA– and omcB– mutant heme values minus omcA– omcB– double mutant values, respectively The concentrations of OmcA and OmcB were subsequently calculated on the basis on the known stoichiometry of 10 heme groups per OmcA or OmcB molecule [16] This approach is valid, because no alterations other than the expected disappearance of either or both OmcA and OmcB in the respective mutants are apparent from the heme-staining gels The omcA– background contains 4.00 pmol of OmcB per 109 cells, which, as to be expected from the heme stain in Fig 2B, is similar to the OmcA concentration calculated for the omcB– background (3.43 pmol per 109 cells) By subtracting the heme concentration of the omcA– omcB– double mutant from that of MR-1R cells, we calculated a decaheme cytochrome c content (OmcA + OmcB) in MR-1R of about 6.68 pmol per 109 cells This value matches the sum of both decaheme cytochrome c concentrations in the respective single mutants, again showing that neither decaheme cytochrome c is upregulated in the absence of the FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS J Borloo et al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum of the values of the omcA– and the omcB– mutants revealed that there is no statistically significant difference (P ¼ 0.43) Shewanella oneidensis MR-1 OmcA and OmcB kinetics Fig Heme quantifications reveal unaltered protein production profiles of both OmcA and OmcB in the respective single mutants relative to the wild-type (A) RT-PCR confirming the absence of polar effects in mutants omcA– and omcB– Specific oligonucleotides were used to amplify omcA (lane 2), omcB (lane 3), mtrA (lane 4) and mtrB (lane 5) in the omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass cytochromes c through heme staining of a Tris ⁄ glycine SDS ⁄ PAGE gel loaded with · 107 whole cells from anaerobically grown overnight cultures of MR-1R (lane 1), mutants omcA– (lane 2), omcB– (lane 3), and omcA– omcB– (lane 4), and complemented strains omcA– ⁄ pBAD202 ⁄ D-TOPOomcA (lane 5) and omcB– ⁄ pBAD202 ⁄ D-TOPOomcB (lane 6) A molecular mass standard is indicated at the right (C) Visualization of low molecular mass cytochromes c through heme staining of a Tricine ⁄ SDS ⁄ PAGE gel loaded with · 107 whole cells from anaerobically grown overnight cultures of MR-1R (lane 1), and mutants omcA– (lane 2), omcB– (lane 3), and omcA– omcB– (lane 4) A molecular mass standard is indicated at the left (D) Bar graph representation of the cytochrome content, normalized to 109 CFU, and calculated from reduced-minus-oxidized heme absorption differences at 554 nm (a peak) using the absorption coefficient of 21 400 M)1Ỉcm)1 The differences in peak height reflect the concentrations of OmcA and OmcB in omcB– and omcA– cells, respectively Maximal activities were converted to turnover numbers on the basis of either the OmcA or OmcB concentrations calculated in the above paragraph for the omcB– and omcA– single mutants, respectively As explained in Experimental procedures, Monod-based kinetic models for whole cell kinetics simplify to Michaelis– Menten models under the conditions applied in this study Figure 3A shows Fe(III)-nitrilotriacetic acid saturation curves obtained using either omcA– [OmcBdependent Fe(III) reduction], omcB– [OmcA-dependent Fe(III) reduction] or MR-1R [OmcA + OmcBdependent Fe(III) reduction] cells In the absence of Table Enzymatic properties of OmcA- and OmcB-dependentFe(III)-nitrilotriacetic acid reduction Values represent the average of triplicate experiments ± SD Enzymatic properties Whole cell kinetics of OmcA- and OmcB-dependent chelated Fe(III) reduction To establish whether differential kinetics and ⁄ or synergism explain the dominance of OmcB over OmcA in dissimilatory chelated Fe(III) reduction, we determined the kinetic parameters for each decaheme cytochrome c using intact actively Fe(III)-respiring cells (Table 1) Fe(III)-nitrilotriacetic acid Km (lM) kcat (s)1) kcat ⁄ Km (M)1Ỉs)1) V2O5 Inhibition type Kic Kiu FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS OmcA OmcB 15.3 ± 2.1 17.8 ± 0.4 1.17 · 106 28.0 ± 0.9 205 ± 3.0 7.33 · 106 Competitive 22.5 ± 1.0 Mixed type 65.9 ± 0.1 11.5 ± 0.6 3731 Shewanella oneidensis MR-1 OmcA and OmcB kinetics J Borloo et al ally determined activities at nonsaturating Fe(III)nitrilotriacetic acid concentrations This suggests that OmcA might synergistically enhance, albeit slightly, the affinity of OmcB for its metal substrate However, the curves totally refute the reverse possibility, i.e that OmcB is needed to get functional OmcA On the other hand, the derived kinetic parameters for OmcA- and OmcB-dependent chelated Fe(III) reduction summarized in Table rationalize the dominance of OmcB in dissimilatory Fe(III) reduction: under physiologically relevant low micromolar concentrations of Fe(III), OmcA should outnumber OmcB six-fold to catalyze electron transfer at a similar rate Complementation of the omcA– and omcB– mutants restored Fe(III)-nitrilotriacetic acid reduction activity to MR-1R levels (Fig 3B) Inhibition assays of OmcA- and OmcB-dependent chelated Fe(III) reduction as a measure of enzyme specificity Fig Kinetic characterization of OmcA- and OmcB-dependent Fe(III)-nitrilotriacetic acid reduction rationalizes the dominance of OmcB in anaerobic ferric iron respiration (A) Monod-based kinetic model curves [34] for Fe(III)-nitrilotriacetic acid reduction by MR-1R cells (inverted triangles), omcA– cells (squares), and omcB– cells (triangles) As explained in Experimental procedures, the two latter curves simplify to the Michaelis–Menten formulation under the conditions applied Adding up these curves generates the dotted-line curve, which, as explained in Experimental procedures, should resemble the MR-1R curve Because this assumption is only valid at saturating Fe(III)-nitrilotriacetic acid concentrations, slight synergy may modulate activity when both OmcA and OmcB are present in the outer membrane (B) In trans complementation of omcA– and omcB– cells restores Fe(III) reductase activity to MR-1R levels See Experimental procedures for details synergism, the OmcA- and OmcB-dependent substrate saturation curves should add up to form the MR-1R (OmcA + OmcB) curve; this is a valid assumption, as we could not identify differential protein production profiles as mentioned in the previous paragraph At full Fe(III)-nitrilotriacetic acid saturation, the modeled summation function corresponds well with the MR-1R curve, whereas it shows slightly lower than experiment3732 To determine whether the lack of phenotype of omcA– omcB– strains observed during anaerobic growth on either of the electron acceptors U(VI) and Se(VI) is due to the decaheme cytochromes c not recognizing either of these electron acceptors, we probed the relative affinities via competition assays Figure shows the IC50 plots of the inhibition data of whole cell OmcA- and OmcB-dependent Fe(III)-nitrilotriacetic acid reduction by either V(V), U(VI), or Se(VI) Only V(V) appears to significantly inhibit Fe(III) reduction, as characterized by IC50s of 10.7 lm and 81.4 lm for inhibition of OmcA and OmcB, respectively Modes of inhibition of either OmcA or OmcB by V(V) The modes of inhibition of either OmcA- or OmcBdependent Fe(III)-nitrilotriacetic acid reduction by V(V) were investigated for the two following reasons: (a) to derive the relevant inhibition constants; and (b) to establish whether both decaheme cytochromes c may differ mechanistically Fe(III)-nitrilotriacetic acid saturation curves in the absence and in the presence of two different concentrations of V(V) were plotted and modeled to obtain the apparent Vmax and Km values (Fig 5A,B) These parameters were subsequently used to generate double-reciprocal Lineweaver–Burk plots to easily determine inhibitor modality (Fig 5C,D; Table 1) OmcA inhibition by V(V) is characterized by an increase in apparent Km and no change in apparent FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS J Borloo et al Shewanella oneidensis MR-1 OmcA and OmcB kinetics Fig Competition assays of OmcA- (left panel) and OmcB-dependent (right panel) Fe(III)-nitrilotriacetic acid reduction with other metals show that only V(V) may represent an alternative substrate for both cytochromes Fe(III)-nitrilotriacetic acid reductase activity in the absence of a competing metal substrate is set to 100% Relative activities are plotted as a function of increasing concentrations of either V(V) (as vanadate; red), U(VI) (as uranyl acetate; green), or Se(VI) (sodium selenate; purple) Inhibition curves were fitted to the standard hyperbolic inhibition equation (see Experimental procedures) Fig Analysis of the modes of inhibition of OmcA- and OmcB-dependent Fe(III) reduction by V(V) reveals mechanistic differences between the two cytochromes (A, B) Direct plots of the steady-state velocities of OmcA-dependent (A) and OmcB-dependent (B) Fe(III)-nitrilotriacetic acid reduction in the absence and the presence of two increasing V(V) concentrations (C, D) Theoretical double reciprocal plots using the kinetic parameters obtained by fitting the data from the direct plots Vmax, generating Lineweaver–Burk lines with intersecting y-axis intercepts, which is the characteristic signature of competitive inhibition We calculated a Ki value of 22.5 lm, suggesting that the kinetics of V2O5 binding to OmcA are similar to those for binding of Fe(III)-nitrilotriacetic acid FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS 3733 Shewanella oneidensis MR-1 OmcA and OmcB kinetics J Borloo et al OmcB inhibition by V(V) is characterized by a decrease in apparent Km and Vmax By plugging the values of the modeled apparent kinetic parameters into the double-reciprocal Lineweaver–Burk equation and plotting the resulting linear functions, we obtained the graph in Fig 5D The lines intersect at negative values of ⁄ [S] and ⁄ v, which is a characteristic signature of noncompetitive inhibition Thus, V(V) apparently binds both the free OmcB enzyme and the binary OmcB–Fe(III)-nitrilotriacetic acid complex, and the binding is kinetically favored upon Fe(III)-nitrilotriacetic acid binding We calculated Kic and Kiu values of 65.9 lm and 11.5 lm, respectively, which again appears to have physiologic significance Hence, besides having significantly different turnover rates, OmcA and OmcB may also behave differently in terms of binding their metallic substrates Discussion In the present study, we could not detect anaerobic Fe(III)-nitrilotriacetic acid respiration for omcA– omcB– double mutant cells Virtually no biomass was generated in minimal medium containing lactate and Fe(III)-nitrilotriacetic acid as the electron donor and acceptor, respectively (Fig 1), and baseline reduction of Fe(III)-nitrilotriacetic acid was seen in the ferrozine-based whole cell kinetic approach (data not shown) The collective action of both decaheme cytochromes c, OmcA and OmcB, appears to be crucial for anaerobic soluble Fe(III) respiration, and, because of their outer membrane localization, one or both cytochromes probably function as terminal Fe(III) reductases Both these outer membrane-localized cytochromes are reduced through an as yet incompletely identified electron transport chain, which at an early point receives electrons from the NADH pool, in our study obtained by lactate supplementation In a recent study, Marshall et al [15] established almost equally fast direct electron transfer from either dithionitereduced MR-1 OmcA or OmcB to chelated Fe(III), providing the first biochemical evidence that both decaheme cytochromes c are in fact functional Fe(III) reductases As an OmcA ⁄ OmcB double mutant strain does not show any Fe(III) reduction activity, our study not only strengthens, but also exceeds, this evidence, in that OmcA and OmcB are found to be the sole Fe(III) reductases present in MR-1 Furthermore, the outer membrane localization and partial extracellular exposure of both cytochromes c, combined with the fact that the result of adding up the OmcA and OmcB Fe(III)-nitrilotriacetic acid reduction curves conforms to the MR-1R curve, allow us to deduce that the electron transport 3734 chain does not bifurcate any further, but ends at this point before transferring electrons to the subject metal species, indicating that OmcA and OmcB are the terminal Fe(III) reductases in MR-1 Other MR-1 cytochromes c, previously shown to be ferric iron reductases in vitro, such as MtrA [17] and Ifc3 in S frigidimarina [18], appear to be not directly involved in the process of anaerobic chelated Fe(III) respiration Notably, the apparent maximal rate reported for Fe(III)-nitrilotriacetic acid-dependent OmcB oxidation is approximately 50 times slower than the kcat for OmcB-dependent Fe(III)-nitrilotriacetic acid reduction (205 s)1), determined here using a whole cell kinetics approach, which has the advantages of: (a) maintaining the complete electron transport chain used during metal respiration; and (b) keeping the terminal reductases in their native cellular compartment For OmcA, the in vitro Kobs values determined by Marshall et al [15] and the in vivo kcat values determined in our study also differ, although to a lesser extent (six-fold) This discrepancy can most likely be accounted for by the fact that the purified cytochromes used in the in vitro approach lack some factor(s), such as one or more protein partners or lipids that generate maximal activity Reduced activity due to detergent-based solubilization of the outer membrane cytochromes is an alternative explanation Growth experiments as well as the whole cell Fe(III) reduction kinetics presented here agree with previous findings that OmcB is more important than OmcA in anaerobic Fe(III) respiration [19] Using a heme-quantification approach, we have presented evidence showing that this relative difference is not based on differential protein production profiles of either the omcA or omcB gene in the presence or absence of the other Shi et al [19] provided evidence for synergistic complex formation between both decaheme cytochromes, which may explain the dominance of OmcB over OmcA in dissimilatory Fe(III) reduction Our whole cell-based kinetic analysis, however, refutes the possibility that OmcB is necessary to reconstitute fully functional OmcA, as the Fe(III)-reducing activities of omcA– and omcB– cells add up to the counterpart activities of MR-1R cells A perfect fit, however, only becomes possible after slightly increasing the affinity of OmcB for its chelated Fe(III) substrate (Fig 3A) Complex formation may thus cause some synergism only at low micromolar and therefore physiologically relevant substrate concentrations The kinetics for OmcA- and OmcB-dependent Fe(III)-nitrilotriacetic acid reduction (Table 1) rationalize the different roles of these proteins in Fe(III) respiration Both cytochromes have similar low micromolar affinities for their Fe(III) substrate; however, FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS J Borloo et al completion of the electron transfer pathway takes $ 11.5 times longer for OmcA than for OmcB Taking into account the specificity constants, OmcA should outnumber OmcB about six-fold if it is to substitute for the latter in anaerobic Fe(III) respiration at physiologic ferric iron concentrations, a hypothesis that will be pursued further in our laboratory Note that the division of labor established here for OmcA and OmcB cytochromes should not necessarily apply to homologs from different backgrounds; the OmcA homolog from S frigidimarina, for example, has been found to be as fast (206 s)1) as the S oneidensis MR-1 OmcB reductase [20] It has previously been recognized that both cytochromes, OmcA and OmcB, appear to have some substrate specificity, as purified reduced batches lack activity towards nitrite, nitrate and, in the case of OmcA, uranyl acetate [15] OmcB was shown to have some activity towards U(VI); however, the turnover number (Kobs1 ¼ 0.039 s)1) is more than 100 times lower than that for Fe(III)-nitrilotriacetic acid (Kobs1 ¼ 4.1 s)1) [15] Our anaerobic growth experiments show that neither decaheme cytochrome c is necessary for dissimilatory uranyl acetate reduction (Fig 1) OmcA, as expected, but also OmcB does not bind U(VI) in the competition assay shown in Fig The 100-fold lower Kobs1 for U(VI) reduction compared to Fe(III)-nitrilotriacetic acid reduction reported by Marshall et al [15] thus appears to result not from disturbed catalysis, but rather from hampered substrate binding Of the other metals tested in this study [V(V) and Se(VI)], only vanadate was shown to be a substrate for either OmcA or OmcB Inhibition experiments suggest that Fe(III) and V(V) bind both cytochromes with similar efficiencies (Table 1) However, whereas omcA– omcB– double mutant cells did not grow on chelated Fe(III), they grow on V(V) to about 50% of the MR-1R stationary-phase density (Fig 1) In the case of V(V), the electron transport chain may thus bifurcate to one or several other, as yet unrecognized, terminal reductases Redundancy in terminal metal reductases has been clearly shown here, as MR-1 does not suffer from the omcA– omcB– double mutants in anaerobic growth on the terminal electron acceptors Se(VI) and U(VI), and as none of these metals inhibits OmcA- and OmcB-dependent whole cell Fe(III)-nitrilotriacetic acid reduction In summary, metal reduction appears to be a selective process in which the reduction potential and the topology and accessibility of the presented metal play crucial roles in terms of binding efficiencies and subsequent reduction by the appropriate enzyme The identification and characterization of alternative terminal metal reductases will be the subject of future research Shewanella oneidensis MR-1 OmcA and OmcB kinetics Experimental procedures Bacterial strains S oneidensis MR-1 was originally isolated from Oneida Lake sediments (Oneida Lake, NY, USA) [21], and was obtained from the LMG culture collection (LMG 19005; Ghent, Belgium) S oneidensis MR-1R is a spontaneous rifampicin-resistant mutant of strain MR-1 that was isolated in-house Escherichia coli strain TAM1pir+ and E coli S171kpir cells were used for cloning purposes and conjugation experiments, respectively Growth conditions MR-1R, omcA–, omcB– and omcA– omcB– S oneidensis cultures were routinely grown overnight at 28 °C in LB broth and subsequently inoculated in M1 defined medium [22] supplemented with l-serine (1 lgỈmL)1), l-arginine (1 lgỈmL)1), l-glutamate (1 lgỈmL)1), lactate (15 mm), and fumarate (20 mm) For growth experiments, fumarate was replaced by either Fe(III)-citrate (2 mm), Fe(III)-nitrilotriacetic acid (0.5 mm), Na2SeO4 (1 mm), or UO2(CH3COO)2.2H2O (0.5 mm) (all products: Sigma-Aldrich, Bornem, Belgium) Growth on V(V) was studied using VM medium [23] Anaerobicity was achieved using a Coy anaerobic chamber (Coy Laboratories, Grass Lake, MI) containing 90% N2, 8% CO2, and 2% H2 The presence of H2 in the anaerobic chamber did not affect metal reduction (data not shown) Growth curves were recorded by measuring the attenuance (D655) of the cultures at regular time intervals for days The average rise in density after days ± SEM for triplicate readings are summarized in Fig 1A, whereas the growth curves for MR1R grown on the different metals are shown in Fig 1B Construction of the omcA– and omcB– single mutants and of the omcA– omcB– double mutant strains of MR-1 Single omcA– and omcB– mutants and a double omcA– omcB– mutant strain of MR-1 were generated by insertional inactivation using the pKNOCK-based system [24] The primers used in this study are summarized in Table Briefly, internal PCR-amplified fragments of the omcA and omcB genes were 5¢-phosphorylated and cloned into EcoRV-digested and calf intestinal phosphatase-treated pKNOCK-Km and pKNOCK-Cm, respectively, using T4 DNA Ligase (all enzymes: New England Biolabs, Ipswich, MA), yielding pKNOCK-Km-omcA and pKNOCK-Cm-omcB These constructs were transformed into E coli S17-1kpir cells Equal amounts of overnight-grown transformed E coli S17-1kpir cells and rifampicin-resistant S oneidensis cells were mixed and spotted on LB ⁄ Rif plates (10 lgỈmL)1) After a h incubation period (necessary for the conjugation to take place), the cells were resuspended in 500 lL of LB broth [25] and FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS 3735 Shewanella oneidensis MR-1 OmcA and OmcB kinetics J Borloo et al plated on LB ⁄ Rif plates containing either kanamycin (25 lgỈmL)1) or chloramphenicol (25 lgỈmL)1) (Duchefa, Haarlem, The Netherlands) After overnight incubation at 28 °C, colonies were analyzed via PCR using the oligonucleotides OMCA-F ⁄ OMCA-R and OMCB-F ⁄ OMCB-R (Table 2), designed to amplify the entire omcA gene and omcB gene, respectively Homology-based insertional integration of the pKNOCK constructs enlarged the omcA (2207 bp) and omcB (2015 bp) gene amplicons by 2700 and 2500 bp, respectively (data not shown) The omcA– omcB– double mutant was constructed by applying a similar procedure to that described above, using the omcA– mutant as the recipient strain in conjugation As omcA and omcB are part of the gene cluster mtrDEF–omcA–mtrCAB (omcB is also known as mtrC), and the genes mtrCAB form a single operon, we expected polar effects to occur when disrupting omcB RT-PCR experiments proved the absence of such polar effects (Fig 2A) and confirmed that we had obtained the omcA– and the omcB– mutants Complementation of the MR-1 omcA– and omcB– mutant strains Oligonucleotides OMCA-PBAD-F ⁄ OMCA-PBAD-R and OMCB-PBAD-F ⁄ OMCB-PBAD-R (Table 2) were used to amplify the omcA and omcB genes from MR-1 genomic DNA, respectively These genes were subsequently cloned into vector pBAD202 ⁄ D-TOPO (Invitrogen, Carlsbad, CA), and the constructs were transformed into the appropriate omcA– or omcB– mutants of MR-1 by electroporation, generating the in trans complemented strains As pBAD202 ⁄ D-TOPO carries a kanamycin resistance region, the ability to complement the omcA– mutant was shown using a pKNOCK-Cm-based omcA– mutant, instead of the pKNOCK-Km-based mutant that was applied in all other experiments Full complementation of either the omcA or omcB insertional mutation by the wild-type genes, Table Synthetic oligonucleotides used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE gels (Fig 2B), as well as at the level of activity (see further) Visualization of c-type cytochromes using heme staining High and low molecular mass c-type cytochromes were resolved by SDS ⁄ PAGE according to Laemmli [27] and Schaegger & von Jagow [28] (tricine gels), respectively In either case, · 107 whole cells of anaerobically grown overnight cultures were applied to the gels, which were then heme stained according to Thomas et al [29] The outer membrane cytochromes c OmcA and OmcB, the periplasmic FR, and the cytoplasmic tetraheme cytochrome c CymA were unambiguously identified via MS from hemestained Tris ⁄ glycine gels and tricine gels, respectively Spectral quantification of the outer membrane decaheme cytochromes c OmcA and OmcB The heme content of whole cells was determined using the difference absorption coefficient of 21 400 m)1Ỉcm)1 [16] at 554 nm for the pyridine ferrohemochrome minus pyridine ferrihemochrome spectrum In that study, the difference absorption coefficient was determined at pH 8.0, whereas all our experiments were carried out at pH 7.5 We observed no differences between spectra measured at pH 8.0 and 7.5 (data not shown) Sodium dithionite was used as the reducing chemical Overnight anaerobically grown cells (with 20 mm fumarate as the electron acceptor) were washed with and suspended in an equal volume of air-saturated NaCl ⁄ Pi (pH 7.5), and incubated at room temperature for h to ensure oxidation of the outer membrane cytochromes Absorption spectra of mL fractions were recorded at 554 nm using a double-beam spectrophotometer (Uvikon, Kontron, Herts, UK) in the absence and the presence of a few crystals of sodium dithionite (Sigma-Aldrich) The decaheme cytochrome c concentration was calculated as explained in Results, taking into account 10 heme groups per molecule of either OmcA or OmcB and our experimentally derived correlation between D655 and cell concentration (a mL MR-1 culture with a D655 of 1.0 contains 1.44 · 109 cells) The values presented are means of triplicate experiments ± SEM To quantify FR, lysed MR-1R omcA–, omcB– and omcA– omcB– cells were assayed for this specific enzyme activity according to Maklashina et al [30] Whole cell kinetics of ferric iron reduction The Fe(III) reductase activity of whole cells was measured using the ferrozine-based method [31] The chromophore formed by ferrous iron and ferrozine was measured at 562 nm [32] Whole cells for the Fe(III) reductase assays were FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS J Borloo et al prepared as follows Anaerobically grown cells (with fumarate as the terminal electron acceptor) were collected by centrifugation at 10 000 g (Beckman Coulter Avanti J-301 centrifuge, JA-30.50 rotor), washed twice with NaCl ⁄ Pi supplemented with mm lactate (unless otherwise mentioned), and placed on ice These preparations retained full activity for at least h Comparison of the reduced-minus-oxidized spectra of anaerobically grown MR-1R cells washed with NaCl ⁄ Pi (pH 7.5) on the one hand, or water on the other, revealed no differences in heme content, indicating that the salt treatment did not lead to unwanted release of outer membrane cytochromes Assays were conducted in microtiter plates at 25 °C in a final volume of 200 lL of NaCl ⁄ Pi (pH 7.4), and were monitored using a Bio-Rad model 680 microplate reader (Bio-Rad, Hercules, CA) A standard reaction mixture contained mm 3-(2-pyridyl)-5,6-bis(4-phenylsulfonic acid)-1,2,4-triazine monosodium salt (ferrozine; Sigma-Aldrich), mm lactate (unless otherwise mentioned), a : 100 dilution of the washed cell preparation, and Fe(III)nitrilotriacetic acid at concentrations ranging from 0.5 lm to 1.5 mm Phosphate did not interfere with the reduction assay (data not shown), which is in accordance with the results reported by Ruebush [33] For inhibition studies, the standard reaction mixture containing 100 lm Fe(III)-nitrilotriacetic acid (unless otherwise mentioned) was supplemented with either V(V) (as V2O5), Se(VI) (as Na2SeO4) or U(VI) [as UO2(CH3COO)2.2H2O], ranging in concentration from 0.5 lm to mm Inhibition curves were fitted using a least squares algorithm (graphpad prism Version 4.00; GraphPad Software, Inc., San Diego, CA) to the equation: mr ¼ 100 Imax ẵMe=IC50 ỵ ẵMeịị where vr is the relative activity, Imax is the maximal response amplitude, [Me] is the supplemented initial concentration of inhibiting metallic substrate, and IC50 is the half-maximal concentration of inhibiting metallic substrate To analyze kinetic data, we used Monod-based kinetic models [34] that actually simplify to a Michaelis–Menten formulation under the applied conditions The kinetic rate is determined solely by the electron acceptor, as the electron donor used (lactate, mm) is supplied in excess The effect of bacterial growth on Fe(III)-nitrilotriacetic acid reduction can be neglected, as the initial cell concentration used was high, and growth-supporting nutrients were excluded We also assumed that cell decay can be neglected, because the activity proceeded linearly during our h analyses Therefore, the Monod model takes a form similar to the Michaelis–Menten expression v ¼ VmS ⁄ (Ks + S), where Vm equals the maximal activity for the initial bacterial concentration, S is the initial Fe(III)-nitrilotriacetic acid concentration, and Ks is the halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB– double mutant cells completely lack Fe(III) reductase activity, we can, using the single mutants, convert Vm values to kcat values, and safely Shewanella oneidensis MR-1 OmcA and OmcB kinetics assume Ks to be Km, the familiar Michaelis–Menten constant for enzyme-catalyzed reactions Activity data were fitted to the regular Michaelis–Menten equation using graphpad prism Version 4.00 For MR-1R- and OmcA-dependent kinetics, the Michaelis–Menten equation was adjusted for substrate inhibition Acknowledgements This work was supported by a personal grant to J Borloo from the Institute for the Promotion of Innovation by Science and Technology in Flanders (IWT-Vlaanderen) J Van Beeumen and B Devreese are indebted to the Fund for Scientific Research (FWOVlaanderen) for granting research project G.0190.04, as well as to the Bijzonder Onderzoeksfonds of Ghent University for Concerted Research Action GOA 120154 References Krause B & Nealson KH (1997) Physiology and enzymology involved in denitrification by Shewanella putrefaciens Appl Environ Microbiol 63, 2613–2618 Moser DP & Nealson KH (1996) Growth of the facultative anaerobe Shewanella putrefaciens by elemental sulfur reduction Appl Environ Microbiol 62, 2100–2105 Myers CR, Carstens BP, Antholine WE & Myers JM (2000) Chromium(VI) reductase activity is associated with the cytoplasmic membrane of anaerobically grown Shewanella putrefaciens MR-1 J Appl Microbiol 88, 98–106 Myers JM & Myers CR (2001) Role for outer membrane cytochromes OmcA and OmcB of Shewanella putrefaciens MR-1 in reduction of manganese dioxide Appl Environ Microbiol 67, 260–269 Myers JM & Myers CR (2003) Overlapping role of the outer membrane cytochromes of Shewanella oneidensis MR-1 in the reduction of manganese(IV) oxide Lett Appl Microbiol 37, 21–25 Carpentier W, Sandra K, De Smet I, Brige A, De Smet L & Van Beeumen J (2003) Microbial reduction and precipitation of vanadium by Shewanella oneidensis Appl Environ Microbiol 69, 3636–3639 Klonowska A, Heulin T & Vermeglio A (2005) Selenite and tellurite reduction by Shewanella oneidensis Appl Environ Microbiol 71, 5607–5609 Davis JA, Kent DV, Rea BA, Maest AS & Garabedial SP (1993) Influence of redox environment and aqueous speciation on metal transport in groundwater: preliminary results of tracer injection studies In Metals in ground water (Allen HE, Perdue EM & Brown DS, eds), pp 223–273 Lewis Publishers, Chelsea, MI Schwalb C, Chapman SK & Reid GA (2003) The tetraheme cytochrome CymA is required for anaerobic FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS 3737 Shewanella oneidensis MR-1 OmcA and OmcB kinetics 10 11 12 13 14 15 16 17 18 19 20 J Borloo et al respiration with dimethyl sulfoxide and nitrite in Shewanella oneidensis Biochemistry 42, 9491–9497 Myers JM, Antholine WE & Myers CR (2004) Vanadium(V) reduction by Shewanella oneidensis MR-1 requires menaquinone and cytochromes from the cytoplasmic and outer membranes Appl Environ Microbiol 70, 1405–1412 Saffarini DA, Blumerman SL & Mansoorabadi KJ (2002) Role of menaquinones in Fe(III) reduction by membrane fractions of Shewanella putrefaciens J Bacteriol 184, 846–848 Myers CR & Myers JM (1997) Cloning and sequence of cymA, a gene encoding a tetraheme cytochrome c required for reduction of iron(III), fumarate, and nitrate by Shewanella putrefaciens MR-1 J Bacteriol 179, 1143–1152 Myers CR & Myers JM (2003) Cell surface exposure of the outer membrane cytochromes of Shewanella oneidensis MR-1 Lett Appl Microbiol 37, 254–258 Myers CR & Myers JM (2004) The outer membrane cytochromes of Shewanella oneidensis MR-1 are lipoproteins Lett Appl Microbiol 39, 466–470 Marshall MJ, Beliaev AS, Dohnalkova AC, Kennedy DW, Shi L, Wang Z, Boyanov MI, Lai B, Kemner KM, McLean JS et al (2006) c-Type cytochromedependent formation of U(IV) nanoparticles by Shewanella oneidensis PLoS Biol 4, 1324–1333 Ozawa T, Tanaka M & Shimomura Y (1980) Crystallization of the middle part of the mitochondrial electron transfer chain: cytochrome bc1–cytochrome c complex Proc Natl Acad Sci USA 77, 5084–5086 Pitts KE, Dobbin PS, Reyes-Ramirez F, Thomson AJ, Richardson DJ & Seward HE (2003) Characterization of the Shewanella oneidensis MR-1 decaheme cytochrome MtrA: expression in Escherichia coli confers the ability to reduce soluble Fe(III) chelates J Biol Chem 278, 27758–27765 Gordon EH, Pike AD, Hill AE, Cuthbertson PM, Chapman SK & Reid GA (2000) Identification and characterization of a novel cytochrome c(3) from Shewanella frigidimarina that is involved in Fe(III) respiration Biochem J 349, 153–158 Shi L, Chen B, Wang Z, Elias DA, Mayer MU, Gorby YA, Ni S, Lower BH, Kennedy DW, Wunschel DS et al (2006) Isolation of a high-affinity functional protein complex between OmcA and MtrC: two outer membrane decaheme c-type cytochromes of Shewanella oneidensis MR-1 J Bacteriol 188, 4705–4714 Field SJ, Dobbin PS, Cheesman MR, Watmough NJ, Thomson AJ & Richardson DJ (2000) Purification and magneto-optical spectroscopic characterization of cytoplasmic membrane and outer membrane multiheme c-type cytochromes from Shewanella frigidimarina NCIMB400 J Biol Chem 275, 8515–8522 3738 21 Myers CR & Nealson KH (1988) Bacterial manganese reduction and growth with manganese oxide as the sole electron-acceptor Science 240, 1319–1321 22 Myers CR & Nealson KH (1990) Respiration-linked proton translocation coupled to anaerobic reduction of manganese(IV) and iron(III) in Shewanella putrefaciens MR-1 J Bacteriol 172, 6232–6238 23 Carpentier W, De Smet L, Van Beeumen J & Brige A (2005) Respiration and growth of Shewanella oneidensis MR-1 using vanadate as the sole electron acceptor J Bacteriol 187, 3293–3301 24 Alexeyev MF (1999) The pKNOCK series of broad-hostrange mobilizable suicide vectors for gene knockout and targeted DNA insertion into the chromosome of gramnegative bacteria Biotechniques 26, 824–826, 828 25 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: a Laboratory Manual, 2nd edn Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 26 Shi L, Lin JT, Markillie LM, Squier TC & Hooker BS (2005) Overexpression of multi-heme C-type cytochromes Biotechniques 38, 297–299 27 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 227, 680–685 28 Schaegger HA & von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from to 100 kDa Anal Biochem 166, 368–379 29 Thomas PE, Ryan D & Levin W (1976) An improved staining procedure for the detection of the peroxidaseactivity of cytochrome-P450 on sodium dodecyl sulfate polyacrylamide gels Anal Biochem 75, 168–176 30 Maklashina E, Iverson TM, Sher Y, Kotlyar V, Andrell J, Mirza O, Hudson JM, Armstrong FA, Rothery RA, Weiner JH et al (2006) Fumarate reductase and succinate oxidase activity of Escherichia coli complex II homologs are perturbed differently by mutation of the flavin binding domain J Biol Chem 281, 11357–11365 31 Beliaev AS & Saffarini DA (1998) Shewanella putrefaciens mtrB encodes an outer membrane protein required for Fe(III) and Mn(IV) reduction J Bacteriol 180, 6292–6297 32 Moody MD & Dailey HA (1983) Aerobic ferrisiderophore reductase assay and activity stain for native polyacrylamide gels Anal Biochem 134, 235–239 33 Ruebush SS (2006) Biochemical Characterization of Membrane Proteins in Shewanella Oneidensis Involved in Dissimilatory Iron Reduction PhD thesis, Pennsylvania State University, PA 34 Monod J (1949) The growth of bacterial cultures Annu Rev Microbiol 3, 371–394 FEBS Journal 274 (2007) 3728–3738 ª 2007 The Authors Journal compilation ª 2007 FEBS ... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of. .. into the dependence of dissimilatory metal reduction by MR-1 on OmcA and OmcB Results Growth analyses of anaerobically metal- respiring omcA? ??, omcB? ?? and omcA? ?? omcB? ?? MR-1R mutants relative to their