a portion of the script pane shows the onrelease handler for a button called skiptoendbutton maxscroll is assigned to the scroll property of scrollwindow

By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx

Ngày tải lên : 16/03/2014, 18:20

... without any realization of the task The morning wore on The doctors, one at a time came down, and the nurse came down, and they ate a hearty breakfast Maria watched them, and hated them because they ... women,” Aunt Maria said to her niece Maria one night, when Harry had gone out on the piazza, after he had talked and laughed a good deal at the supper-table Harry Edgham heard the remark, and his face ... saw, her father enter the room with his bath-robe slipped over his pajamas, and approach the bed “What on earth is the matter?” he said He also laid hands on Maria, and, at his touch, she became...

488
398
0

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Ngày tải lên : 18/06/2014, 22:20

... pairs at the stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... design of the study, carried out the experiments and helped to draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final...

5
483
0

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

Ngày tải lên : 20/06/2014, 04:20

... pairs at the stage of nested PCR gave exactly the same result The V-type S RNA was detected during all ten passages while the REC-type totally disappeared after the 5th passage (data not shown) These ... Molecular Systems) was used To monitor the presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; ... design of the study, carried out the experiments and helped to draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final...

5
430
0

Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot

Ngày tải lên : 09/08/2014, 07:21

... depicting a mass Computed tomography of the abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal diameter ... 50:636-641 Akino K, Kondo Y, Ueno A, Yamazaki K, Hosokawa M, Shimozi H, Adachi T, Honda S, Ichiyanagi S, Akahonai Y, Fujisawa Y, Takahashi H, Arimura Y, Endo T, Imai K: Carcinoma of duodenum arising ... has been stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported...

4
202
0

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Ngày tải lên : 13/08/2014, 09:20

... (5' to 3'): β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, CD88(forward): TCAAGGTGGTGGTGGCAGTG, CD88(reverse): GTGACGATGGCTCCAGGAAGG, P21(forward): AGCAGCGGAACAAGGAGTCAG, P21(reverse): ... YW and XQ constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study CS performed the analysis of DNA microarray data and performed the statistical analysis AR conceived...

16
178
0

Tài liệu Simple Tricks To Ace the Subnetting Portion of Any Certification Exam pdf

Ngày tải lên : 21/12/2013, 04:18

... go into that part of the discussion A couple of gentle reminders Network addresses are always even and broadcast addresses are always odd First usable addresses are always odd, last usable addresses ... equivalent to a prefix of /24 If you see masks or prefixes on your exam, don’t panic The prefix is simply another way to state the mask The prefix contains a count of the total number of bits in the ... methods and processes to convert from one to the other While the methods may be confusing, the mathematics behind them is the same for all In this paper, you will learn some of the simpler ways to...

10
435
0

A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

Ngày tải lên : 29/01/2014, 10:33

... teachers understand their aims For example, it is obvious that in order to be able to speak a foreign language, it is necessary to know a certain amount of grammar and vocabulary Part of a language ... language in school curricula Gillian Bertram points out that oral language is the greatest use of language and is the basis of communication In fact it is the literacy basis ‘Language plays a vital ... the study are based on the data analysis V Design of the study The minor thesis consists of three parts: • The first part is an introduction to the thesis which presents the factors as plan of...

44
1.5K
1

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Ngày tải lên : 16/02/2014, 09:20

... during apoptosis The mitochondrial release of cytochrome c and second mitochondria-derived activator of caspase (Smac ⁄ DIABLO) allows for the formation of the apoptosome, a complex that enables the ... Bcl-2 family involved in the initiation of apoptosis through the mitochondrial pathway The key event in the mitochondrial pathway is the release of proapoptotic factors from the mitochondrial intermembrane ... by the Natural Sciences and Engineering Research Council of Canada Discovery Grant 288238 to AA AA is supported by a FQRNT young investigator award We thank D Du Pasquier for the kind gift of the...

12
718
0

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspeciﬁc alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Ngày tải lên : 19/02/2014, 17:20

... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... added to cell lysates and media (10 lgÆmL)1 for each) Unless stated otherwise, iodoacetoamide was not added to the lysates and media The lysates were incubated for 20 at 37 °C to extract TNSALP The ... fraction was collected from the top of the gradient and assayed for alkaline phosphatase activity (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c,...

14
445
0

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is speciﬁcally induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Ngày tải lên : 21/02/2014, 01:21

... detected against any of the transgalactooligosaccharides listed in Materials and methods Puriﬁcation and characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that ... identify the D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides were expressed as percentages of the area of mM D-galactose A niger ... linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L-arabinose Methylation analysis demonstrated that a...

9
669
0

Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx

Ngày tải lên : 07/03/2014, 09:20

... lead to binding of a third metal ion The implications of the M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role of the third metal in catalysis ... interactions to those described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the ... conformation (checked against the final coordinates) due to the poor quality of the maps, and refinement with refmac5 [29] stalled at R-factors of 26 and 30% This may be due to real disorder in the...

10
542
0

Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difﬁculty of Texts for FFL" potx

Ngày tải lên : 08/03/2014, 21:20

... etc The goal is to have as wide a coverage as possible, to achieve maximum generalisability of the formula, and also to check what sort of texts it does not ﬁt (e.g statistical descriptive analyses ... proportional odds for ordinal data; and multinomial logistic regression for nominal variables Therefore, identifying the best scale of measurement is an important issue for readability From a theoretical ... representative of the population (which could be true for our data) These analyses would aim to illuminate some of the assets and ﬂaws of each of the statistical models considered This paper has proposed...

9
514
0

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Ngày tải lên : 15/03/2014, 00:20

... N-terminal moiety of Ure2p, which is critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher afﬁnity a conformational state of Ure2p as ... identify all the peptides in our list using the available softwares (gpmaw [30], xquest [31] and msx-3d [12]) with a mass tolerance of p.p.m We therefore used MALDITOF-TOF and ⁄ or nanoLC-Orbitrap tandem ... Biosystems) and an additional internal calibration was performed during mass spectra analysis using nonmodiﬁed peptides of both Ure2p and ⁄ or Ssa1p Acquisition and data analysis were performed using the...

12
510
0

Báo cáo khoa học: A new rice zinc-ﬁnger protein binds to the O2S box of the a-amylase gene promoter pptx

Ngày tải lên : 16/03/2014, 18:20

... buffer, appropriate CGGTATCGATAAGCTTGATTGACTTGACCGTCA amounts of GA were added to a ﬁnal concentration of TCGGATTGACTTGACCGTCATCG-3¢, Amyb2: 5¢-CA 10 lM Isolated aleurone tissues were incubated ... protein The mutant O2S box was synthesized by PCR using the primers mAmyb1 (5¢-ACCCTCGAGATTGAGCTAGCC GTCATCGGATTGAGCTAGCCGTCATCG-3¢) and mAmyb2 (5¢-CAGGATCCGTCAGTGCCGATGACG GCTAGCTCAATCCGATG-3¢) The ... transferred to Whatman paper, dried and autoradiographed RAMY G.max LEAS N.tabacum LEA5 G.hirsutum LEA5 V.radiata ARG2 A. thaliana ARG21 H.vulgare G3 60 59 51 49 52 53 59 Results Screening for rice cDNA...

7
359
0

Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot

Ngày tải lên : 17/03/2014, 10:20

... regulatory factors Clin Diagn Lab Immunol 9, 530–543 26 Funatogawa, K., Matsuura, M., Nakano, M., Kiso, M & Hasegawa, A (1998) Relationship of structure and biological activity of monosaccharide ... H2SO4 and the absorbance was measured at 450 nm Quantiﬁcation of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... )85 to )76) of the mouse iNOS promoter plus the downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the...

10
395
0

Báo cáo khoa học: A hydrophilic cation-binding protein of Arabidopsis thaliana, AtPCaP1, is localized to plasma membrane via N-myristoylation and interacts with calmodulin and the phosphatidylinositol phosphates PtdIns(3,4,5)P3 and PtdIns(3,5)P2 pptx

Ngày tải lên : 23/03/2014, 07:20

... lanes and 10, B oleracea var italica The amount of protein applied was lg for A thaliana and 40 lg for the other plants 43 kDa) and Brassica oleracea var italica (broccoli, 41 kDa) (Fig 1B) The ... of PCaP1 orthologous protein in crude membrane fractions with anti-PCaP1 Lanes and 6, A thaliana; lanes and 7, Raphanus sativus; lanes and 8, Brassica rapa; lanes and 9, B rapa var glabra; lanes ... plants [Raphanus sativus (radish), Brassica rapa (turnip), Brassica rapa L var glabra Regel (Chinese cabbage) and Brassica oleracea var italica (broccoli)] were purchased from a market Puriﬁcation...

16
424
0

The preference of a Female Greek island population in regard to the gender of their gynecologist pdf

Ngày tải lên : 28/03/2014, 14:20

... reported that they preferred a female doctor to take their Pap smear, 48% that they preferred a woman for their breast exam and 36% that they preferred a woman to take a sample of vaginal fluid for ... variable the potential preference of a male gynecologist, the age of the first visit and the breast exam presented, in comparison to the others, the largest statistically significant correlation ... led to them choosing that particular doctor, as well as the characteristics that the Greek women desire their doctor to possess.13 Statistics Initially, a descriptive statistical analysis was...

9
432
0

The mandibles of a mantis are strong and sharp enough to cut human flesh potx

Ngày tải lên : 02/04/2014, 21:21

... The mandibles of a mantis are strong and sharp enough to cut human flesh 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: The mandibles of a mantis are strong and sharp enough to cut human ... *The mandibles of a mantis are strong and sharp enough to cut human flesh Hình thức ngữ pháp, cấu trúc : “adj/adv + enough + to V” – đủ …để làm Chúng ta quan sát câu sau Các bạn di ... have enough money I will buy a motorbike.” – Nếu có đủ tiền, mua xe máy - The mandibles of a mantis are” – Hàm bọ ng a “mandibles”- hàm (sâu bọ), danh từ số nhiều từ “mandible” , động từ “to...

5
599
0

morrice - 1802 - a treatise on brewing wherein is exhibited the whole process of the art and mystery of brewing

Ngày tải lên : 12/06/2014, 11:36

200
272
0

Báo cáo sinh học: "Bisphosphonate-associated osteonecrosis of the jaw is linked to suppressed TGFb1-signaling and increased Galectin-3 expression: A histological study on biopsies" pot

Ngày tải lên : 18/06/2014, 19:20

... harvested the samples KA established the immunohistochemistry, analyzed the tissue samples, interpreted the data, and performed the histopatholgic analysis of BRONJrelated and control tissue samples All ... procedures, and wrote the manuscript PH formulated the hypothesis and interpreted the data AG performed the histomorphologic analysis of the changes in BRONJ-affected oral mucosa and mucoperiosteal soft ... Immunohistochemical staining was performed with the alkaline phosphatase-anti-alkaline phosphatase method and an automated staining device (Autostainer plus, DakoCytomation, Hamburg, Germany) We...

11
416
0