1990 p 86 the difficulty or lack of difficulty a word presents may override its frequency and or range and decisions to bring forward or postpone the teaching of an item may be based on learnability

Báo cáo khoa hoc:" Lack of association between sCTLA-4 levels in human plasma and common CTLA-4 polymorphisms" ppsx

Ngày tải lên : 11/08/2014, 07:20

... association between CT60 genotype and sCTLA-4 levels On the other hand, our findings appear to be at odds with the speculation that the CTLA-4 CT60 -A/ G SNP may determine the alternate splicing and production ... of polymorphisms relations between absolute levels of sCTLA-4 protein and SNP genotypes Our data confirm and extend the findings of Purohit and co-workers [30], who reported a lack of association ... sCTLA-4 protein are observed in plasma of individuals with autoimmune disease Possible explanations for the appearance of this discrepancy may include the possibility that there is no direct relationship...

4
297
0

Báo cáo khoa học: "Integration Of Visual Inter-word Linguistic Knowledge In Degraded Constraints And Text Recognition" doc

Ngày tải lên : 08/03/2014, 07:20

... fragment of a real text page Word images and are almost the same Word image matches the left part of word image quite well Word image matches a part of the image 6, and so on Visual inter -word ... relaxation algorithm and the lattice parser of Work A word- collocation -based relaxation algorithm and a probabilistic lattice chart parser have been designed for word candidate selection in degraded ... lattice parser to improve the performance of candidate selection Visual Inter -Word Relations A visual inter -word relation can be defined between two word images if they share the same pattern at the...

3
295
0

báo cáo khoa học: "A hospital-site controlled intervention using audit and feedback to implement guidelines concerning inappropriate treatment of catheterassociated asymptomatic bacteriuria" pptx

Ngày tải lên : 10/08/2014, 10:23

... percentage of catheterized patients who are screened for ABU Based on estimates of the number of catheterized patients at Houston and San Antonio in a one-year time period (1 ,867 and 1,512, respectively), ... approaches above For rare outcomes for which fewer than 10 total cases are expected, we may be unable to conduct comparative analyses and will instead provide descriptive analyses Analysis plan and ... Mazmanian P, Taylor-Vaisey A: Impact of formal continuing medical education: conferences, workshops, rounds, and other traditional continuing education activities change physician behavior or...

12
345
0

báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx

Ngày tải lên : 11/08/2014, 18:20

... manuscript MS supervised the data analyses and manuscript preparation and critically revised the final draft All of the authors approved the final version submitted for publication Competing interests ... prepared the first draft of the paper and the final manuscript AB assisted with the interpretation of the data, provided the main background content and provided critical comments on the manuscript ... Furthermore, there must be networking and cooperation between the various stakeholders and actors, such as politicians, the police and /or medical-treatment services For example, thanks to the collaboration...

6
267
0

Amyloid assemblies of influenza a virus PB1 f2 protein damage membrane and induce cytotoxicity pdf

Ngày tải lên : 16/09/2016, 17:12

... demonstrated that cytotoxicity of PB1-F2 depends on the protein conformational state and its supramolecular organization Monomeric PB1-F2 added to a solution of physiological pH aggregates to amorphous ... to quantify the membrane damages, infected cells were harvested and analyzed for acridine orange fluorescence by flow cytometry Acridine orange easily traverses the cell membrane and accumulates ... measurements C P performed electron microscopy B D C and N B provided assistance for experiments in Fig All authors provided critical feedback on the manuscript and approved the final version of the manuscript...

14
287
0

DSpace at VNU: Molecular Cloning, Expression of minD Gene from Lactobacillus acidophilus VTCC-B-871 and Analyses to Identify Lactobacillus rhamnosus PN04 from Vietnam Hottuynia cordata Thunb.

Ngày tải lên : 16/12/2017, 10:35

... MinD and sugar The Isolation and Identification of Lactobacillus rhamnosus from Hottuynia Cordata Thunb To make a sure of the minD existence and aid for identification, an isolation of L rhamnosus ... ready reaction kit according to the manufacturer’s protocols The Lactobacillus minD genes was determined and analyzed using Fasta The protein molecular mass, pI were calculated on an ExPASy Proteomics ... indicated the self-interaction [4] and L acidophilus MinD predicted in monomer, the monomers of these structures are highly similar The results meant the comparative analysis can be an important tool...

6
120
0

DSpace at VNU: Determination of bisphenol A (BPA) by gas chromatography-mass spectrometry and H-1 NMR spectroscopy during curing of epoxy-amine resins

Ngày tải lên : 17/12/2017, 14:32

... measuring the integrals I1, I2 and I3 corresponding, respectively, to the aromatic protons (peaks a and b), the epoxide group protons (peaks e, f and g) and the benzylic methyl protons (peak h) Indeed, ... (small peaks at 7.05 and 6.77 ppm) are still present in the organic extract after extraction The wt% recovery of BPA was determined by adding naphthalene as an internal standard to the organic ... Methods The samples were prepared by adding appropriate amounts of an amine/BPA solution or BPA powder to the DGEBA/DGEBF resin either at room temperature (aliphatic amine -based epoxy) or at 120...

11
150
0

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Ngày tải lên : 08/03/2014, 08:20

... values for the cAMP pathway and for the inositol phosphates pathway SP, [Ala9]SP and [Pro9]SP are almost equipotent at the major binding site NK-1M (Ki between 0.64 nM and 1.6 nM and EC50 values between ... molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAlaNHMe have been generated and compared to the canonical structures of the corresponding a- amino acid Ac-Gly-NHMe ... Any modiﬁcation of Phe7 causes a dramatic loss in receptor afﬁnity for the corresponding peptide [21,41] Indeed, the backbone conformation, the aromatic ring and the orientation (v1 and v2) of...

11
860
0

Báo cáo y học: "Lack of association or interactions between the IL-4, IL-4Rα and IL-13 genes, and rheumatoid arthritis" pptx

Ngày tải lên : 09/08/2014, 10:23

... E, Arinami T, Yamakawa-Kobayashi K, Nakagawa H, Otsuka F, Hamaguchi H: Linkage and association of Page of (page number not for citation purposes) an interleukin gene polymorphism with atopic ... the acquisition of the samples or study data IM performed genotyping as well as all data analyses All the authors Page of (page number not for citation purposes) Arthritis Research & Therapy Vol ... investigated epistasis between the IL-4 or IL-13 and their common receptor IL-4Rα Materials and methods Study populations A total of 965 white Caucasian individuals with RA (cases) and 988 healthy...

7
383
0

PHYSICS AND POLITICS OR THOUGHTS ON THE APPLICATION OF THE PRINCIPLES OF ''''NATURAL SELECTION'''' AND ''''INHERITANCE'''' TO POLITICAL SOCIETY pptx

Ngày tải lên : 06/03/2014, 13:20

... muscles of the lips, tongue, and throat, of laryngeal and respiratory muscles, are involved in the production of speech Perhaps the reader is standing up and accompanying the lecture with appropriate ... age of Catullus, Terence, or Lucretius, and that of Statius or Claudian; and in our own country, in the age of Shakespeare and Beaumont and Metcher, and that of Donne and Cowley, or Pope.' And then, ... to be ready to advance to something good— to have prepared all the means to advance to something good, and then to have stopped, and not advanced India, Japan, China, almost every sort of Oriental...

143
597
0

Báo cáo khoa học: Interactions of elongation factor EF-P with the Escherichia coli ribosome doc

Ngày tải lên : 16/03/2014, 06:20

... ethical approval by the University of Toronto Animal Care Committee, which is in full compliance with the Guidelines of the Canadian Council on Animal Care and the Regulations of the Animals for ... electrospray interface for liquid chromatography-microspray and nanospray mass spectrometry Anal Biochem 263, 93–101 Eng JK, McCormack AL & Yates JRI (1994) An approach to correlate tandem mass-spectral ... determined, as was the area of each peak The ratio of the density, which is related to the amount of EF -P bound, to the area of the peaks, which is related to the total amount of the ribosome population...

11
362
0

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Ngày tải lên : 23/03/2014, 05:22

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... subjected to SDS ⁄ PAGE (6% acrylamide for MAP1B, MAP2 and STOP; and 10% for Tau) and immunoblotting using antibodies to various MAPs as indicated As positive controls, samples of supernatant fractions ... et al logies and abilities, there are certain basic features common to all neurons (e.g the initiation and elongation of membrane protrusions for neurite formation, and their stabilization and...

14
416
0

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

Ngày tải lên : 24/03/2014, 03:21

... is a more potent inhibitor of both CaNa and CaNb than CyPA/CsA Activation of CaNa and CaNb phosphatase activity by FKBP12/FK506 toward pNPP In contrast to the inhibition of CaN phosphatase activity ... effects on the activities of CaNa and CaNb toward pNPP, we examined the activation of CaNa and CaNb phosphatase activities toward pNPP by FKBP12/FK506 As shown in Fig 5, a twofold increase in CaN phosphatase ... inhibition of CaN phosphatase activity toward the two peptide substrates by the CaN autoinhibitory peptide, and the FKBP12/FK506 complex The activation of CaN phosphatase activity towards pNPP by the...

9
473
0

the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities

Ngày tải lên : 31/05/2014, 01:37

... proposed layout for practical and safe operation, and recommend allowances for future expansion Regardless of the amount of professional assistance available, the laboratory operator can expect to burn ... 13 THE LABORATORY HANDYMAN Limitations Value of Laboratory Handyman Related Experience Sources of Information Tools for the Laboratory Sources of Tools Tool Storage Special Purpose Tools Tool ... Medical, and Research Laboratories Educational Laboratories Reagent Storage Glassware Instruments Preparation Space Repair and Maintenance Equipment Check-Out Laboratory Location Safety Considerations...

173
561
0

Báo cáo hóa học: "TAp73 is one of the genes responsible for the lack of response to chemotherapy depending on B-Raf mutational status" pot

Ngày tải lên : 18/06/2014, 16:20

... harbors K-Ras mutation and Caco-2 is K-Ras and B-Raf wild type The association between the expression of TAp73 and the presence/absence of K-Ras and B-Raf mutations in response to cetuximab supports ... Siena S, Bardelli A: Oncogenic activation of the RAS/RAF signaling pathway impairs the response of metastatic colorectal cancers to anti-epidermal growth factor receptor antibody therapies Cancer ... protein TAp73 expression We evaluated the role of TAp73 in untreated and treated conditions in order to compare their behavior and correlate their gene expression profile changes with K-Ras and...

8
471
0

báo cáo hóa học: " Muscle weakness and lack of reflex gain adaptation predominate during post-stroke posture control of the wrist" doc

Ngày tải lên : 19/06/2014, 08:20

... haptic manipulator The haptic manipulator Schematic drawing of the haptic manipulator The subject is holding a handle, which is connected via a lever to the axis of an electrical motor, which ... and Rehabilitation 2009, 6:29 the angle:torque relationship The coherence varies between and 1; a value of means that at a specific frequency the relation between input and output is linear and ... neuromusculoskeletal system can be manipulated [17] The relationship between handle torque (input) and resulting angular deviation (output) yields the mechanical behaviour of the subject attached and comprises...

11
556
0

báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot

Ngày tải lên : 19/06/2014, 22:20

... in autism The therapeutic role of tachykinin receptor antagonists, a potential new class of anti-inflammatory medications, should also be studied in autism Keywords: Anti-ribosomal P protein antibodies; ... non-verbal communication; activity level; level and consistency of intellectual response; adaptation to change; visual response; taste, smell and touch response and general impressions) According to ... of lipids inside the cell, and downregulation of the total protein synthesis P proteins are post-translationally modified (dephosphorylated) during apoptosis, and a dysregulation in the normal...

30
522
0

Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part1 potx

Ngày tải lên : 20/06/2014, 02:20

... defines a performance -based contract as: A contract under which compensation to the vendor shall be computed according to performance standards established by the department Any performance -based contract ... standards and the Office of the Auditor’s Manual of Guides These standards require that we plan and perform the audit to obtain sufficient, appropriate evidence to provide a reasonable basis for ... Department of Taxation to examine the department’s financial records and its systems of accounting and internal controls and tested these for compliance with applicable laws and regulations These...

11
387
0

Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part2 doc

Ngày tải lên : 20/06/2014, 02:20

... in a dysfunctional management environment” and blamed the then-director for being unable to manage the situation The email said the then-tax director “had no management or leadership skills” and ... employee the former deputy director—without the involvement of the then-director and key managers According to the former deputy director, after the email, the majority of the managers and the ... structure and weakened the relationship between the director and a deputy director within the department In addition, a former tax department manager said there was competition between the internal...

11
413
0

Chapter 2: Lack of Planning and Fractured Management Undermine the State’s Tax Collection Efforts_part3 pdf

Ngày tải lên : 20/06/2014, 02:20

... The director was required to report to the Legislature the status of the contract and provide an accounting of all moneys appropriated and detailed information on the cost and benefits of implementing ... collection agencies, licensed attorneys, accountants, and auditors or other persons for the purpose of assessment, enforcement, or collection of taxes According to the law, all compensation can be paid ... and approval, stating that the enhancements will have to be coordinated and integrated with the current applications that were developed by CGI to its proprietary software For that reason, another...

11
389
0