the endocytic mechanism involved in plant defense responses triggered by fungal elicitors eix as a model

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

Ngày tải lên : 16/02/2014, 09:20

... GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG GGAACACACAGAGGGGATGATA CTTCAACACGCACAAAGCAC TGCCACCTTTTCCATCATACA CTGCTTTTCTGGGGACTTCA TGAAGTCCCCAGAAAAGCAG GTGCTTTGTGCGTGTTGAAG TGTATGATGGAAAAGGTGGCA GGAACACACAGAGGGGATGATA ... CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG ... dG Adapter dT Adapter primer AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG...

20
689
0

Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx

Ngày tải lên : 07/03/2014, 05:20

... graphical comparison of the experimentally measured parameters against simulated datasets (Fig 4) Data indicated by gray squares were simulated using the extended Lipari and Szabo [37] and axially ... yeast RNA 4, 958–972 Ebihara K & Nakamura Y (1999) C-terminal interaction of translational release factors eRF1 and eRF3 of ﬁssion yeast: G-domain uncoupled binding and the role of conserved amino ... obtained relaxation rates R1 (longitudinal or spin–lattice relaxation rate) and R2 (transverse or spin–spin relaxation rate) and NOE values for the amide 15N nuclei measured at 278 K, and the calculated...

15
538
0

Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

Ngày tải lên : 16/03/2014, 18:20

... cellular components (Table 1) ATPase activity of this fraction was, indeed, uninhibited or only very slightly inhibited by vanadate (plasmalemma ATPase inhibitor), baﬁlomycin A1 (tonoplast ATPase inhibitor) ... 2211.10 Database search with the peptide masses was performed against the NCBInr, taxon Viridiplantae, database using the peptide search algorithm MASCOT (Matrix Science) Fragments generated by post ... reductase activity was assayed in the presence and absence of antimycin A to assess the contamination from endoplasmic reticulum In puriﬁed mitochondria (in the presence of antimycin A) , the activity...

8
504
0

Báo cáo khoa học: Modulation of the endocannabinoid system by focal brain ischemia in the rat is involved in neuroprotection afforded by 17b-estradiol pdf

Ngày tải lên : 23/03/2014, 07:20

... D Amantea et al Endocannabinoids are amides, esters and ethers of long-chain polyunsaturated fatty acids that are synthesized on demand Anandamide (arachidonoylethanolamide) (AEA) was the ... mediated by a membrane transporter [4], and subsequent intracellular degradation catalyzed by a fatty acid amide hydrolase (FAAH), which cleaves the amide bond to form arachidonic acid and ethanolamine ... in a signiﬁcant increase of endogenous AEA levels in the ischemic striatum, as early as h following injury This effect was associated with altered endocannabinoid metabolism, as h of MCAo also...

12
460
0

Báo cáo hóa học: " “Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression” pptx

Ngày tải lên : 18/06/2014, 16:20

... cDNA for the individual TaqMan MicroRNA Assays (RNU48 Assay ID 001006, RNU49 Assay ID 001005, hsa-miRNA-44 9a Assay ID 001030, hsa-miRNA-449b Assay ID 001608, Applied Biosystems, Foster City, CA, ... these hypoxiainducible factors could be regulated by miRNA-44 9a/ b The miRBase Target Database (by using the link for TargetScan) listed SERPINE1 as a putative mRNA target of miRNA-44 9a/ b We then ... when compared to control kidneys, Figure 8A SERPINE1 protein in kidney tissues was predominantly demonstrable in areas of interstitial fibrosis and vascular remodeling Activated fibroblasts and smooth...

14
279
0

Báo cáo sinh học: "Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pptx

Ngày tải lên : 18/06/2014, 19:20

... expression by incorporating a dotted line The line was intended to highlight the additional increase of SERPINE1 (PAI-1) mRNA by miRNA-44 9a/ b inhibitors Unfortunately, it could also suggest a false-positive ... or misleading interpretation we may have caused Additional material Additional file 1: Data underlying corrected Figures 2, 4, 5, Authors’ Note Katharina Theophile, the 2nd author in the author ... miRNA-44 9a/ b inhibitors additionally increased the hypoxia-induced SERPINE1 mRNA expression The mean, minimum and maximum of calculations relative to reference gene POLR 2A compared with non-transfected...

5
222
0

báo cáo hóa học:" Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pdf

Ngày tải lên : 20/06/2014, 03:20

... expression by incorporating a dotted line The line was intended to highlight the additional increase of SERPINE1 (PAI-1) mRNA by miRNA-44 9a/ b inhibitors Unfortunately, it could also suggest a false-positive ... or misleading interpretation we may have caused Additional material Additional file 1: Data underlying corrected Figures 2, 4, 5, Authors’ Note Katharina Theophile, the 2nd author in the author ... miRNA-44 9a/ b inhibitors additionally increased the hypoxia-induced SERPINE1 mRNA expression The mean, minimum and maximum of calculations relative to reference gene POLR 2A compared with non-transfected...

5
215
0

Báo cáo sinh học: " Research Article An Upper Bound on the Critical Value β∗ Involved in the Blasius Problem" pot

Ngày tải lên : 21/06/2014, 17:20

... A Oleinik and V N Samokhin, Mathematical Models in Boundary Layer Theory, vol 15 of Applied Mathematics and Mathematical Computation, Chapman & Hall/CRC Press, Boca Raton, Fla, USA, 1999 J Wang, ... Gao, and Z Zhang, “Singular nonlinear boundary value problems arising in boundary layer theory,” Journal of Mathematical Analysis and Applications, vol 233, no 1, pp 246–256, 1999 10 R P Agarwal ... Falkner-Skan equation arising in the boundary layer theory,” Canadian Mathematical Bulletin, vol 51, no 3, pp 386–398, 2008 14 B Brighi, A Fruchard, and T Sari, “On the Blasius problem,” Advances in Diﬀerential...

6
348
0

Discovering the seeds of diversity in plant genomes ppsx

Ngày tải lên : 09/08/2014, 20:20

... heterochromatin in Arabidopsis A chromosomal-tiling path was created in kilobase segments that spanned a 1.5 megabase region An analysis of the spectrum of methylation of H3 at lysine and DNA shows a good ... contrast, the level of variation in the rice genome is lower than that of maize, as was revealed in a talk about sequencing the rice genome from Takuji Sasaki (National Institute of Agrobiological ... thaliana and Arabidopsis arenosa, the A thaliana genes are silenced The active genes are associated with modifications of histone H3, namely the methylation of the lysine at position 4, whereas...

3
96
0

báo cáo khoa học: " Functional analysis of Arabidopsis WRKY25 transcription factor in plant defense against Pseudomonas syringae" potx

Ngày tải lên : 12/08/2014, 05:20

... primers (5'-ATCGAATTCATGGACAATAGCAGAAC-3' and 5'ATCCTCGAGTGAGGGCATAAACGAAT-3') The amplified DNA fragment was digested with EcoR1 and Xho1, cloned into the same sites of pET3 2a (Novagen) and transformed ... was amplified with two gene-specific primers (5'-ATCGAATTCATGGACAATAGCAGAAC-3' and 5'-ATCCCATGGTGGGCATAAACGAATCG-3') The amplified fragment was digested with EcoR1 and Nco1 and cloned into a ... defense signaling was further investigated by analyzing its expression in Arabidopsis after inoculation with PsmES4326 As shown in Figure 3A, WRKY25 mRNA levels increase in wild-type plants after...

13
310
0

uncovering the cellular pathways involved in lowe syndrome

Ngày tải lên : 13/11/2014, 09:40

175
148
0

Characterization of the molecular mechanisms involved in ethionamide activation in mycobacteria

Ngày tải lên : 09/09/2015, 08:14

... cytochalasin D EMB – Ethambutol ETH – Ethionamide INH – Isoniazid ISO – Isoxyl PZA – Pyrazinamide PAS – Para-amino Salicylic Acid (PAS) PZA – Pyrazinamide RIF – Rifampicin TAC- Thiacetazone TMC-207 ... times in vitro and should be regarded nowadays more like a labadapted strain than a clinical isolate Regardless, the numerous handling and in vitro passages of these individual strains in various ... injectable drugs (capreomycin, kanamycin and amikacin) in addition to INH and RIF (103); and totally-drug resistant TB (TDR-TB) as strains that are resistant to all first and second-line drug classes...

189
389
0

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Ngày tải lên : 22/03/2014, 17:20

... engraftment was achieved using both methods as shown by expression of human CD45 3–6 months post-transplantation Additionally, secondary engraftment was achieved following intravenous transplantation ... viral infections [20] Cancer therapy is a principal goal of the current clinical research on hESCs Recently, regression of metastatic melanoma tumors was achieved by transplantation of adaptive ... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway...

12
550
0

Báo cáo khoa học: Novel suppression mechanism operating in early phase of adipogenesis by positive feedback loop for enhancement of cyclooxygenase-2 expression through prostaglandin F2a receptor mediated activation of MEK⁄ ERK-CREB cascade doc

Ngày tải lên : 28/03/2014, 22:20

... increases the intracellular calcium level and activates various kinases including MEK [16,18–20] MEK, also known as MAPK kinase [34], is an activator of ERK, a MAPK The MEK ⁄ ERK pathway is a critical ... CO2 at 37 °C [15] RNA preparation and quantification of RNA level Total RNA was extracted with Sepasol-RNAI (Nacalai Tesque, Kyoto, Japan), and was then further purified with an RNeasy Purification ... measured by using a Dual-Glo Luciferase Assay System (Promega) The reporter activity was calculated relative to that of pGL4.10[luc2] vector, which was defined as Data were obtained from three independent...

12
366
0

Báo cáo toán học: "Rate of convergence of the short cycle distribution in random regular graphs generated by pegging" pdf

Ngày tải lên : 07/08/2014, 21:21

... obtain can be intuitively explained by “mistakes” made by this random walk that are of order 1/t after t steps Actually, in a sense it is easy to show that such mistakes occur occasionally, and ... such that one edge is contained in at least one triangle, and the other edge contained in at least two triangles The latter is a small subgraph with excess at least Both cases imply that for ... 1)(d − 2)2 Table 2: Value of the constants appearing in Table Riordan [5] proved that the random graphs generated by the preferential attachment model a. a.s have diameter asymptotically log n/...

19
208
0

Báo cáo y học: "Expression analysis of three isoforms of hyaluronan synthase and hyaluronidase in the synovium of knees in osteoarthritis and rheumatoid arthritis by quantitative real-time reverse transcriptase polymerase chain reaction" potx

Ngày tải lên : 09/08/2014, 01:24

... 43 Nagaya H, Ymagata T, Ymagata S, Iyoda K, Ito H, Hasegawa Y, Iwata H: Examination of synovial fluid and serum hyaluronidase activity as a joint marker in rheumatoid arthritis and osteoarthritis ... Joint fluid was obtained from 10 healthy control donors, 10 patients with OA, and 10 with RA Hyaluronan concentration in joint fluid was measured by a sandwich binding protein assay using a Hyaluronate-Chugai ... AGATGTCCAGATTTTA 96 – 111 888F TGTCCAGATCCTCAACAAGTACGA 888 – 911 AATACACTGCACACAGCCAAAGTAG 1005 – 981 TCATGGATTTCCTTCCTGAGCAGCGT 913 – 938 1561F AGTGGTGCTCTGGGTGAGCT 1561 – 1580 1667R TGGTCACGTTCAGGATGAAGG...

7
466
0

Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

Ngày tải lên : 09/08/2014, 10:20

... tibial plateaus, the maximum loss was found on the medial plateau and was approximately 35% greater than that found on the lateral plateau Plateau subregion analysis revealed findings similar ... percentage losses compared with baseline (mean ± standard deviation) and statistical relevance assessed by a one-sample Student t test A set of analyses was done by dividing the cohort into quartiles ... Meniscal tear assessment was as follows: = no damage, = out of meniscal areas involved (anterior, middle, and posterior horns), = out of involved, and = all areas involved (severe tear) The extent...

11
518
0

Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx

Ngày tải lên : 09/08/2014, 18:21

... number of small microchromosomes, visualized as dots on metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which ... varies according to authors, the actual standard karyotype description by GTG- and RBG-banding for the chicken, established by the International Committee for the Standardization of the Avian ... obtain characteristic banding patterns for each pair (68], it is im- However, by using DAPI or chromomycin A3 staining, it has been suggested that most of the microchromosomes had lower (A +...

11
318
0

Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx

Ngày tải lên : 09/08/2014, 23:20

... analyzing how the protein families of interest identified above have differentially expanded or contracted in the snake and mammalian lineages We are also interested in analyses that focus on areas ... University of California Santa Cruz [32] and NCBI [33] genome browsers for public queries as soon as it is available and passes contamination analyses, and relevant announcements and links will be ... genome that contains genic and near-genic regions that are assembled and annotated To provide a service to the broader research community, we have released a prepublication preliminary draft assembly...

8
410
0

Báo cáo y học: " Reduction of the HIV-1 reservoir in resting CD4+ T-lymphocytes by high dosage intravenous immunoglobulin treatment: a proof-of-concept study" pot

Ngày tải lên : 10/08/2014, 05:21

... We hypothesized that IVIG contributed to activation of HIV-1 in latently-infected cells, leading to a transient increase in plasma viral load, and followed by a decrease in infected T-lymphocytes ... J, Nunnari G, Otero M, Calarota S, Dornadula G, Zhang H, Malin A, Sullivan J, Xu Y, DeSimone J, Babinchak T, Stern J, Cavert W, Haase A, Pomerantz RJ: Intensification and stimulation therapy for ... plasma sample 16 days after initiation of IVIG treatment (2.PLd16); 23 SGS from the supernatant at baseline (2.BL); and 38 SGS from the supernatant of activated T-cells 85 days after initiation...

8
378
0