ζ in tls across a wide variety of dna lesions

Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps

Ngày tải lên : 12/08/2014, 04:20

... 5'ATGAGCTCATGGCAAGTAAAGGAGAAGAAC-3', and Reverse: 5'-CGGGATCCGAGCTCTTAGAGTTCGTCGTGTTTG-3' The amplified fragment was cloned in the forward orientation in VA/pCAMBIA1391Z, as obtained above, at ... viral amplicon was found to be generated and replicated in plants like tomato, tobacco (Nicotiana xanthii), Arabidopsis thaliana and rice (Oryza sativa, variety Pusa Basmati) We also show that ... tomato plants agroinfiltrated with VA/pCAMBIA1391Z Northern hybridization using CR-AC3 DNA fragment as a probe showing the formation of siRNAs in infiltrated tomato leaves at indicated time points...

13
428
0

Báo cáo khoa học: A truncated form of DNA topoisomerase IIb associates with the mtDNA genome in mammalian mitochondria doc

Ngày tải lên : 31/03/2014, 07:20

... mitoplasts using steps that eliminate nuclear DNA contaminants Unlike the well-characterized nuclear form of DNA topoisomerase IIb that consists of a 180-kDa polypeptide and relaxes DNA in a processive ... The accessory subunit of Xenopus laevis mitochondrial DNA polymerase gamma increases processivity of the catalytic subunit of human DNA polymerase gamma and is related to class II aminoacyl-tRNA ... b-galactosidase (116 kDa), phosphorylase b (97 kDa), BSA (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa) (B) Standard agarose-gel relaxation assays of glycerol gradient contained in 40 lL: a...

14
428
0

báo cáo hóa học: " Simulator sickness when performing gaze shifts within a wide field of view optic flow environment: preliminary evidence for using virtual reality in vestibular rehabilitation" pptx

Ngày tải lên : 19/06/2014, 10:20

... virtual reality facility for research and rehabilitation of balance disorders In In: Proceedings of the ACM symposium on virtual reality software and technology: 2001; Banff, Alberta, Canada ACM ... both visual inputs and movements of the head and body [13] Retinal slip, i.e movement of a visual image across the retina, is a powerful signal that can induce adaptation of vestibular responses ... care is taken to minimize delays between head tracking devices and image updates, VR-induced retinal slip can be delivered in a controlled manner in order to cause adaptation A randomized trial...

10
323
0

Báo cáo y học: "A comparative analysis of DNA methylation across human embryonic stem cell lines" docx

Ngày tải lên : 09/08/2014, 23:20

... JA, Jacobsen SE: Establishing, maintaining and modifying DNA methylation patterns in plants and animals Nat Rev Genet 2010, 11:204-220 Athanasiadou R, de Sousa D, Myant K, Merusi C, Stancheva ... P, Baldi P: MotifMap: a human genome -wide map of candidate regulatory motif sites Bioinformatics 2009, 25:167-174 Yoshida-Hata N, Mitamura Y, Oshitari T, Namekata K, Harada C, Harada T, Yamamoto ... neighboring sequences are positively correlated The MEIS 1A carboxyl terminus harbors a transcriptional activation domain that is stimulated by protein kinase A in a manner dependent on the co- Page of...

12
458
0

Báo cáo y học: " A single dose of DNA vaccine based on conserved H5N1 subtype proteins provides protection against lethal H5N1 challenge in mice pre-exposed to H1N1 influenza virus" ppt

Ngày tải lên : 12/08/2014, 04:20

... Matsuo K, Asanuma H, Takahashi H, Iwasaki T, Suzuki Y, Aizawa C, Kurata T, Tamura S: Comparison of the ability of viral proteinexpressing plasmid DNAs to protect against influenza Vaccine 1998, 16:1544-1549 ... Ihata A, Liu LJ, Honsho A, Aoki I, Hamajima K, Wahren B, Okuda K: Protection against influenza virus challenge by topical application of influenza DNA vaccine Vaccine 2001, 19:4434-4444 Chang ... showed that DNA vaccination might be a quick and effective strategy against H5N1 infection in individuals innaive to influenza A virus Results Anti-H1N1 antiserum failed to afford protection against...

9
380
0

Báo cáo y học: "MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system" docx

Ngày tải lên : 14/08/2014, 08:20

... Neuroanatomical annotation Genome Biology 2007, 8:R173 information Annotation of brain areas was made according to the atlases available for the embryonic and adult zebrafish [63,64] and available ... dorsal hindbrain (cerebellar granular layer, facial and vagal lobes; Additional data file 5, and Tables D and I in Additional data file 27) As described above, miR-222 expression is also largely ... differentiated cells throughout the adult brain as in the larval brain (for instance, compare Vv in Figure 1i with Sv in Figure 1c; Additional data files 2-4, and Tables A and F in Additional data file...

16
400
0

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

Ngày tải lên : 13/04/2013, 10:29

... (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities of ... skilled and specialized discipline It concerns with managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations ... Class Class Stretching Stretching Up Up Ad Hoc Ad Hoc Brand Brand Extensions Extensions Co-Branding Co-Branding Creating aa Creating Range Brand Range Brand Figure 2.3 : A Variety of Ways of...

67
974
0

Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

Ngày tải lên : 20/02/2014, 05:20

... that AdjA1 and AdjA2 are mutually reinforcing The combination is indexed on AdjA1+AdjA2 Example: “as dark and sophisticated as a chocolate martini” (3) AdjA NounS where NounS denotes a cultural ... stimuli, any small portion of which can strike a chord as a potential readymade In this casual inspiration phase, the observant writer recognizes that a certain combination of words may produce, in another ... complement of adjectival properties used by Veale and Hao (2007), we harvest all instances of the patterns “as ADJ and * as” and “as * and ADJ as” from Google, noting the combinations that are found and...

6
442
0

Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx

Ngày tải lên : 21/02/2014, 06:20

... Sunday Archives, Grace College, Winona Lake, Indiana future business manager of the grand revival campaigns Also from this period are Nell’s oil paintings, a collection of a dozen paintings of various ... painted a wide variety of subjects as exercises, including still lifes of fruit and ﬂoral arrangements, a seascape, several rural landscapes, a western mountain landscape, and her own interpretation ... habits, and language patterns One author has gone so far as to assert that spoken language is actually a form of material culture, spoken words being air masses shaped by a speech apparatus according...

169
398
0

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Ngày tải lên : 07/03/2014, 06:20

... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... following the decrease in A4 56 Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S3 Reaction...

9
327
0

the impact of corporate cultural in vietnamese companies a case study of vietinbank, hoan kiem branch

Ngày tải lên : 13/03/2014, 14:20

... such as Saigon Bank for Commerce and Industry; Indovina Bank (the first joint-venture bank in Vietnam); Vietnam International Leasing Company – VILC (the first financial leasing company in Vietnam) ... Vietnam) and Vietinbank Insurance Company Ltd This bank has also being the official members of Vietnam’s Banker Association; Asian Banker’s Association; Society for Worldwide Interbank Financial Telecommunications ... Chairman of VietinBank;  Trading services: collecting and spending cash, budgeting, payment cards, etc  Business accounting and distributing income as the regulation of VietinBank;  Examining, auditing...

78
825
1

HealtH education PrinciPles in Patient education: A literature review of selected health education principles used in patient education pdf

Ngày tải lên : 22/03/2014, 15:20

... and integration in a multifaceted intervention so that individual parts interact To establish an overall educational approach and uniformity in all parts of patient education, also by way of participation ... results of this study suggest that cognitive and behavioural strategies as part of self-management programs would be useful for motivating and maintaining compliance to a regular walking program among ... selfdetermination and clinical decision-making, 18 Health Education Principles in Patient Education organisation of healthcare services and clinical information systems, and resources and local community...

67
326
0

13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

Ngày tải lên : 22/03/2014, 18:20

... nA Each analysis involves 10 cycles of sample-standard comparison and each cycle involves s integration of sample and standard ion beams Analyses were standardized by comparison with an intra-laboratory ... sample Filed re-sampling Drilled transect Sample Distance D47 No (mm) Standard Distance Sr/Ca d13CPDB d18OPDB error (mm) A3 6 A3 5 A3 3 A3 2 A3 1 A2 9 A2 8 A2 7 A2 6 A2 5 A2 4 A2 3 A2 2 A2 1 A1 9 A1 8 A1 7 A1 6 ... Sea experiences unusually large seasonal variations in sea-surface temperature (SST) between winter minima averaging 21.2 °C and summer maxima averaging 27.6 °C (Rayner et al., 1996), but varying...

18
472
0

Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc

Ngày tải lên : 23/03/2014, 10:21

... Although calpains may enhance caspase activity, they can also function to block the activation of caspases For example, calpains can cleave caspase rendering it incapable of activating caspase and ... Raynaud and A Marcilhac Indeed, although there is evidence in favor of calpains acting as a- secretases, such as (a) the a- secretase cleavage site is identical with a cleavage site of calpain in ... suggested a possible cascade of events involving three protease systems: calpain-induced cathepsin release, cathepsin-mediated caspase activation and caspase-mediated calpastatin degradation leading...

7
341
0

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

Ngày tải lên : 28/03/2014, 09:20

... Page 21 GAO-07-486 Global Health repair in West Africa and making newborn health a priority in Latin America and the Caribbean Finally, the Bureau for Global Health gave technical assistance and ... and maternal health within USAID Bureau for Asia and the Near East Bureau for Africa Bureau for Latin America and the Caribbean Oversee all country and regional missions in a particular geographic ... of the major causes of maternal death The study found that the major causes of maternal death vary by geographical region In Africa, the leading cause of maternal death is hemorrhage, while in...

64
379
0

Assessing counterparty risk at private companies in energy industry A descriptive survey of credit models potx

Ngày tải lên : 31/03/2014, 03:20

... banks enabling them to access and authority to operate in financial and capital markets From this credit information, financial information and qualitative appraisal of the majority of companies ... generated by various multinational agencies and/or locally at each country’s official business statistic report in form of master file data, combination of application and demographic data, as ... addressed in the academic literature This is mainly because the largest databases of credit performance and default frequencies are maintained by financial institutions, and thus they have larger...

60
324
0

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Ngày tải lên : 31/03/2014, 08:20

... complexes of inhibitory substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and ... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... 1A) Superpositioning of AMY2 and TAA guided by the catalytic acids was excellent for Tyr51AMY2 and Tyr82TAA (Fig 1A) and mutation in Saccharomycopsis buligera a- amylase (closely related to TAA)...

14
557
0

báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx

Ngày tải lên : 18/06/2014, 17:20

... 283–294 Kayongo M, Rubardt M, Butera J, Abdullah M, Mboninyibuka D, Madili M: Making EmOC a reality – CARE's experiences in areas of high maternal mortality in Africa International Journal of Gynaecology ... was carried out in Cameroon, Chad, Morocco, Nicaragua, Niger, Rwanda, Sri Lanka and Tanzania [22-35] Key interventions that were most often absent included assisted vaginal delivery and manual ... Koblinsky M, Matthews Z, Hussein J, Mavalankar D, Mridha MK, Anwar I, Achadi E, Adjei S, Padmanabhan P, Marchal B, et al.: Going to scale with professional skilled care [see comment][erratum appears...

12
640
0

báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot

Ngày tải lên : 18/06/2014, 17:20

... Happel B, Martin T, Pinikahana J: Burnout and Job satisfaction: a comparative study of psychiatric nurses from forensic and mainstream mental health service International Journal of Mental Health ... satisfaction, individual and organizational characteristics Journal of Advanced Nursing 2000, 32(3):536-543 Kaplan RA, Boshoff AB, Kellerman AM: Job involvement and job satisfaction of South African ... Hardy MA: Job satisfaction among nursing staff in a military health care facility Military medicine 2000, 165(10):757-761 Nolan M, Nolan J, Grant G: Maintaining nurses' job satisfaction and morale...

10
514
1

Báo cáo hóa học: " Gait kinematic analysis in patients with a mild form of central cord syndrome" pdf

Ngày tải lên : 19/06/2014, 08:20

... was calculated as the average of the values obtained in the five trials considered A descriptive analysis was made of the clinical and functional variables by calculating the mean and standard ... those from a normal population, not only in the spatialtemporal parameters of gait but also in the joint Page of 10 motion Accordingly, the findings obtained from the kinematic analysis of gait performed ... of Investigaciones Sanitarias del Instituto of Salud Carlos III del Ministerio of Sanidad PI070352 (Spain), and cofunded by FEDER, Consejer a of Sanidad of the Junta of Comunidades of Castilla-La...

10
440
0