Conventional and molecular detection of Listeria monocytogenes and its antibiotic sensitivity profile from cattle sources of aizawl, Mizoram (India)

The present study was conducted to study the prevalence of the food borne zoonotic pathogen of animal origin, L. monocytogenes by isolation and identification, molecular detection and antibiotic sensitivity pattern from different samples of cattle sources in Aizawl district of Mizoram. A total 200 numbers of sample including cattle faeces (50), raw milk (50) and milk products (100) were collected randomly from different unorganized shop and farms.

Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume Number 11 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.711.326 Conventional and Molecular Detection of Listeria monocytogenes and its Antibiotic Sensitivity Profile from Cattle Sources of Aizawl, Mizoram (India) Papia Biswas1*, Devajani Deka1, T.K Dutta2, E Motina1 and P Roychoudhury2 Department of Veterinary Public Health & Epidemiology, 2Department of Veterinary Microbiology, College of Veterinary Sciences & AH, Central Agricultural University, Selesih, Aizawl, Mizoram, 796014, India *Corresponding author ABSTRACT Keywords Listeria monocytogenes, PCR, Antibiotic sensitivity, Aizawl, Mizoram Article Info Accepted: 22 October 2018 Available Online: 10 November 2018 The present study was conducted to study the prevalence of the food borne zoonotic pathogen of animal origin, L monocytogenes by isolation and identification, molecular detection and antibiotic sensitivity pattern from different samples of cattle sources in Aizawl district of Mizoram A total 200 numbers of sample including cattle faeces (50), raw milk (50) and milk products (100) were collected randomly from different unorganized shop and farms The seasonal variation in the occurrence of L monocytogenes was also studied The L monocytogenes was isolated by using two step enrichment method of culturing and identified based on cultural characteristics, gram staining, biochemical properties, tumbling motility and in vitro pathogenicity tests The molecular detection of L monocytogenes strains were done by PCR using published primers The antibiotic sensitivity was studied against 12 numbers of commonly used antibiotics in animals and human The prevalence of L monocytogenes was recorded as 6.50 percent including 8.00 percent from cattle faeces, 6.00 percent from raw milk, 8.00 percent from lassi, dahi and ice-cream samples, respectively The L monocytogenes strains showed 100 percent sensitivity towards Penicillin, Ampicillin, Oxacillin, Cephotaxime/Clavulanic acid, Ciprofloxacin, Tetracycline and Trimethoprim/Sulphamethoxazole followed by Streptomycin (84.61%), Chloramphenicol (53.84%), Gentamicin (53.84%) and Ceftriaxone (46.15%) Introduction Listeriosis has been among important food borne zoonotic diseases since long, mostly due to its high mortality rate despite of being uncommon in human beings (Atil et al., 2011) The severity of the disease has become significant as the causative organism Listeria monocytogenes is the most important species in the genus can be secreted through milk of both healthy and infected animals (Wagner et al., 2000) This is still called an emerging pathogen as its transmission through contaminated food is recently recognized L monocytogenes is a gram positive, ubiquitous, non-spore forming organism that can survive a 2829 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 wide range of pH from 4.0-9.6 and temperature from -1.5°C to 45°C (Lado and Yousef, 2007) Listeriosis is commonly characterized by meningoencephalitis, generalised septicaemia and abortion (Late pregnancy) in both human and animals Young individuals along with immunocompromised ones are more susceptible than others Way back in 1985, Listeriosis was declared as serious public health hazards (Rocourt and Catimel, 1985) Listeria spp have been reported as susceptible to antibiotics active against gram positive bacteria but in recent years like many other bacterial pathogens Listeria are developing resistance to many currently used antibiotics Current choice of antibiotics for all forms of listeriosis is combination of Ampicillin and Gentamicin (Schlech and Acheson, 2000) The studies on L monocytogenes in the perspective of foodborne pathogen are scanty in North-East Region states of India including Mizoram Therefore keeping the above points in view, the present study was undertaken to isolate, identify and to study the prevalence and antimicrobial sensitivity pattern of L monocytogenes from different samples of cattle source s in Aizawl district of Mizoram Materials and Methods Study area The present study on isolation and identification, molecular detection and antimicrobial sensitivity pattern of L monocytogenes from different samples of cattle sources was carried out in Aizawl district of Mizoram It is mainly a hilly state of North-eastern region It extends from 21°56'N to 24°31'N, and 92°16'E to 93°26'E It is the 2nd least populous state in the country and it is covers an area of approximately 21,087 square kilometres About 91percent of the area in the state is forested Period of the study The study was conducted for a period of one year from July, 2017 to June, 2018 and the study period was divided into two halves; Summer (March to September) and Winter (October to February) Collection of Samples A total of 200 numbers of faecal samples of cattle, raw milk and milk products were collected randomly from different unorganized cattle farms/ milk vendors/ shops periodically during the study period by following aseptic measures for detection of L monocytogenes during the study period Distributions of different samples collected are given in the Table Isolation and phenotypic characterization of L monocytogenes Enrichment of faecal sample The USDA (USDA FSIS, 2002) method was employed for isolation of Listeria spp from faecal samples of cattle by two step enrichment method Primary enrichment of five grams of faecal sample was done in 45 ml 1/2 strength UVM-I broth containing selective supplements (HiMedia Pvt Ltd., Mumbai)® and incubated for 24 hours at 30°C followed by secondary enrichment of 0.1 ml from the primary broth culture in 10 ml UVM-II broth containing selective supplements and incubated for 48 hours at 37°C Enrichment of milk and milk products Food and Drug Administration (2015) testing methodology with slight modification was employed for isolation and identification of L monocytogenes from cattle faeces, raw milk and milk products (lassi, dahi, ice-cream and rasmalai) Twenty five ml of sample was 2830 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 mixed with 225 ml of UVM broth properly for minutes and the mixture was incubated at 30 ± 2°C for 24 hours For secondary enrichment, 0.1ml of the cultured UVM was transferred to 10 ml of Fraser broth (FB) and incubated at 37°C for 24 ± hours Selective plating of L monocytogenes (UVM-Broth and FB culture) in PALCAM, McBride and TSYEA agar A drop of approximately 0.1ml of FB broth culture turning to black colour was streaked aseptically upon PALCAM and McBride agar plates and the plates were incubated at 37°C for 24–48 hours The suspected colonies on PALCAM/ McBride agar plates were streaked with the help of a sterile loop on TSYEA plate and incubated at 37°C for 24 hours and subsequently tested for further biochemical and in vitro pathogenicity characteristics Morphological and biochemical characteristics of L monocytogenes The L.monocytogenes strains were phenotypically characterized by morphological characteristics, Gram staining reaction and biochemical characteristics (Catalase, Oxidase, Motility, Indole, Methyl Red, Voges-Proskauer, Citrate utilization, fermentation patterns of sugars like LRhamnose, D-Xylose and Mannitol etc.) (Quinn et al., 1994) In vitro pathogenicity test Beta haemolysis test on five percent sheep blood agar The suspected colonies on PALCAM/ McBride/ TSYEA agar plates were streaked on five percent Sheep Blood Agar (SBA) plates and the plates were incubated at 37°C for 24 hours The L monocytogenes positive SBA plate showed translucent colonies surrounded by a small zone of β-haemolysis after back light Christie, Atkins, Munch- Petersen (CAMP) Test The presence of in-vitro pathogenicity of L monocytogenes by CAMP test was as per the method of ISO (1996) The standard strains of Rhodococcus equi (MTCC 8144) and Staphylococcus aureus (MTCC 43300) were streaked on freshly prepared percent SBA plates wide apart and parallel to each other The test strains were streaked at 90° angle to R equi and S aureus with a distance of three mm apart from these strains streaking line The streaked plates were incubated for 24 hours at 37°C and examined for haemolytic zone from partial haemolysis to a wider zone of complete haemolysis The isolates with CAMP- positivity against S aureus were characterized as L monocytogenes giving a spade shaped haemolytic zone formation Molecular detection of L monocytogenes Bacterial lysate preparation All the culturally, phenotypically and biochemically positive L monocytogenes isolates were processed for bacterial lysate preparation using boiling and snap chill method A single colony of phenotypically confirmed strain was inoculated into one ml of LB broth and incubated at 37°C for 16-18 hours After overnight incubation at 37°C, cells were pelleted by centrifugation at 8000 rpm for 10 minutes at 4°C Then the pellet was washed three times with sterile normal saline solution (0.85%) and finally re-suspended in 500µl of nuclease free sterile distilled water The cell suspension was heated in a boiling water bath for five minutes followed by immediate chilling The cellular debris was sediment by centrifugation at 5000 rpm for 2831 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 five minutes The supernatant was used as template DNA for PCR assay Detection of species specific gene (16SrRNA) of L monocytogenes isolates by PCR All the culturally, phenotypically and biochemically positive L monocytogenes isolates were subjected for 16S-rRNA species specific gene amplification by PCR using published primer and according to the methodology described by Jallewar et al., (2007) The details about the primer sequence are given at Table The PCR assay was carried out in 0.2 ml thin PCR tube To detect species specific genes of L monocytogenes, the PCR protocol was standardized by using standard L monocytogenes (MTCC 1143) as positive control and sterile milli-Q water as negative control The final composition for 25 μl reaction mixture is given at Table Amplification of DNA was performed in a Thermal cycler machine with a pre-heated lid The detail of the cycling condition for the species specific gene was given in the Table All the amplified PCR products were analyzed by agarose gel electrophoresis using one percent agarose gel in 1X TAE buffer (pH 8.0) About five µl of PCR product was mixed with μl of X gel loading dye and loaded into each well DNA ladder (3000 bp) was used as reference to compare the size of amplified products The gel was visualized under UV transilluminator (Alpha Imager) and documented by gel documentation system (Alpha Imager) Detection of antibiotic sensitivity and resistance pattern of L monocytogenes strains All the L monocytogenes isolates were subjected to in vitro antibiotic sensitivity test by disc diffusion method (Bauer et al., 1966) against a panel of 12 antibiotics namely Penicillin G, Ampicillin, Oxacillin, Streptomycin, Erythromycin, Cephotaxime/ Clavulanic acid, Ceftriaxone, Chloramphenicol, Ciprofloxacin, Gentamicin, Tetracycline and Trimethoprim/ Sulphamethoxazole as per Clinical and Laboratory Standard Institute (CLSI) guidelines (2014) The L monocytogenes isolates were inoculated into Brain Heart Infusion (BHI) broth and incubated for 24 hours at 37°C After that, 200 µl of each inoculum was taken on Muller Hinton agar plates and spread eventually with the help of sterile L-shaped spreader Then the plates were allowed to dry and antibiotic discs were placed on media aseptically with the help of sterile forceps Next, the plates were incubated at 37°C for 24-48 hours After completion of incubation the diameter of zone of inhibition was compared with the standard known value against each specific antimicrobial agent from interpretation guide line (Hi-Media)® Results and Discussion Isolation and monocytogenes identification of L Out of 200 different samples from cattle sources (cattle faeces, raw milk and milk products) of Aizawl, a total 29 (14.50%) samples were found to be positive for Listeria spp by the cultural method in which isolates turned into black colour in different broth (FB and UVM) and also showed different characteristics of colonies on different agars such as green colonies with black haloes in PALCAM agar, dense white to iridescent white appearing as crushed glass in McBride agar and clean glass like colonies in TSYEA agar after 24-48 hours of incubation at 37°C Based on the Gram staining reaction and different biochemical tests (catalase: positive:; oxidase: negative: tumbling motility; indole: negative; methyl red: positive; VogesProskauer: positive citrate: negative; L- 2832 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 rhamnose: positive; D- Mannitol fermentation: negative; D- Xylose fermentation: negative, weak haemolysis on sheep blood agar and positive CAMP test against Staphylococcus aureus characteristics), 13 (6.50%) numbers of L monocytogenes were identified and the findings were in accordance with Gupta and Sharma (2012) and Walse et al., (2003) (Table 5, and Figure 1–12) The detection of Listeria spp from food products is challenging due to the concurrence presence of other organisms within the food product In this respect, the isolation method in respect to specific pathogen is critical and must allow recovery and detection of injured cells too In food, detection of Listeria spp is generally performed in a two-step cultural enrichment process and along with selective supplements like antibacterial and antifungal agents The bacteriological culture methods commonly used for detection and identification of the bacteria include aesculin and ferric iron in enrichment or plating media, which results through the hydrolysing capacity of Listeria spp., in the formation of intense black colour (Fraser and Sperber, 1988) Results of in vitro pathogenicity tests showed that Listeria spp brought about haemolysis on five per cent SBA similar to the earlier records of Blanco et al., (2008) The Christie Atkins Munch-Petersen (CAMP) test is a unique confirmatory tool for identification of this food borne pathogen The Listeria spp isolates recovered during the study have shown the positive CAMP pattern against S aureus (ISO, 1996) Prevalence of L monocytogenes in different samples of cattle sources (faeces, raw milk and milk products) from Aizawl, Mizoram The prevalence of L monocytogenes was recorded as 6.50 percent (13/200) comprised of 8.00 percent (4/50) strains from cattle faeces, 6.00 percent (3/50) from raw milk, 8.00 percent (2/25) from lassi, dahi and icecream samples, respectively (Table and Figure 13) Listeria monocytogenes was detected from the raw milk and ready to eat refrigerated milk products produced locally from unpasteurized milk like dahi, lassi and ice-cream whereas the organism was not isolated from rasmalai which is a well-cooked milk product stored for a short duration of time in the sweet shops The Higher prevalence rates of L monocytogenes from faecal samples of ruminants were recorded by Lawan et al., (2003) (10.00%) and Kalorey et al., (2006) (16.00%) from Nigria and Nagpur (India), respectively Waghmare, (2006) evaluated the incidence of Listeria spp in raw milk from different markets of Mumbai city (India) and revealed prevalence of Listeria spp and L monocytogenes amongst the pasteurized milk samples with the incidence of 21.32 and 5.88 per cent in unpasteurized milk samples Similarly, Chandio et al., (2007) reported 6.00 per cent of L monocytogenes in raw cow milk where as higher incidence of prevalence of L monocytogenes (21 70%) was reported by Sharma et al., (2012) from 115 raw cow milk samples in Meerut and Babugarh Cantt, Hapur, India In contrast, studies conducted at Coimbatore (Tamilnadu) and Mangalore, India reported that branded milks were more prone to L monocytogenes than the local milk (Dhanashree et al., 2003; Sheela and Muthukmar, 2011) However, Moharram et al., (2007) reported 5.00 percent incidence of L monocytogenes from nonbranded ice-cream samples from different ice cream parlours of Mysore (India) The seasonal distribution of L monocytogenes revealed 4.95 and 8.08 percent of prevalence in summer and winter season, respectively The Seasonal fluctuation of L monocytogenes in the milk has been reported as 1.69 per cent in summer and 3.82 per cent in winter (Aurora et al., 2006) (Table and Figure 14) 2833 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Table.1 Distribution of different samples of cattle sources collected from Aizawl district of Mizoram Sl No State Aizawl (Mizoram) Type of sample Number of samples Cattle faeces Raw cow milk Lassi Dahi Ice-cream Rasmalai Total 50 50 25 25 25 25 200 Seasonal distribution Summer Winter 25 25 25 25 13 12 13 12 12 13 13 12 101 99 Table.2 Oligonucleotide primers used for detection of species specific gene of L monocytogenes by PCR Target Genes 16SrRNA Primer Sequence (5’-3’) FGGACCGGGGCTAATACCGAATGATAA R- TTCATGTAGGCGAGTTGCAGCCTA Base Pair (bp) 1200 Reference Weidmann et al.,(1993) Table.3 Composition of PCR reaction mixture for detection of species specific gene and virulence genes of L monocytogenes Sl No Ingredients PCR Master Mixture 2x Forward primer Reverse primer Template Milli-Q water Total Volume (µl) 12.5 1 6.5 25.0 Table.4 Thermal cycling condition for detection of species specific (16S-rRNA) gene of L monocytogenes Sl No Stages Initial denaturation Denaturation Annealing Elongation Final Extension for cycle No of cycle PCR for 16Sr-RNA gene of L monocytogenes 94°C for 94°C for 30 sec 56.5°C 45 sec 72°C for 30 sec 72°C for 35 2834 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Table.5 Morphological and biochemical test results of L monocytogenes Sl No 10 11 Morphological/biochemical test Gram staining Catalase Oxidase Motility Indole Methyl Red Voges-Proskauer Citrate L-Rhamnose fermentation D- Mannitol fermentation D- Xylose fermentation Positive characteristics Positive Positive Negative Tumbling Negative Positive Positive Negative Positive Negative Negative Table.6 Listeria monocytogenes isolation by cultural method and confirmed by biochemical test collected from different source of cattle of Aizawl (Mizoram) district Sl No State Type of sample Aizawl (Mizoram) Cattle faeces Raw cow milk Lassi Dahi Ice-cream Rasmalai Total Number of samples analyzed 50 50 25 25 25 25 200 Number of samples positive for Listeria spp by cultural method 4 29 Number of samples positive for L monocytogenes after biochemical test 2 13 Table.7 Prevalence of L monocytogenes in different samples of cattle source from Aizawl (Mizoram) district (n=200) Sl No State Aizawl (Mizoram) Total Type of sample Number of samples analyzed Cattle faeces Raw milk Lassi Dahi Ice-cream Rasmalai 50 50 25 25 25 25 200 2835 Number of sample positive for L monocytogenes 2 13 % prevalence of L monocytogenes 8.00 6.00 8.00 8.00 8.00 0.00 6.50 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Table.8 Season wise prevalence of L monocytogenes isolated from different samples of cattle source from Aizawl (Mizoram) district Sl No State Type of sample Number of sample tested in winter Number of sample tested in winter Cattle faeces 25 25 (4.00%) (12.00%) Raw milk 25 25 (4.00%) (8.00%) Lassi 13 12 (7.69%) (8.33%) Dahi 13 12 (7.69%) (8.33%) Ice-cream 12 13 (8.33%) (7.69%) Rasmalai 13 12 - - 101 99 (4.95%) (8.08%) Aizawl (Mizoram) Total Seasonal distribution of L monocytogenes Prevalence Prevalence in in summer winter Table.9 Antibiotic Sensitivity and Resistance pattern of L monocytogenes isolated from different samples of cattle source of Aizawl (Mizoram) district Sl No Antimicrobial agent No of isolates Penicillin G (P) Ampicillin (AMP) Oxacillin (OX) Streptomycin (HLS) Erythromycin (E) Cephotaxime / Clavulanic acid (CEC) 13 13 13 13 13 13 L monocytogenes isolated from cattle faeces Sensitive Intermediate Resistance (%) (%) (%) 13 100 13 100 13 100 11 84.61 15.38 7.69 12 92.30 13 100 - 10 11 12 Ceftriaxone (CTR) Chloramphenicol (C) Ciprofloxacin (CIP) Gentamicin (GEN) Tetracycline (TE) Trimethoprim/Sulpha methoxazole (COT) 13 13 13 13 13 13 13 13 13 2836 46.15 53.84 100 53.84 100 100 - 15.38 - - 53.84 30.76 46.15 - Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Figure : Milk products with UVM -I Figure 2: L monocytogenes on PALCAM agar Figure 3: L monocytogenes on McBride agar Figure 4: L monocytogenes on TSYEA agar Figure 5: L monocytogenes showing gram staining positive Figure 6: L monocytogenes showing oxidase negative and Catalase positive Figure 7: L monocytogenes showing umbrella shaped growth in Listeria motility Figur e 8: IMVIC test showing MR and VP +ve for L monocytogenes 2837 Figure 9: Sugar fermentation tests for L monocytogenes (Rhamnose +ve, Xylose and Mannitol – ve) Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Figure 10: L monocytogenes weak ? - haemolysis on SBA showing Figure 11: L monocytogenes showing positivity in CAMP test 00 Ice-cream 2 Lassi Cattle faeces T ype of sample 4 7 No of samples Positive for L.monocytogenes by biochemical tests Positive for Listeria spp cultural method Figure 12: Detection of Listeria monocytogenes from different samples of cattle source from Aizawl (Mizoram) district by cultural method (n=200) Figure -1 Prevalence of L monocytogenes in different samples of cattle source from Aizawl (Mizoram) district (n=200) s 2838 10 Percentage (%) Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 12% 15% 10% 5% 7.69% 8.33% 8% 4% 8.33% 7.69% 8.33% 7.69% 4% 0 0% Cattle faeces (n=50) Raw milk (n=50) Lassi (n=25) Dahi (n=25) Ice-Cream (n=25) Rasmalai (n=25) Type of sample Prevalence in Summer Prevalence in Winter Figure 14: Season wise prevalence of L monocytogenes isolated from different samples of cattle source from Aizawl (Mizoram) district (n=200) L1 L2 L3 L4 L5 L6 L7 L8 L9 1500 bP 1000 bp 1200 bp Figure-15: Agarose gel electrophoresis showing the PCR amplicons of 16S-rRNA gene (1200bp) obtained from L monocytogenes strains; L1: 3000 bp DNA ladder; L2: Positive control; L3: Negative control; L4 to L9: Representative samples Figure 16: Antibiotic sensitivity and resistance pattern of L monocytogenes isolated from different samples of cattle source of Aizawl (Mizoram) district 2839 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Listeria is a widely distributed bacterium in nature and commonly found in soil, sewage, dust, water and causes listeriosis in humans and animals (Norton et al., 2001) Of the various milk pathogens, L monocytogenes is one of the deadly organisms which occurs largely in all types of environment, including foods grown in contaminated environment, poorly processed/stored food, milk and associated products (Priyanka and Alka, 2008) The study of incidence of Listeria spp in cattle faeces, milk and milk products in their selling units provide information about the carrier status in cattle and contamination status of the milk and milk products The milk producing and processing environment and handling practices may vary place to place and production practices There are chances of increase in cross contamination as 47 per cent of surface of hand of the food handlers and 16 per cent on the processing tables were found to carry L monocytogenes (Kerr et al., 1993; Jayasekaran et al., 1996) The presence of Listeria spp particularly L monocytogenes in ready to eat milk products like dahi, lassi, ice cream and raw milk could be a major food safety issue for consumers as L monocytogenes should be absent in RTE foods (US-FDA) (Fusch et al., 1992) Detection of species specific gene (16SrRNA) of L monocytogenes in different samples of cattle source The culturally, phenotypically and biochemically positive 13 numbers of L monocytogenes isolates were subjected for 16S-rRNA species specific gene amplification using the standardized PCR protocol by using published primer All the 13 numbers of L monocytogenes strains isolated from Aizawl districts of Mizoram were positive for 16SrRNA gene (Figure 15) Antibiotic sensitivity monocytogenes pattern of L All the 13 L monocytogenes strains showed 100 percent sensitivity towards Penicillin, Ampicillin, Oxacillin, Cephotaxime/ Clavulanic acid, Ciprofloxacin, Tetracycline and Trimethoprim/ Sulphamethoxazole followed by Streptomycin (84.61%), Chloramphenicol (53.84%), Gentamicin (53.84%) and Ceftriaxone (46.15%) Conversely the L monocytogenes strains showed highest resistance to Erythromycin (92.30%), Ceftriaxone (53.84%), Gentamicin (46.15%) and Chloramphenicol (30.76%), respectively (Table and Figure 16) There is growing concern of bacterial adaptation and evolution resulting in the emergence of antimicrobial resistant bacteria pathogens since last 50 years The prevalence of antimicrobial resistance among food borne pathogens has increased during recent decades (Akbar and Anal, 2014) The frequent and unnecessary use of antimicrobial agents in food animals for therapeutic and prophylactic purposes in animals are contributing to create resistant strains Animal origin foods are the major sources of transmission of antimicrobial resistant organisms to human The antimicrobial resistant bacteria from food animals may colonize the human population via food chain, contact through occupational exposure or waste run off from animal production facilities Resistant bacteria may readily transferred from food animals to human beings as the similar kind of antimicrobial agents are used in human practice also, therefore the detection of antimicrobial resistance pattern is a matter of public health significance Sharma et al., (2012) detected 80-90 percent resistance of L monocytogenes strains from raw milk of Meerut and Babugarh Cantt, Hapur (India) to Nalidixic acid, Amoxycillin + Sulbactum, Vancomycin, 2840 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Kanamycin, Cloxacillin, and Erythromicin whereas many were susceptible to the Ampicillin, Ofloxacin, Tetracycline, Streptomycin, Sulphafurazole, Oxacilin and Ciprofloxacin The findings of Sharma et al., (2017) is alarming as they recently isolated Multi Drug Resistant (MDR) strains of L monocytogenes from raw milk in Rajasthan and emphasized on the need of awareness among consumers Implementation of food safety regulations at different levels of milk production has come up as a great public health issue The present study detected the L monocytogenes, a major zoonotic pathogen causing fatal infections in human by conventional and molecular detection methods in different samples of cattle sources namely faeces, raw milk and milk products in the study area indicating the public health significance of the pathogen The presence of the organism in cattle faeces indicated the carrier status and the presence in raw milk and refrigerated milk products produced locally and sold in local markets under unhygienic condition is alarming public health threat to the consumers The well-cooked milk product (Rasmalai) which is stored for a short period of time has been found to be free from L monocytogenes Acknowledgements The authors duly acknowledge to the Dean, College of Veterinary Sciences & Animal Husbandry, Central Agricultural University, Selesih, Aizawl, Mizoram for providing the funds with necessary facilities to conduct this study under the Department of Veterinary Public Health and Epidemiology References Akbar, A., and Anal, A.K 2014 Zinc oxide nanoparticles loaded active packaging a challenge study against Salmonella typhimurium and Staphylococcus aureus ready-to-eat poultry meat Food Contr., 38:88-95 Atil, E., Ertas, H.B., and Ozbey, G 2011.Isolation and molecular characterization of Listeria spp From animals, food and environmental samples Vet Med., 56: 386 394 Aurora, A., Prakash, A., and Prakash, S 2006 Occurrence of pathogenic Listeria monocytogenes in raw milk and ready to eat milk products in Agra city India Indian J Comp Microbiol Immunol Infect Dis., 27(2): 87-93 Bauer, A.W., Kirby, W.M.M., Sherris, J.C., and Turck, M 1966 Antibiotic susceptibility testing by a standardized single disc method Amer J Clin Patho., 45:493-496 Blanco, M B., Fernandez-Garayzabal, J F., Dominguez, L., Briones, V., VazquezBoland, J A., Blanco, J L., Garcia, J A., and Suarez, G 2008 A technique for the direct identification of haemolytic pathogenic Listeria on selective plating media Lett Al Microbiol., 9:125-128 Chandio, T.H., Soomro, A.H., Bhutto, M.B., Dewani, P., and Shah, G 2007 Occurrence of Listeria monocytogenes in bovine milk in Hyderabad, Pakistan Ann Microbiol., 57:341- 344 CLSI (2014) Performance Standards for Antimicrobial Microbial Susceptibility testing 18th Information supplement M100-S18 Wany, PA: Clinical and Laboratory Standards Institute Dhanashree, B., Otta, S.K., and Karunasagar, I 2003 Typing of Listeria monocytogenes isolates by random 2841 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 amplification of polymorphic DNA Indian J Med Res., 117:19–24 FDA 2015 Testing methodology for L monocytogenes in environmental samples Version Fraser, J.A., and Sperber, W.H 1988 Rapid detection of Listeria spp in food and environmental samples by esculin hydrolysis J Food Prot., 51:762-765 Fusch, R.S., and Reilly, P.J.A 1992 The incidence and significance of in sea foods In: H H Huss, and M Jackobsen (ed), Proceeding of an International Conference on ―Quality Assurance in the Fish industry‖, Copenhagen, Denmark pp 217-230 Gupta, S., and Sharma, V 2012 Antibiotic resistance pattern among different Listeria species isolated from mutton and chevon J Anim Res., 3: 99-102 International Organization for Standardization, 1996 Microbiology of food and animal feeding stuffsHorizontal method for detection and enumeration of Listeria monocytogenespart-1: Detection method International Standard ISO11290-1, Geneva, Switzerland Jallewar, P.K., Kalorey, D.R., Kurkure, N.V., Pande, V.V., and Barbuddhe, S.B 2007 Genotypic characterization of Listeria spp isolated from fresh water fish Int J Food Microbiol., 114: 120–123 Jayasekaran, G., Karunasagar, I., and Karunasagar, I 1996 Incidence of Listeria species in tropical fish Int.J Food Microbiol., 31: 333-340 Kalorey, D.R., Kurkure, S.R., Rawool, D.B., Mallik, S.V.S., and Barbuddhe, S.B 2006 Isolation of pathogenic Listeria monocytogenes in faeces of wild animals in captivity Comp Immunol, Microbiol Inf Dis., 29:295-300 Kerr, K.G., Birkenhead, D., Seale, K., Major, J., and Hawkey, P.M 1993 Prevalence of Listeria spp on the hands of food workers J Food Prot., 56:525-527 Lado, B., and Yousef, A E 2007 Characteristics of Listeria monocyotgenes important to food processors, Chapt In: Ryser E T and Marth E H (Eds), Listeria, listeriosis and food safety, 3rd edn, CRC Press Taylor and Francis Group, Boca Raton Pp 157-213 Lawan, F A., Tijjani, A N., Raufu, A I., Ameh, J A., Ngoshe, I Y., and Auwal, M.S 2003 Isolation and characterization of Listeria species from ruminants in Maiduguri north-eastern Nigeria Afr J Biotechnol., 12(50):6997-7001 Moharram, M., CharithRaj, A.P., and Janardhana, G.R 2007 Prevalence of Listeria monocytogenes in ice creams sold in Mysore city and detection by Polymerase Chain Reaction (PCR) Asian J Microbiol Biotechnol Environ Sci., 9:151-154 Norton, D.M., McCamey, M.A., Gall, K.L., Scarlett, J.M., Boor, K.J., and Wiedmann, M 2001 Molecular studies on the ecology of Listeria monocytogenes in the smoked fish processing industry Appl Environ Microbiol., 67: 198-205 Priyanka, S., and Alka, P 2008 Isolation of Escherichia coli, Staphylococcus aureus and Listeria monocytogenes from milk products sold under market conditions at Agra region Acta agriculturae Slovenica., 92: 83–88 Quinn, P.J., Carter, M.E., Markey, B.K., and Carter, G.R 1994 General procedures in microbiology Clin Vet Microbiol Wolfe Publishing, London, pp 648 Rocourt, J., and Catimel, B 1985 Biochemical characterization of species in the genus Listeria Zentralble Bakteriologika Mikrobiol Hyg., 260:221 231 2842 Int.J.Curr.Microbiol.App.Sci (2018) 7(11): 2829-2843 Schlech III, W.F., and Acheson, D 2000 Foodborne listeriosis Clin Infect Dis., 31(3): 770-775 Sharma, D., Sharma, P.K., Saharan, B.S., and Malik, A 2012 Isolation, identification and antibiotic susceptibility profiling of antimicrobial resistant Listeria monocytogenes from dairy milk Int J Microbial Res Technol., 1: 1-4 Sharma, S., Sharma, V., Dahiya, D.K., Khan, A., Mathur, M., and Sharma, A 2017 Prevalence, virulence potential, and antibiotic susceptibility profile of Listeria monocytogenes isolated from bovine raw milk samples obtained from Rajasthan, India Foodborne Pathog Dis., 14(3): 132-140 Sheela, M.M., and Muthukmar, M 2011 Effectiveness of Ozone to Inactivate the Listeria monocytogenes from the Milk samples World J Young Researchers., 1(3): 40 – 44 United States Department of Agriculture – Food Safety and Inspection Service (FSIS) (2002) Isolation and Identification of Listeria monocytogenes from Red Meat, Poultry, Egg and Environmental Samples, Revision 03, April 29, 2002 In: Microbiol Lab Guidebook pp 1–21 Waghmare, R.N 2006 Prevalence and Molecular characterization of Listeria monocytogenes from milk Thesis, M.V.Sc, MAFSU, Bombay Veterinary College, Mumbai Wagner, M., Podstatzky-Lichtens, L., Lethner, A., Asperger, H., Baumgarther, W., and Brand, E 2000 Prolonged excretion of Listeria monocytogenes in a subclinical case of mastitis Milchwisschaft, 55: Walse, S.H., Paturkar, A.M., Sherikar, A.T., Waskar, V.S., Zende, R.J., and Vaidya, V.M 2003 Prevalence of Listeria spp in mutton and chevon J Vet Pub Health., 1:65-68 Weidmann, M., Barany, F., and Batt, C.A 1993 Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain assay Appl Environ Microbiol., 59(8): 2743-2745 How to cite this article: Papia Biswas, Devajani Deka, T.K Dutta, E Motina and Roychoudhury, P 2018 Conventional and Molecular Detection of Listeria monocytogenes and its Antibiotic Sensitivity Profile from Cattle Sources of Aizawl, Mizoram (India) Int.J.Curr.Microbiol.App.Sci 7(11): 2829-2843 doi: https://doi.org/10.20546/ijcmas.2018.711.326 2843 ... Dutta, E Motina and Roychoudhury, P 2018 Conventional and Molecular Detection of Listeria monocytogenes and its Antibiotic Sensitivity Profile from Cattle Sources of Aizawl, Mizoram (India) Int.J.Curr.Microbiol.App.Sci... isolation and identification, molecular detection and antimicrobial sensitivity pattern of L monocytogenes from different samples of cattle sources was carried out in Aizawl district of Mizoram. .. Nigria and Nagpur (India), respectively Waghmare, (2006) evaluated the incidence of Listeria spp in raw milk from different markets of Mumbai city (India) and revealed prevalence of Listeria spp and