yew tissue resulting in cleaned extracts that can be used for hplc — use of the c 18 sep pak™ column protocol 4

báo cáo hóa học: " Quality of life in South East Asian patients who consult for dyspepsia: Validation of the short form Nepean Dyspepsia Index" docx

Ngày tải lên : 18/06/2014, 18:20

... prevalence and clinical course of functional dyspepsia Aliment Pharmacol Ther 20 04, 19(6): 643 -6 54 Haycox A, Einarson T, Eggleston A: The health economic impact of upper gastrointestinal symptoms in the ... organic disease, supporting the construct validity of the instruments Once again, the magnitude of this reduction in SFNDI scores was less marked in the Malay version of the SFNDI and the smaller ... produced with the aim of achieving equivalence in concepts (i.e conceptual equivalence) and meaning (i.e semantic equivalence), from which a consensus forward Malay translation was obtained,...

9
447
0

Tài liệu Write Data Validation Code That Can Be Reused in Other Classes docx

Ngày tải lên : 24/12/2013, 06:17

... a constructor to the CCustomerID class that accepts a CCustomerID object as a parameter, as shown in Listing 9 .44 Listing 9 .44 CCustomerID.vb: An Object-Based Constructor for the CCustomerID Class ... classes because the CLR must resolve which members of the object must actually be called This cannot be done at compile time, because in many cases, the specific type of the object is ambiguous in ... Another Extension of the CNumberString Class, This Time for SSNs Public Class CSocialSecurityNo Inherits CNumberString Public Class InvalidSSNException Inherits CNumberString.InvalidNumberStringException...

16
360
0

Báo cáo y học: "Combinatorial RNA interference in Caenorhabditis elegans reveals that redundancy between gene duplicates can be maintained for more than 80 million years of evolution" pdf

Ngày tải lên : 14/08/2014, 17:22

... RNA interference (RNAi) can recapitulate known synthetic lethal interactions Combinatorial RNA interference (RNAi) can recapitulate known synthetic lethal interactions To test whether combinatorial ... of a second gene, then these two genes are said to interact genetically Genetic interactions can be used to identify novel components of molecular pathways and can reveal the redundancy that underlies ... methods, below) These genes have thus been duplicated in the genome of C elegans since the divergence from either species To determine whether there is functional redundancy between the duplicated...

13
318
0

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Ngày tải lên : 17/03/2014, 23:20

... oligonucleotides for 30 at 25 C The oligonucleotide sequences used as the 32P-labelled probes and competitors were: MREa, 5¢-GGGCGCC TGCGCCCCCGTTCC-3¢ ( )44 1 to )42 1); MREa mut1, 5¢-GGGCGCCAATGCCCCCGTTCC-3¢; ... MREe mut, 5¢-GGCCATTGGCTGGCCTTaatGCACAGCGGATCG ATTTTC-3¢; MREc mut, 5¢-CCAGTACAGTGTCGG AGCattCCAGCGCGAGGTGGCCG-3¢; MREd mut, 5¢-CGGGAGGACGGCGGCGCattACTTTGAATCAT CCGTG-3¢ Mutations in the MREs were ... 5¢-GGGCGCCAATGCCCCCGTTCC-3¢; MREa mut2 : 5¢-GGGCGCCTGCGCCCTTATTCC-3¢; Sp1 : 5¢-ATT CGATCGGGGCGGGGCGAGC-3¢ (underlined bases denote the functional core of the MREs and the Sp1 binding element, and the mutated...

11
628
0

Báo cáo lâm nghiệp: "Infrared images of heat ﬁelds around a linear heater in tree trunks: what can be learned about sap ﬂow measuremen" pptx

Ngày tải lên : 07/08/2014, 16:20

... distances, a can be calculated numerically from (15) and inserted into ( 14) for calculation of b Basically, the HFD technique may be easier changed for measuring dynamics of ellipses in such a ... hydromechanical computer program) Therefore we will concentrate on understanding the dynamics of the observed infrared ellipse patterns, focused around the inserted heater, the eccentricity of which ... equivalent to the dimension of the main axis 2a The distance F1F2 = 2e, that is twice the linear eccentricity e of the ellipse, described √ by e = a2 − b2 The ratio of linear eccentricity to the big...

8
377
0

Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot

Ngày tải lên : 09/08/2014, 07:20

... study before these markers can be used as an additional prognostic measurement in daily practice More recently, ELISA assays for C1 , 2C, for C2 C, for CS 846 -epitope, and for CPII have become commercially ... increase of 6 .4% in the joint space narrowing score during the next year caused by a one standard deviation increase in the C2 C value Discussion The search for markers to predict radiographic ... radiological scores (specifically, for each combination of one of the four biomarkers and one of the three damage scores) A statistically significant interaction was found for C2 C, for C1 , 2C, and for...

9
525
0

báo cáo khoa học: " A review of health system infection control measures in developing countries: what can be learned to reduce maternal mortality" pps

Ngày tải lên : 11/08/2014, 14:21

... yet the principles of infection control remain the same across clinical areas and in different resource settings, so the findings of the studies are relevant to maternity care The link between infection ... demonstrated its effectiveness in reducing infection rates, but it was the seminal SENIC (Study on the Efficacy of Nosocomial Infection Control) findings which are of greatest interest [40 ,42 ] The study ... complex and multifaceted approaches in obstetric units The choice of the specific combination of components to be evaluated can be informed by what is known from the wider infection control literature,...

9
551
0

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Ngày tải lên : 12/08/2014, 16:20

... The clinical details of subjects included are summarised in table Twenty-three of 27 subjects also performed spirometry in accordance with American Thoracic Society guidelines Table 1: Clinical ... The aims of the present study were therefore to investigate i) whether BWT, as shown on HRCT, can be used as a noninvasive indicator of RBM thickness in EB, in a group of children with difficult ... considered, then even from their data BWT on HRCT cannot be used as a surrogate for RBM thickness on EB Conclusion In summary, these data demonstrate that measurements of BWT on HRCT cannot be used...

9
390
0

Báo cáo y học: "Tissue fibrocytes in patients with mild asthma: A possible link to thickness of reticular basement membrane" pptx

Ngày tải lên : 12/08/2014, 16:20

... Quantification of CD 34, CD45RO, in fibrocytes Quantification of CD 34, CD45RO, α-SMA, procollagen I and prolyl -4- hydroxylase coexpression in fibrocytes Cells in bronchial biopsies coexpressing CD 34/ CD45RO/α-SMA ... were included in all experiments to correct for background fluorescence Isotype controls were used in combination and for each fluorochrome to decrease the risk of detecting unspecific staining ... as being collagen producing cells The cells were therefore stained for prolyl -4- hydroxylase, a protein critically involved in collagen synthesis, and procollagen I Prolyl -4- hydroxylase/CD45RO could...

9
314
0

Báo cáo y học: "Can performance indicators be used for pedagogic purposes in disaster medicine training?" docx

Ngày tải lên : 13/08/2014, 23:20

... evaluate the teaching performance of instructors in disaster medicine training Well-trained instructors are essential for conducting effective disaster medicine training How can we assess whether instructors ... medicine instructor training course by using postulated performance indicators The indicators used in this study were established based on the results of our experience of the disaster medicine instructor ... competencies of trainers in preparing, executing and evaluating skills and knowledge for disaster medicine training The results were scored as 0, or according to the performance of the 'instructors'...

5
194
0

windows xp services that can be disabled

Ngày tải lên : 19/10/2014, 09:30

... tớnh cht v c im ca C ng ty In - Thng mi - Dch v Ngõn hng nh trờn lm cho C ng ty c nhiu chc nng nh l: Chc nng thng mi, chc nng sn xut, chc nng dch v C c chc nng ny c th hin rừ qua c c ngnh ngh kinh ... doanh ca C ng ty C c ngnh ngh kinh doanh ch yu: - In c c n phm phc v cho hot ng ca Ngõn hng NN & PTNT Vit Nam, ca c c t chc tớn dng kh c v khỏch hng ca t chc tớn dng - Thc hin c c loi hỡnh dch v ... dn ch o thc hin tt ch k toỏn hin hnh cho c c k toỏn viờn C ng ty - Phú phũng k toỏn ngoi vic c trỏch nhim v c c phn hnh k toỏn t c nghip trc tip c n phi chu trỏch nhim i vi c c mng c ng vic c...

13
516
0

PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone

Ngày tải lên : 27/06/2016, 10:30

... them for a bad or poorly received presentation • Learning to use them is only a part of becoming a better presenter • Can enhance or ruin the message • Powerpoint slides should not be a crutch ... acquired without any formal training, • And without getting accurate feedback Supporting Materials • Slide-shows not the heart of the presenation • For backup, not a script Training in presentation ... training to help develop key techniques and build confidence New Skill Set What makes a good presentation • • • • • • Using your voice effectively, Controlling the pace of delivery, Using effective...

23
393
0

Báo cáo y học: "Multivariate explanatory model for sporadic carcinoma of the colon in Dukes’ stages I and IIa"

Ngày tải lên : 03/11/2012, 11:34

... rejection of a total of controls and cases at the defining moment of the construction of the data package The fundamental cause was the lack of fulfilment of the inclusion criteria The assembly of the ... the Dukes classification [18] to the Astler-Coller [30] classification because of the long period of data collection of our investigation and because it was the one that we used from the beginning ... progression in patient with metastatic colorectal cancer treated with 5-fluoroucil-based chemotherapy Clin Colorrectal Cancer 2003; 4: 231-2 34 Sanz Rubiales A., García Alvarez G Significance of carcinoembryonic...

8
559
0

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Ngày tải lên : 19/02/2014, 07:20

... substrateÆmin)1) It remains possible that more chronic alteration of circulating insulin results in significant changes of circulating DPP IV Indeed, further fractionation demonstrated the presence of ... Sequence coverage indicates the percentage of the identified protein covered by the sequences of identified peptides; m indicates the molecular mass of each protein predicted from the sequence (pred.) ... from the cell surface In this regard, an increased circulating concentration of the soluble form of DPP IV may result in an increased proteolysis of GLP-1 peptides and thus decreased insulin secretion...

12
738
0

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Ngày tải lên : 06/03/2014, 11:20

... Tyr 349 Tyr 347 Features of the amino acid sequence of the V spinosum tyrosinase Copper binding motif Copper binding motif Cys 84 Arg40 bacterial Copper binding motif Copper binding motif Cys 84 Core ... Phe453 Tyr 349 Tyr 347 Copper binding motif Copper binding motif Cys 84 Arg40 Pro-tyrosinase 48 1 amino acids Ala36 Phe453 Tyr 349 Tyr 347 Copper binding motif Trypsinisedpro-tyrosinase 332 amino acids ... the presence of an amino acid that occludes the active site This idea has been proposed because of similarities in the structures of the C- terminals of the related family of haemocyanins to plant...

13
778
0

Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

Ngày tải lên : 07/03/2014, 12:20

... binder of the substrate when in the active conformation The presence of such a form in enzyme can be observed by kinetics If an unproductive binder is present, the Hill-coefﬁcient should indicate ... plants, the product (E)-cinnamic acid is hydroxylated at the para-position by cinnamate -4- hydroxylase (C4 H), in conjunction with NADPH:cytochrome P450 reductase (CPR) The coordinated reactions catalyzed ... decreases As homotetrameric PAL contains four catalytically active sites according to the crystal structures [40 42 ], it is probable that the isolated isoforms of the bean PAL after chromatofocusing...

16
502
0

Báo cáo Y học: Transient activation of the c-Jun N-terminal kinase (JNK) activity by ligation of the tetraspan CD53 antigen in different cell types pptx

Ngày tải lên : 08/03/2014, 22:20

... endogenous JNK activity, the cells were incubated for h in the presence of MEM53 antibody The luciferase activity was corrected for the eﬃciency of transfection by determining the activity of plasmid ... in tumor cell invasion Evidence for 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 the role of the complexes in production of matrix metalloproteinase (MMP-2) J Cell Biol 146 , 1375–1389 ... through the cell cycle The differences in the effects caused by mAbs are due to their recognition of different epitopes on the CD53 molecule All of these data indicated that tetraspanin proteins,...

10
517
0

Postal Savings and the Provision of Financial Services: Policy Issues and Asian Experiences in the Use of the Postal Infrastructure for Savings Mobilization pdf

Ngày tải lên : 15/03/2014, 09:20

... postal checking services: Austria, Belgium, Burkina Faso, Central African Republic, Chad, China, C te d’Ivoire, Croatia, Czech Republic, Democratic Republic of Congo, Denmark, Dominican Republic, ... and Canada), 1997 The similar use of fax machines in Morocco and the United Republic of Tanzania points to the value of establishing mechanisms for fostering the exchange of practical experience ... should be given to providing continuing incentives to the posts and the postbank to actively cooperate in the operations of postal financial services Such incentives can include some form of ownership...

38
645
3

Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf

Ngày tải lên : 16/03/2014, 00:20

... respectively, and for construction of the Tr(L559G) mutant, the primers 5¢-ACCCCAAGATCGACTGGGCGG TAAG CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG GGT-3¢ were used ... ascomycete laccases, because the C- terminus of C cinereus laccase does not contain the conserved ascomycete cleavage site [ 24] The role of C- terminal processing of the ascomycete laccases is not ... construction of the Sc(L559A) mutant for PCR reactions were as follows: forward, 5¢-CCAAGATCGACTCG GGCGCTTAGCGTCGC-3¢; and reverse, 5¢-GCGACGCT AAGCGCCCGAGTCGATCTTGG-3¢ For construction of the Sc(delDSGL559)...

16
452
0

Being Born Under Adverse Economic Conditions Leads to a Higher Cardiovascular Mortality Rate Later in Life: Evidence Based on Individuals Born at Different Stages of the Business Cycle pdf

Ngày tải lên : 17/03/2014, 08:20

... year cohort changes with the cyclical indicator of the business cycle at birth Their data are from the Netherlands and contain the social class of the parents at the moment of birth They conclude ... study the effect of conditions during pregnancy more precisely by taking the date of birth within the birth year into account We interact the season of birth with the business cycle in the year before ... Note also that the effect of being born in Copenhagen is larger for the cancer mortality rate than for the CV mortality rate 4. 4 Underlying mechanisms The long-run effects of the business cycle at...

45
453
0