when a valuation allowance is required the replacement cost of the raw materials and other consumables may be the best available measure of their net realisable value

You know why is MOM the best?

Ngày tải lên : 26/09/2013, 03:10

... FORGOT TO LOVE HER MORE THAN EVER … AND IF SHE’S NOT, REMEMBER HER UNCONDTIONAL LOVE AND PASS IT ON … ALWAYS REMEMBER TO LOVE YOUR MOTHER, BECAUSE YOU ONLY HAVE ONE MOTHER IN YOUR LIFE TIME !!!! ... òm ☆ When you were 24 years old, she met your fiancé and asked about your plans for the future You thanked her by glaring and growling, “muuhh-ther, please!” Và bạn 24 tuổi, mẹ gặp chồng ch a cưới ... cách nói bạn bận bù đầu ☆ When you were 50 years old, she fell ill and needed you to take care of her You thanked her by reading about the burden parents become to their children Khi bạn 50,...

4
410
0

Tài liệu The Internal Revenue Service Is Not Adequately Protecting Taxpayer Data on Laptop Computers and Other Portable Electronic Media Devices docx

Ngày tải lên : 18/02/2014, 04:20

... Computers and Other Portable Electronic Media Devices Appendix V Office of Management and Budget Memoranda The Office of Management and Budget1 has issued several memoranda addressing data protection ... such as a fire, it is possible that all data maintained at a facility could be destroyed The IRS reduces this risk by maintaining backup data at offsite facilities Because IRS backup data are often ... and taxpayer data, the associated disciplinary penalties for negligence over these responsibilities, and a statistical summary of actual violations and disciplinary actions relating to loss of...

42
289
0

Tài liệu Báo cáo khoa học: Mechanisms of obesity and related pathologies: Androgen deﬁciency and endothelial dysfunction may be the link between obesity and erectile dysfunction pptx

Ngày tải lên : 18/02/2014, 06:20

... regarding this pathophysiological state Central (abdominal) obesity, as assessed by several characteristics including BMI, WC and WHR, is considered as a hallmark of the MetS and is associated ... by visceral obesity can have a profound and damaging effect on the endothelium not only in the systemic vascular circulation, but also in the peripheral vascular bed, such as the penis, and can ... men may be attributed to an increased peripheral aromatization of testosterone and the increased E2 levels may alter LH levels in obesity, thus modulating the pituitary gonadal axis [70,71] Another...

13
662
0

Regional Food Hub Resource Guide: Food hub impacts on regional food systems, and the resources available to support their growth and development pdf

Ngày tải lên : 23/03/2014, 08:21

... dedicated to helping food hub operators and supporters understand and navigate through the variety of financial and human resources available to them What Funds Are Available From the Federal Government ... comprise a majority of their sales, and secondary markets are other market channels in which they participate but which comprise a smaller portion of their overall sales Including both primary and ... operations and reduce costs The Common Market won the award because its work increases the quality and quantity of fresh, healthy, and affordable food available to vulnerable communities and...

92
469
0

Integrated Pollution Prevention and Control (IPPC) Reference Document on Best Available Techniques in the Pulp and Paper Industry pptx

Ngày tải lên : 01/04/2014, 00:20

... global nature of the pulp and paper business today By 2010 it is anticipated that the major markets of the USA, Europe and Japan are joined by Asia and in particular China and Indonesia Southeast ... For chemical usage the availability of a database for all used chemicals and additives and the application of the principle of substitution is considered as BAT That means that less hazardous products ... such as storage and handling of chemicals, occupational safety and hazard risk, heat and power plants, cooling and vacuum systems and raw water treatment are not or only briefly treated This BREF...

509
3K
4

Báo cáo y học: "Cost-effectiveness model comparing olanzapine and other oral atypical antipsychotics in the treatment of schizophrenia in the United States" ppt

Ngày tải lên : 13/08/2014, 11:22

... ziprasidone; ARIP = aripiprazole Further analysis showed that olanzapine remained dominant when the rates of diabetes for aripiprazole and ziprasidone were kept at the base case value and all others ... by setting the minima and maxima of the range to be 50% and +50% of the base case value The second PSA extended the first analysis by adding distributions around the number and cost of resources ... revision and validation of baseline assumptions when new and additional relevant scientific data are available Competing interests Haya Ascher-Svanum, Anthony Lawson, and Robert Conley are all...

22
385
0

Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx

Ngày tải lên : 16/03/2014, 13:20

... 5¢-CGCTGCAGTAAGAGCAGTAAACCCG-3¢ 5¢-GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT-3¢ 5¢-GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG-3¢ 5¢-GGGCGGATCCTCTGCTTTTCTTTATC-3¢ 5¢-GCGCTAATGCAACCGTAGTCAATTGATTAACGTGCT-3¢ ... 5¢-GCGCTAATGCAACCGTAGTCAATTGATTAACGTGCT-3¢ 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢ 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢ 5¢-AGCACGTTAATCAATTGACTAATCTGGTTCTTTTAA-3¢ 5¢-AAGCAAGAACAGTTCACTGCAGCTTTTGGTCAAGCAGGTAACTAGTCAATTGAT-3¢ ... 5¢-AAGCAAGAACAGTTCACTGCAGCTTTTGGTCAAGCAGGTAACTAGTCAATTGAT-3¢ 5¢-ATCAATTGACTAGTTACCTGCTTGACCAAAAGCTGCAGTGAACTGTTCTTGCTT-3¢ 5¢-GCGCTAATGCAACCGATAGATGTCTCTACGGAGGAC-3¢ 5¢-GTCCTCCGTAGAGACATCTATCGGTTGCATTAGCGC-3¢ 5¢-GACGACGAAACAAGAAAAGATGGCGCCATCGAGATG-3¢...

17
313
0

Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot

Ngày tải lên : 23/03/2014, 07:20

... were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; ... Lethal phase analysis and phenotypic characterization The djmje03131 and Df(3L)AC1 alleles were rebalanced with TM6BGFP and TM3GFP balancer chromosomes, respectively Lethal phase analysis and ... merged images of dJmj and DAPI staining showed that dJmj was localized mostly to bands, but it was also observed in interbands and at band–interband boundaries, and no correlation was observed between...

13
356
0

Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx

Ngày tải lên : 18/06/2014, 22:20

... cells At an MOI of 0.1 or 0.5 there was an average reduction of 99.1% of infectious virus particles (Fig 2) At an MOI of there was an average reduction of 95.7%, and at an MOI of 10 there was an average ... associated with the immature virus along with the accompanying DNA and other viral proteins, then activation of I7L leads to the process of core protein precursor cleavage and the initiation of ... in any of the infected cells observed There appeared to be an accumulation of immature viral particles, some with nucleoids, as well as the appearance of crescent shaped particles (Fig 4, panels...

6
300
0

báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx

Ngày tải lên : 20/06/2014, 04:20

... cells At an MOI of 0.1 or 0.5 there was an average reduction of 99.1% of infectious virus particles (Fig 2) At an MOI of there was an average reduction of 95.7%, and at an MOI of 10 there was an average ... associated with the immature virus along with the accompanying DNA and other viral proteins, then activation of I7L leads to the process of core protein precursor cleavage and the initiation of ... in any of the infected cells observed There appeared to be an accumulation of immature viral particles, some with nucleoids, as well as the appearance of crescent shaped particles (Fig 4, panels...

6
208
0

Báo cáo y học: "A nuclear export signal within the structural Gag protein is required for prototype foamy virus replication" pdf

Ngày tải lên : 13/08/2014, 01:20

... extracts and cell-free supernatants shows the absence of viral particles in the supernatants of GagG110V, GagΔNES and Gag-RevNES transfected cells whereas the intracellular Gag mutants are normally ... GagF10 9A, GagL9 5A/ F9 7A and GagΔ95-112 mutants, which each showed a similar distribution as the G110V mutant, were further examined for release particle and infectivity (data not shown) and behaved ... fractionated Hela cell extracts of Gag WT and GagG110V Detection of the human lactate dehydrogenase (LDH) in cytoplasmic extracts only attests the validity of the fractionation assay (C: Cytoplasm, N:...

11
253
0

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Ngày tải lên : 13/08/2014, 09:20

... YW and XQ constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study CS performed the analysis of DNA microarray data and performed the statistical analysis AR conceived ... similarity below each GO node This number is then compared against the distribution of counts expected for a random list of the same size Statistical consideration of the counts is based on a sampling ... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG,...

16
178
0

Báo cáo y học: " Older patients in the ICU: a cautious analysis of epidemiologic data is required" ppt

Ngày tải lên : 14/08/2014, 08:21

1
204
0

Báo cáo sinh học: "Prediction error variance and expected response to selection, when selection is based on the best predictor for Gaussian and threshold characters, traits following a Poisson mixed model and survival traits" potx

Ngày tải lên : 14/08/2014, 13:21

... |A1 | |A2 | 322 I.R Korsgaard et al is the expected additive genetic value of an offspring, conditional on A and A2 being the sets of selected males and females, and under the assumption of random ... (ai |data) = Ev|data Var (ai |v, data) + Varv|data E (ai |v, data) the ﬁrst term Ev|data Var (ai |v, data) = Ev|data Var (ai |v) (because p (ai |v, data) = p (ai |v), which follows from the conditional ... selection For Gaussian traits, then the joint distribution of (ai , aibp ) is bivariate normal, ˆ this is not the case for any of the other traits studied Anyhow this assumption has been used (and noted...

27
254
0

Changing a sentence into the passive voice when the active verb is in the simple future tense

Ngày tải lên : 11/07/2015, 10:18

1
617
0

Changing a sentence into the passive when the active verb is in the past perfect tense

Ngày tải lên : 11/07/2015, 10:18

... Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered by TCPDF (www.tcpdf.org)...

2
722
0

Changing a sentence into the passive when the active verb is in the simple past or past continuous tense

Ngày tải lên : 11/07/2015, 10:18

... Mother was making a cake The girl was painting a picture Answers A poem was being written by Megha Clothes were being washed by the woman The house was being built by the masons A cake was being ... masons A cake was being made by mother A picture was being painted by the girl Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered...

2
707
0

The Art of Public Speaking cylinder, piston, water, and fire, is the steam−engine in its most elementary form. For a steam−engine may be defined as an apparatus for doing work by means of heat applied to water; and since raising such a weight as the pisto

Ngày tải lên : 08/08/2012, 17:20

5
1.3K
3

Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx

Ngày tải lên : 20/12/2013, 23:15

... in the application and the written arguments presented in the appeal briefs After careful consideration of these materials, we hold that the refusal to register must be affirmed As applicant ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written ... arguments, and made the refusal to register final in the second Office Action Submitted with that action in support of the final refusal were copies of a number of third-party trademark registrations...

8
416
0

Tài liệu Is It the Network? Solving VoIP Problems on a Wireless LAN ppt

Ngày tải lên : 24/01/2014, 09:20

... reserved Page Once you begin analyzing delay limits rather than raw bandwidth limits, quantitatively determining a maximum handset capacity per AP becomes impractical Since the random backoff sequence ... Acknowledgments accompany that data In addition, Wi-Fi networks have a random backoff sequence that allows a wireless AP and the stations that connect to it to share a wireless channel Since a detailed discussion ... that can cause roam times to increase to unacceptable levels When handling the effect that handset roaming has on wireless VoIP, it’s best to be familiar with both the network and the handset Make...

11
478
0