use of and with variables of a class type

UNIQUENESS OF POSITIVE SOLUTIONS OF A CLASS OF ODE WITH NONLINEAR BOUNDARY CONDITIONS RUYUN MA AND pdf

UNIQUENESS OF POSITIVE SOLUTIONS OF A CLASS OF ODE WITH NONLINEAR BOUNDARY CONDITIONS RUYUN MA AND pdf

Ngày tải lên : 23/06/2014, 00:20
... Lanzhou 730070, China E-mail address: mary@maths.uq.edu.au Yulian An: Physical Software & Engineering, Lanzhou Jiaotong University, Lanzhou 730070, Gansu, China E-mail address: an yulian@tom.com ... solutions for a nonlinear differential equation with nonlinear boundary conditions, Ann Polon Math 69 (1998), no 2, 155–165 L Erbe and M Tang, Structure of positive radial solutions of semilinear elliptic ... elliptic equations on annular domains, Nonlinear Anal Ser A: Theory Methods 44 (2001), no 6, 749–758 J Henderson and H Y Wang, Positive solutions for nonlinear eigenvalue problems, J Math Anal Appl...
  • 10
  • 281
  • 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Ngày tải lên : 21/12/2013, 19:15
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...
  • 2
  • 392
  • 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Ngày tải lên : 18/01/2014, 04:20
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1 Copyright...
  • 2
  • 374
  • 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

Ngày tải lên : 23/03/2014, 19:20
... Stutz 1996 Bayesian classification (AutoClass): Theory and results In Fayyad, Piatetsky-Shapiro, Smyth, and Uthurusamy, editors, Advances in Knowledge Discovery and Data Mining AAAI Press/MIT ... Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can be tagged with certainty Using only simple features, the classifier achieves ... including AutoClass (Cheeseman and Stutz, 1996) The form of the latent class model is that of naive Bayes: the observed variables are all conditionally independent of one another, given the value of...
  • 8
  • 354
  • 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Ngày tải lên : 20/06/2014, 01:20
... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG S F E...
  • 11
  • 854
  • 0
Báo cáo toán học: " Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" pot

Báo cáo toán học: " Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" pot

Ngày tải lên : 20/06/2014, 21:20
... using alternating surface-saturating reactions of titanium chloride and water The TiOPDA-TiO2 nanohybrid thin films that were prepared exhibit good thermal and mechanical stability, large-scale ... binding energy scale was calibrated to 284.5 eV for the main C 1s peak Each sample was analyzed at a 90° angle relative to the electron analyzer The samples were analyzed by a JEOL2100F transmission ... thermal and mechanical stability Experimental details Preparation of Si substrates The Si (100) substrates used in this research were cut from p -type (100) wafers with a resistivity in the range of...
  • 6
  • 359
  • 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

Ngày tải lên : 21/06/2014, 06:20
... control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear uncertain ... We use P > < 0, ≤ 0, ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain ... Journal of Inequalities and Applications 1, are real constant matrices of appropriate dimensions and F t is an where Di , Ei , i unknown time-varying matrix with F T t F t ≤ I The following lemmas...
  • 13
  • 444
  • 0
báo cáo hóa học:" Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" ppt

báo cáo hóa học:" Fabrication of a new type of organic-inorganic hybrid superlattice films combined with titanium oxide and polydiacetylene" ppt

Ngày tải lên : 21/06/2014, 17:20
... using alternating surface-saturating reactions of titanium chloride and water The TiOPDA-TiO2 nanohybrid thin films that were prepared exhibit good thermal and mechanical stability, large-scale ... binding energy scale was calibrated to 284.5 eV for the main C 1s peak Each sample was analyzed at a 90° angle relative to the electron analyzer The samples were analyzed by a JEOL2100F transmission ... thermal and mechanical stability Experimental details Preparation of Si substrates The Si (100) substrates used in this research were cut from p -type (100) wafers with a resistivity in the range of...
  • 6
  • 292
  • 0
Báo cáo hóa học: "Research Article The Solution of Two-Point Boundary Value Problem of a Class of Duffing-Type Systems with Non-C1 Perturbation Term" pdf

Báo cáo hóa học: "Research Article The Solution of Two-Point Boundary Value Problem of a Class of Duffing-Type Systems with Non-C1 Perturbation Term" pdf

Ngày tải lên : 21/06/2014, 20:20
... 1199–1214, 2005 H Wenhua, “Minimax theorems and applications to the existence and uniqueness of solutions of some differential equations,” Journal of Mathematical Analysis and Applications, vol 322, ... each eigenvalue is repeated according to its multiplicity If A commutes with B, that is, AB BA, then A B is a diagonalization matrix and μ1 λ1 ≤ μ2 λ2 ≤ · · · ≤ μn λn are the eigenvalues of A ... this paper to achieve their research References S A Tersian, A minimax theorem and applications to nonresonance problems for semilinear equations,” Nonlinear Analysis: Theory, Methods & Applications,...
  • 12
  • 198
  • 0
Báo cáo hóa học: " Research Article Existence and Uniqueness of Positive and Nondecreasing Solutions for a Class of Singular Fractional Boundary Value Problems" ppt

Báo cáo hóa học: " Research Article Existence and Uniqueness of Positive and Nondecreasing Solutions for a Class of Singular Fractional Boundary Value Problems" ppt

Ngày tải lên : 21/06/2014, 20:20
... Problems Y Ling and S Ding, A class of analytic functions defined by fractional derivation,” Journal of Mathematical Analysis and Applications, vol 186, no 2, pp 504–513, 1994 D Delbosco and L Rodino, ... metric spaces,” Journal of Mathematical Analysis and Applications, vol 341, no 2, pp 1241–1252, 2008 13 A A Kilbas and J J Trujillo, “Differential equations of fractional order: methods, results and ... problems—I,” Applicable Analysis, vol 78, no 1-2, pp 153–192, 2001 14 S G Samko, A A Kilbas, and O I Marichev, Fractional Integrals and Derivatives Theory and Applications, Gordon and Breach Science,...
  • 10
  • 291
  • 0
Báo cáo hóa học: "Research Article The Solvability of a Class of General Nonlinear Implicit Variational Inequalities Based on Perturbed Three-Step Iterative Processes with Errors" potx

Báo cáo hóa học: "Research Article The Solvability of a Class of General Nonlinear Implicit Variational Inequalities Based on Perturbed Three-Step Iterative Processes with Errors" potx

Ngày tải lên : 21/06/2014, 22:20
... general class of variational inclusions,” Journal of Mathematical Analysis and Applications, vol 201, no 2, pp 609–630, 1996 C Baiocchi and A Capelo, Variational and Quasivariational Inequalities: Applications ... Siddiqi and Q H Ansari, “Strongly nonlinear quasivariational inequalities,” Journal of Mathematical Analysis and Applications, vol 149, no 2, pp 444–450, 1990 22 A H Siddiqi and Q H Ansari, “General ... Theory and Applications algorithm, and obtained the existence of solutions for a class of variational inclusions and convergence of the iterative algorithm In 2004, Liu and Kang 19 established...
  • 13
  • 251
  • 0
Báo cáo hóa học: " Research Article Secrecy Capacity of a Class of Broadcast Channels with an Eavesdropper" potx

Báo cáo hóa học: " Research Article Secrecy Capacity of a Class of Broadcast Channels with an Eavesdropper" potx

Ngày tải lên : 21/06/2014, 22:20
... [8] to a broader class of channels (3) We also investigate a class of parallel multireceiver wiretap channels with two subchannels, two users, and one eavesdropper, see Figure For the channels ... model, we again have a parallel multireceiver wiretap channel with two subchannels, two users, and one eavesdropper, and the degradation order in each subchannel is exactly the same as in the ... message secrecy capacity for a special class of parallel multireceiver wiretap channels was studied in [8] In this class of parallel multireceiver wiretap channels [8], each subchannel exhibits a...
  • 29
  • 521
  • 0
Báo cáo hóa học: " Research Article A Generalized Wirtinger’s Inequality with Applications to a Class of Ordinary Differential Equations" docx

Báo cáo hóa học: " Research Article A Generalized Wirtinger’s Inequality with Applications to a Class of Ordinary Differential Equations" docx

Ngày tải lên : 22/06/2014, 02:20
... 139–164, 1978 J L Kaplan and J A Yorke, “Ordinary differential equations which yield periodic solutions of differential delay equations,” Journal of Mathematical Analysis and Applications, vol 48, ... is a periodic solution of 1.2 with period T 2.20 2π Journal of Inequalities and Applications Acknowledgments The authors would like to thank the referee for careful reading of the paper and many ... solutions, and stability of solutions, have been studied by many authors since 1970s of the last century, and a lot of remarkable results have been achieved We refer to 1–6 for reference The delay equation...
  • 7
  • 238
  • 0
Báo cáo hóa học: " Research Article The Nonzero Solutions and Multiple Solutions for a Class of Bilinear Variational Inequalities Jianhua Huang" pptx

Báo cáo hóa học: " Research Article The Nonzero Solutions and Multiple Solutions for a Class of Bilinear Variational Inequalities Jianhua Huang" pptx

Ngày tải lên : 22/06/2014, 18:20
... Banach Space and Nonlinear Partial Differential Equations, vol 49 of Mathematical Surveys and Monographs, American Mathematical Society, Providence, RI, USA, 1997 Jianhua Huang: Institute of Mathematics ... [2] M A Noor, “On a class of variational inequalities,” Journal of Mathematical Analysis and Applications, vol 128, no 1, pp 138–155, 1987 [3] S S Zhang and S W Xiang, “On the existence and uniqueness ... uniqueness of solutions for a class of variational inequalities with applications to the Signorini problem in mechanics,” Applied Mathematics and Mechanics, vol 12, no 5, pp 401–407, 1991 [4] K.-Q Wu and...
  • 9
  • 235
  • 0
Báo cáo hóa học: "OSCILLATION AND NONOSCILLATION THEOREMS FOR A CLASS OF EVEN-ORDER QUASILINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS" pdf

Báo cáo hóa học: "OSCILLATION AND NONOSCILLATION THEOREMS FOR A CLASS OF EVEN-ORDER QUASILINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS" pdf

Ngày tải lên : 22/06/2014, 21:20
... 137–152 [8] T Tanigawa and W Fentao, On the existence of positive solutions for a class of even order quasilinear differential equations, Advances in Mathematical Sciences and Applications 14 (2004), ... (Russian) [2] T Kusano and B S Lalli, On oscillation of half-linear functional-differential equations with deviating arguments, Hiroshima Mathematical Journal 24 (1994), no 3, 549–563 [3] T Kusano and ... Department of Mathematics and Computer Science, Faculty of Science and c Mathematics, University of Niˇ, Viˇegradska 33, 18000 Niˇ, Serbia and Montenegro s s s E-mail address: jelenam@pmf.ni.ac.yu...
  • 22
  • 293
  • 0
Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt

Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt

Ngày tải lên : 11/08/2014, 11:20
... advancing borders and muscular involvement, subcutaneous air, and undermining of the epidermis [14] Also, surgery and pathology indicated intact fascial plains with edema, and the absence of ... collaboration, no alternative diagnosis applied to our patient We reiterate that amputation in this scenario was an unfortunate and Page of debilitating last resort once all therapeutic modalities ... list, and created the tables JM wrote the abstract, case presentation and discussion and conducted journal and literature research SZ reviewed the case presentation and added to the treatment of...
  • 7
  • 468
  • 0
báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps

báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps

Ngày tải lên : 12/08/2014, 00:20
... that was linked to the general tasks and demands category (D2302) from chapter 2, general tasks and demands and an item linked to remunerative employment (D850) Oude Voshaar et al Health and ... 0.60) with other measures of PF and measures of other aspects of physical health and moderately (0.30
  • 13
  • 384
  • 0
báo cáo khoa học:" Quality of life of children and their caregivers during an AOM episode: development and use of a telephone questionnaire" pps

báo cáo khoa học:" Quality of life of children and their caregivers during an AOM episode: development and use of a telephone questionnaire" pps

Ngày tải lên : 12/08/2014, 01:21
... development and used of a telephone questionnaire designed to measure the severity of AOM and its consequences on the QOL of the child and of the caregiver and its use in a country-wide survey in Canada ... six domains The OM-6 also contains a visual analog scale of happy and sad faces allowing the caregiver to rate their child QOL on a 10-point scale This was Descriptive statistics were generated ... between children with severe AOM, (i.e AOM that lasted ≥ days and had ≥ related-symptoms, n = 56) and children with less severe AOM, (i.e AOM that lasted ≤ days and had ≤ related-symptoms, n...
  • 7
  • 311
  • 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Ngày tải lên : 13/08/2014, 13:20
... and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then obtained A ratio ... using a human genomic β-actin calibration curve Absolute viral and β-actin DNA copy number was assessed and final viral DNA load per 106 cells was calculated by the following formula: [HHV-6 DNA ... National Institutes of Health (NIAID/NIH) to Fatah Kashanchi Fatah Kashanchi and Steve Jacobson share senior authorship 18 19 20 21 References Hegde P, Qi R, Abernathy K, Gay C, Dharap S, Gaspard...
  • 15
  • 376
  • 0

Xem thêm