... compromised and group comparison is not valid Where cut points are already established, asinthe current case, we would argue that analysis of DIF represents an elegant mechanism for establishing and ... software and significance levels Rasch analysis was undertaken using the RUMM2020 package [18] During the Rasch analysis, Bonferroni corrections are applied to both fit and DIF statistics due to the ... 2.776 (SD 0.6) forthe former, and 0.580 (SD 1.5) forthe latter The final pass scores for all subtests are presented in Table andthe percentage passing each subtest are given in Table All subtests...
... right awaydo not let them sit s These are standards in consultant work and emphasized over and over by authors inthe field Fowler, Sally and Idalene F Kesner "When Consultants and Clients Clash." ... dictate demand for paper rolls, with an increase in 67 manufacturing output being favorable for paper manufacturers The state of downstream demand causes significant shifts at each stage of the ... was researching the use of bamboo inthe paper industry Many companies in Asia have made advances in using bamboo in products such as textiles, flooring, cosmetics, paper, and food However, many...
... maintaining an acceptable combination of height and diameter growth An important part of our oak improvement programme aims to gain a better understanding of the development and control of branching ... nursery andthe field have been analysed separately The effects of clones and treatments were investigated by analysis of variance As previous studies have shown that bud and branch numbers are related ... (Harmer, 198 9a, 199 2a) analyses of these data used length asa covariate; any levels of significance given inthe text, tables or figures result from these analyses However, the means and standard...
... information gained from assessment to determine their next teaching and learning steps -7- Parents and families can be kept informed of next plans for teaching and learning andthe progress being made, ... performance, using them over time so as to reveal change, growth, and increasing degrees of integration Such an approach aims fora more complete and accurate picture of learning, and therefore ... at elaborating on the participants and setting, justifying the research instruments as well as describing in details the instrument and procedures of collecting and analyzing data III.1 Research...
... Border Kuala Lumpur Residency Border Kuala Lumpur Kota Kinnabalu Melaka Pulau Langkawi Singapore Genting Highlands Thailand Hong Kong Kuala Lumpur Thailand Cambodia Thailand Penang Langkawi Kuala Lumpur ... deemed acceptable asthe second case study was a different type of case study While Pulau Langkawi and Genting Highlands are both contained resorts, Kuala Lumpur and Putrajaya are multi-faceted ... observation more specific and documents (such as sales packs) requested due to knowing what information was required rather than seeing what was available Pulau Langkawi is a small island and the...
... one of the environmental standard items analyzed in marine areas in Japan Suspended solids (SS) was measured using the above-mentioned glass-fiber filter, and chlorophyll -a was analyzed by the SCOR/UNESCO ... was a rainy year (Q: 434m3/s) and 2003 was an average year (Q: 236m3/s) During the observation periods, years with more rainfall had larger mean pollutant loads than years with less rainfall The ... and analyzed inorganic ions and organic matter The water samples taken at the three points spanning the river during the five flooding-stages were analyzed individually, andthe representative...
... running to tell the other fishermen of the town about it, he just went home and fell asleep Landing the fish did not matter to the old man only to get it as far asthe side of the boat The Old Man ... Man AndThe Sea portrays Hemingway Code Heros to their fullest potential As Heros they try their hardest to persevere under pressure and achieve the goal in front of them They show the characteristics ... offered each other the best of company While out at sea Santiago is constantlywishing the boy was there to talk to or to help with the mighty fish Santiago does not have relationships with any of the...
... (22.2%) Hispanic/Latino, (9.7%) Black/African American, (9.7%) Asian/Pacific Islander, 2(2.8%) Native American or Native Alaskan, and (12.5%) missing The statewide SCHIP sample was representative of ... conceptualization and design, and performed the statistical analysis All authors read and approved the final manuscript Acknowledgements This research was supported by a grant from the David and Lucile Packard ... calculated by taking the difference between the healthy sample mean andthe ADHD sample mean, divided by the healthy sample standard deviation Effect sizes for differences in means are designated...
... metatarsophalangeal and then interphalangeal Inthe vehicle and nontreated arthritic group, the incidence of disease was 100% (that is, all animals inthe group were affected) at day 12, and remained as such ... by involvement of the metatarsal and interphalangeal joints The typical time course forthe development and progression of disease, as assessed by the mean arthritis severity score andthe paw ... The arthritis severity score for each rat was calculated by adding the scores for each individual paw Measurement of hind paw hyperalgesia and edema Themethodfor measuring hyperalgesia has been...
... practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately ... responsible for running the project CR was responsible forthe statistical analyses All authors interpreted the data and findings CR wrote the first draft of the manuscript, all authors read and approved ... was calculated asthe mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory...
... is available for review by the Editor -in- Chief of this journal Abbreviations ALB: albumin; AN: anorexia nervosa; AST: asparate aminotransferase; ALT: alanine aminotransferase; BCAA/AAA: branch-chain ... magnetic resonance imaging, and magnetic resonance angiography of the head showed no abnormality Aspartate aminotransferase was 3194 IU/L (reference range, to 38 IU/L); alanine aminotransferase, ... spleen ina patient with ANand elevated transaminases, whereas liver steatosis was diagnosed in ultrasound imaging, as was found in our patient In addition, these authors detected increased markers...
... hemoperitoneum An acute intra-abdominal bleed from the liver metastatic disease was diagnosed Our patient had an esophageal gastro-duodenal endoscopy as he had been taking aspirin and had a past history ... care unit In view of the differential diagnosis of a possible dissection, an urgent chest and abdomen CT scan was performed which showed normal appearances of the thoracic and abdominal aorta ... be of metastatic disease within the liver (Figures 1, 2, No primary tumor was identified A diagnostic peritoneal tap was performed and frank blood was aspirated confirming that there was hemoperitoneum...
... acquisition and analysis of data and drafted the manuscript AC and AB helped in drafting of manuscript and given their valuable suggestions, MG provided the images All the authors read and approved the ... Uninvolved ovarian parenchyma was fibrous and contained hemosiderin laden and foamy macrophages The serosal surface of gallbladder was smooth and shiny The lumen was impacted with a 1.3 cm diameter ... parenchyma almost completely replaced by a tumor with involvement of hilum as well The cut surface was multinodular and had a variegated appearance with both solid and cystic areas Solid areas...
... and AIDS in Eastern and Southern Africa Disability and Rehabilitation 2011 doi:10.1186/1744-8603-7-41 Cite this article as: Nixon et al.: The increasing chronicity of HIV in subSaharan Africa: ... the International Classification of Functioning, Disability and Health (ICF), at Chris Hani Baragwanath Hospital, Johannesburg African Journal of AIDS Research 2009, 8(1):93-106 Van As M, Myezwa ... increased resources are unlikely to be available in significantly greater quantities than they are now to support these elevated demands in terms of health infrastructure, rehabilitation and disability...
... of the study, and participated in its design and coordination and drafted the manuscript RB carried out the field work, assisted in data analysis and assisted in drafting the manuscript All authors ... security inthe forensic rehabilitation process Page of In England and Wales (E&W) and most European and Canadian and United States (US) forensic services, the rehabilitation of high security patients ... adult male, adult female or child, robbery and arson, based on the criteria of Bailey and MacCulloch [22] Data analysis Data were analyzed using the Statistical Package for Social Sciences SPSS for...
... was provided by an operating grant from the Social Sciences and Humanities Research Council of Canada In addition, salary and infrastructure support to scientists at the Centre for Addiction and ... to thank Russell Callaghan and Liz Lambert for their helpful comments on earlier drafts of this manuscript, and Judith Kwok for additional assistance with the RDS diagrams Financial support for ... convenience sampling and snowball/ chain-referral that can yield large samples yet offer no assurance of the representativeness of findings Targeted (in time/space or venue-based) sampling are variations...
... performed the biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated inthe ... 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and ... chains of aggrecan Red Safranin O staining was present inthe AF andthe vertebral growth plates inthe control group (Figure 5a) The NP was rounded, and distinct from the AF The Safranin O-stained...
... J, Papakostas L, Tahta SA, Hardy BG, Bollen BA, Duran CM, Levine RA: Mechanism of recurrent ischemic mitral regurgitation after annuloplasty: continued LV remodeling asa moving target Circulation ... demonstrated that relatively simple echo variables, as left ventricular end-systolic volume, retain their clinical and even prognostic value and therefore should not be forgotten whenever performing ... Critical Care Vol 11 No Poelaert and Roosens Finally, there is the discussion on load dependency of E’ This issue remains controversial and not at all completely clarified, as outlined ina recent...
... original andthe Vietnamese translated version for several times and find this story very interesting to make an analysis Both corpora have a digital format andare available on the internet Detailed ... Detailed information about the translations was not available Inthe study, both quantitative and qualitative methods were adopted for analysis Andthe analysis was conducted inthe following steps ... outside the sentence and establishes a meaning relationship across sentences within the passage Halliday and Hasan (1976) proposed a methodology for cohesion analysis and noted thatthe basic concept...
... example, define speaking asan interactive process of constructing meaning that involves producing and receiving and processing information Its form and meaning are dependent on the context in which ... certain language can affect students' performance It can influence the quality of oral language production and make individuals appear less fluent than they really are This explanation suggests that ... Non-interactive Interactive speaking situations include face-to-face conversations and telephone calls, in which we are alternately listening and speaking, andin which we have a chance to ask for...