the actions panels for startdrag as an action top and as a method bottom differ in the way that the parameters are input

báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx

Ngày tải lên : 20/06/2014, 15:20

... compromised and group comparison is not valid Where cut points are already established, as in the current case, we would argue that analysis of DIF represents an elegant mechanism for establishing and ... software and significance levels Rasch analysis was undertaken using the RUMM2020 package [18] During the Rasch analysis, Bonferroni corrections are applied to both fit and DIF statistics due to the ... 2.776 (SD 0.6) for the former, and 0.580 (SD 1.5) for the latter The final pass scores for all subtests are presented in Table and the percentage passing each subtest are given in Table All subtests...

8
448
0

BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx

Ngày tải lên : 18/03/2014, 02:20

... right awaydo not let them sit s These are standards in consultant work and emphasized over and over by authors in the field Fowler, Sally and Idalene F Kesner "When Consultants and Clients Clash." ... dictate demand for paper rolls, with an increase in 67 manufacturing output being favorable for paper manufacturers The state of downstream demand causes significant shifts at each stage of the ... was researching the use of bamboo in the paper industry Many companies in Asia have made advances in using bamboo in products such as textiles, flooring, cosmetics, paper, and food However, many...

84
472
0

Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

Ngày tải lên : 08/08/2014, 19:21

... maintaining an acceptable combination of height and diameter growth An important part of our oak improvement programme aims to gain a better understanding of the development and control of branching ... nursery and the field have been analysed separately The effects of clones and treatments were investigated by analysis of variance As previous studies have shown that bud and branch numbers are related ... (Harmer, 198 9a, 199 2a) analyses of these data used length as a covariate; any levels of significance given in the text, tables or figures result from these analyses However, the means and standard...

14
240
0

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

Ngày tải lên : 16/07/2015, 07:45

... information gained from assessment to determine their next teaching and learning steps -7- Parents and families can be kept informed of next plans for teaching and learning and the progress being made, ... performance, using them over time so as to reveal change, growth, and increasing degrees of integration Such an approach aims for a more complete and accurate picture of learning, and therefore ... at elaborating on the participants and setting, justifying the research instruments as well as describing in details the instrument and procedures of collecting and analyzing data III.1 Research...

65
893
7

The case for rentierism as a cause forunderdevelopment in malaysia tourism planning from mahathir to the present day

Ngày tải lên : 26/09/2015, 12:48

... Border Kuala Lumpur Residency Border Kuala Lumpur Kota Kinnabalu Melaka Pulau Langkawi Singapore Genting Highlands Thailand Hong Kong Kuala Lumpur Thailand Cambodia Thailand Penang Langkawi Kuala Lumpur ... deemed acceptable as the second case study was a different type of case study While Pulau Langkawi and Genting Highlands are both contained resorts, Kuala Lumpur and Putrajaya are multi-faceted ... observation more specific and documents (such as sales packs) requested due to knowing what information was required rather than seeing what was available Pulau Langkawi is a small island and the...

256
556
0

Frequency of Routine and Flooding-stage Observations for Precise Annual Total Pollutant Loads and their Estimating Method in the Yodo River

Ngày tải lên : 05/09/2013, 09:38

... one of the environmental standard items analyzed in marine areas in Japan Suspended solids (SS) was measured using the above-mentioned glass-fiber filter, and chlorophyll -a was analyzed by the SCOR/UNESCO ... was a rainy year (Q: 434m3/s) and 2003 was an average year (Q: 236m3/s) During the observation periods, years with more rainfall had larger mean pollutant loads than years with less rainfall The ... and analyzed inorganic ions and organic matter The water samples taken at the three points spanning the river during the five flooding-stages were analyzed individually, and the representative...

9
572
0

santiago as a hemmingway code hero in the old man and the sea

Ngày tải lên : 21/03/2014, 22:50

... running to tell the other fishermen of the town about it, he just went home and fell asleep Landing the fish did not matter to the old man only to get it as far as the side of the boat The Old Man ... Man And The Sea portrays Hemingway Code Heros to their fullest potential As Heros they try their hardest to persevere under pressure and achieve the goal in front of them They show the characteristics ... offered each other the best of company While out at sea Santiago is constantlywishing the boy was there to talk to or to help with the mighty fish Santiago does not have relationships with any of the...

2
919
1

báo cáo hóa học:" The PedsQL™ as a patient-reported outcome in children and adolescents with Attention-Deficit/Hyperactivity Disorder: a population-based study" pdf

Ngày tải lên : 20/06/2014, 15:20

... (22.2%) Hispanic/Latino, (9.7%) Black/African American, (9.7%) Asian/Pacific Islander, 2(2.8%) Native American or Native Alaskan, and (12.5%) missing The statewide SCHIP sample was representative of ... conceptualization and design, and performed the statistical analysis All authors read and approved the final manuscript Acknowledgements This research was supported by a grant from the David and Lucile Packard ... calculated by taking the difference between the healthy sample mean and the ADHD sample mean, divided by the healthy sample standard deviation Effect sizes for differences in means are designated...

10
538
0

Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps

Ngày tải lên : 09/08/2014, 10:21

... metatarsophalangeal and then interphalangeal In the vehicle and nontreated arthritic group, the incidence of disease was 100% (that is, all animals in the group were affected) at day 12, and remained as such ... by involvement of the metatarsal and interphalangeal joints The typical time course for the development and progression of disease, as assessed by the mean arthritis severity score and the paw ... The arthritis severity score for each rat was calculated by adding the scores for each individual paw Measurement of hind paw hyperalgesia and edema The method for measuring hyperalgesia has been...

7
569
0

báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

Ngày tải lên : 10/08/2014, 10:23

... practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately ... responsible for running the project CR was responsible for the statistical analyses All authors interpreted the data and findings CR wrote the first draft of the manuscript, all authors read and approved ... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory...

9
367
0

báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot

Ngày tải lên : 11/08/2014, 02:21

... is available for review by the Editor -in- Chief of this journal Abbreviations ALB: albumin; AN: anorexia nervosa; AST: asparate aminotransferase; ALT: alanine aminotransferase; BCAA/AAA: branch-chain ... magnetic resonance imaging, and magnetic resonance angiography of the head showed no abnormality Aspartate aminotransferase was 3194 IU/L (reference range, to 38 IU/L); alanine aminotransferase, ... spleen in a patient with AN and elevated transaminases, whereas liver steatosis was diagnosed in ultrasound imaging, as was found in our patient In addition, these authors detected increased markers...

4
410
0

Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Ngày tải lên : 11/08/2014, 12:20

... hemoperitoneum An acute intra-abdominal bleed from the liver metastatic disease was diagnosed Our patient had an esophageal gastro-duodenal endoscopy as he had been taking aspirin and had a past history ... care unit In view of the differential diagnosis of a possible dissection, an urgent chest and abdomen CT scan was performed which showed normal appearances of the thoracic and abdominal aorta ... be of metastatic disease within the liver (Figures 1, 2, No primary tumor was identified A diagnostic peritoneal tap was performed and frank blood was aspirated confirming that there was hemoperitoneum...

3
372
0

Báo cáo y học: "Occult gallbladder carcinoma presenting as a primary ovarian tumor in two women: two case reports and a review of the literature" pot

Ngày tải lên : 11/08/2014, 12:20

... acquisition and analysis of data and drafted the manuscript AC and AB helped in drafting of manuscript and given their valuable suggestions, MG provided the images All the authors read and approved the ... Uninvolved ovarian parenchyma was fibrous and contained hemosiderin laden and foamy macrophages The serosal surface of gallbladder was smooth and shiny The lumen was impacted with a 1.3 cm diameter ... parenchyma almost completely replaced by a tumor with involvement of hilum as well The cut surface was multinodular and had a variegated appearance with both solid and cystic areas Solid areas...

7
352
0

báo cáo khoa học: " The increasing chronicity of HIV in sub-Saharan Africa: Re-thinking “HIV as a long-wave event” in the era of widespread access to ART" pot

Ngày tải lên : 11/08/2014, 14:21

... and AIDS in Eastern and Southern Africa Disability and Rehabilitation 2011 doi:10.1186/1744-8603-7-41 Cite this article as: Nixon et al.: The increasing chronicity of HIV in subSaharan Africa: ... the International Classification of Functioning, Disability and Health (ICF), at Chris Hani Baragwanath Hospital, Johannesburg African Journal of AIDS Research 2009, 8(1):93-106 Van As M, Myezwa ... increased resources are unlikely to be available in significantly greater quantities than they are now to support these elevated demands in terms of health infrastructure, rehabilitation and disability...

5
225
0

Báo cáo y học: " The utility of the Historical Clinical Risk -20 Scale as a predictor of outcomes in decisions to transfer patients from high to lower levels of security-A UK perspective" pptx

Ngày tải lên : 11/08/2014, 16:22

... of the study, and participated in its design and coordination and drafted the manuscript RB carried out the field work, assisted in data analysis and assisted in drafting the manuscript All authors ... security in the forensic rehabilitation process Page of In England and Wales (E&W) and most European and Canadian and United States (US) forensic services, the rehabilitation of high security patients ... adult male, adult female or child, robbery and arson, based on the criteria of Bailey and MacCulloch [22] Data analysis Data were analyzed using the Statistical Package for Social Sciences SPSS for...

8
388
0

báo cáo khoa học: " Whither RDS? An investigation of Respondent Driven Sampling as a method of recruiting mainstream marijuana users" pdf

Ngày tải lên : 11/08/2014, 18:20

... was provided by an operating grant from the Social Sciences and Humanities Research Council of Canada In addition, salary and infrastructure support to scientists at the Centre for Addiction and ... to thank Russell Callaghan and Liz Lambert for their helpful comments on earlier drafts of this manuscript, and Judith Kwok for additional assistance with the RDS diagrams Financial support for ... convenience sampling and snowball/ chain-referral that can yield large samples yet offer no assurance of the representativeness of findings Targeted (in time/space or venue-based) sampling are variations...

11
372
0

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Ngày tải lên : 12/08/2014, 17:22

... performed the biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the ... 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and ... chains of aggrecan Red Safranin O staining was present in the AF and the vertebral growth plates in the control group (Figure 5a) The NP was rounded, and distinct from the AF The Safranin O-stained...

9
402
0

Báo cáo y học: "Myocardial Doppler velocities as a marker of prognosis in the ICU" pot

Ngày tải lên : 13/08/2014, 08:20

... J, Papakostas L, Tahta SA, Hardy BG, Bollen BA, Duran CM, Levine RA: Mechanism of recurrent ischemic mitral regurgitation after annuloplasty: continued LV remodeling as a moving target Circulation ... demonstrated that relatively simple echo variables, as left ventricular end-systolic volume, retain their clinical and even prognostic value and therefore should not be forgotten whenever performing ... Critical Care Vol 11 No Poelaert and Roosens Finally, there is the discussion on load dependency of E’ This issue remains controversial and not at all completely clarified, as outlined in a recent...

2
262
0

substitution as a grammatical cohesive device in english narrative in comparision with its translation into vietnamese = phép thế như phương tiện liên kết ngữ pháp trong văn trần thuật tiếng anh

Ngày tải lên : 28/02/2015, 11:54

... original and the Vietnamese translated version for several times and find this story very interesting to make an analysis Both corpora have a digital format and are available on the internet Detailed ... Detailed information about the translations was not available In the study, both quantitative and qualitative methods were adopted for analysis And the analysis was conducted in the following steps ... outside the sentence and establishes a meaning relationship across sentences within the passage Halliday and Hasan (1976) proposed a methodology for cohesion analysis and noted that the basic concept...

41
750
2

an action research on methods to improve students’ confidence in speaking english at nguyen ba ngoc lower secondary school = nghiên cứu hành động nhằm nâng cao khả năng tự tin trong tiếng anh của học sinh lớp 9

Ngày tải lên : 02/03/2015, 14:25

... example, define speaking as an interactive process of constructing meaning that involves producing and receiving and processing information Its form and meaning are dependent on the context in which ... certain language can affect students' performance It can influence the quality of oral language production and make individuals appear less fluent than they really are This explanation suggests that ... Non-interactive Interactive speaking situations include face-to-face conversations and telephone calls, in which we are alternately listening and speaking, and in which we have a chance to ask for...

71
806
3