... initiation ofthe reaction by addition of UDP-glucuronate and UDPGlcNAc to measure glucuronate Fig Requirement of a heat-stable cofactor forthe effect of metyrapone (MP) and other xenobiotics on microsomal ... the formation of free glucuronate from UDP-glucuronate observed in this preparation could be theresultof a glucuronidation– deglucuronidation cycle, with a hypothetical acceptor present in the ... UDPglucuronate influx into microsomes [11] This involves conversion of UDP-glucuronate to UMP in the lumen ofthe vesicles and exchange ofthe latter with cytosolic UDPGlcNAc Once inside microsomes,...
... is cooled by the water evaporation fromthe outerwall ofthe bricks into that air The cooling capacity ofthe device depends on the amount of evaporated water fromthe humid surface into the ... “semi-indirect” The second case is characteristic of tropical climates, and this situation can result into condensation of part ofthe outside air humidity, due to the low humidity ofthe stuffy ... through the call for scientific research and technological development research projects Reference number ENE2008-02274/CON Prof Francisco Javier Rey would like to thank the Consejería de Educación,...
... and receipts of business transactions by cash, check or credit card Cash discount It is a refund of some fraction ofthe Chiết khấu tiền amount paid because the purchase price mặt is paid by the ... the principle of Bút toán kép accounting which requires that every transaction has two effects one of which is a debit and the other of which is a credit ofthe same amount II.ACRONYMS IN ACCOUNTING ... able to answer The third difficulty is the large scope of accounting terms and translator cannot cover all sectors of accounting Therefore, translators are confused when facing to accounting terms...
... for Academic purpose (EAP) - English for Occupational purposes (EOP) And exampleof EOP forthe EST branch is English for technicians whereas an exampleof EAP forthe EST branch is English for ... about the characteristics of terminology among terminologists Some say the typical characteristic of terminology is the systematic formation, whilst others claim that it is the feature of content ... Sea surface SST(Nhiệt độ mặt n- c temperature biển) CB Cumulonimbus cloud CB (Mây vũ tích) NHC National hurricance NHC (Trung tâm bão qu c center gia) WFO Weather forecast office WFO (C quan...
... employed there and cut off fromthe prisoners' part ofthe camp by closing the iron gate in the main wire wall ofthe camp It occurred to me that if I could hide in the parcel office or tin room before ... ofthe camp enclosure to the door of this office, thus enabling them to permit the prisoners free access to these two rooms until this hour At o'clock the offices were cleared of prisoners by the ... one ofthe baskets could be cut open fromthe inside, and the others could then be opened with the keys that the occupant of this basket had on him At about eight o'clock the German officer arrived,...
... shows the production cost breakdown for each process The largest cost contributor in the corn starch process is the feedstock; forthe lignocellulosic process it is the depreciation of capital cost, ... shows the production cost breakdown for each process The largest cost contributor in the corn starch process is the feedstock; forthe lignocellulosic process it is the capital cost, which is ... bushel the cost ofthe corn required to produce a gallon of fuel ethanol is $0.68 For a dry milling facility that is selling only DDG, the net cost of corn, which is the cost ofthe corn entering the...
... than the coefficient estimates in other specifications For pitchers, the fixed-effect results are in column (5) of Table while the first-difference results appear in column (6) of Table The pitching results ... performance increases with the pitching performance ofthe other pitchers on the team, but is unaffected by the batting performance ofthe team The differential reaction to both types of players from ... So, the differential responses according to the role of each type of player can be viewed as evidence forthe idea that the technology of production significantly influences the interaction of effort...
... source will make it easier to see the bottom ofthe meniscus), add mL of starch indicator to the first ascorbic acid sample and titrate with the iodine solution Note the change ofthe I2 color ... parameter called the titer -the number of mg of ascorbic acid which reacts with ml- of iodine solution This number is easily found fromthe I2 concentration and the mass relationship in the reaction ... ascorbic acid Using a 0 .1000 -g sample of pure ascorbic acid, 25.32 mL of I2 were required to reach the starch end point a What is the molarity ofthe iodine solution? b What is the titer of the...
... acidity The health effects of SO2, NOX, NH3 and NMVOCs resultfromthe formation of secondary particulate matter and ozone through chemical reactions in the atmosphere The possibility of direct ... damage costs A small number of individual facilities cause the majority ofthe damage costs Fifty per cent ofthe total damage cost occurs as a resultof emissions from just 191 (or 2 %) ofthe ... of difference to analysis forthe European population, whereas inclusion of chronic effects on mortality could greatly increase the overall significance of ozone impacts Revealing the costs of...
... constitute a cohort The file contains information on an officer at the time of accession (including demographic characteristics and characteristics of military employment, such as the DOD occupation ... In the Air Force, we included an indicator for African-American race in a specification check We found that the coefficient on this indicator is small and statistically insignificant (coefficient ... code) Appended to the accession data is information about the officer at the time of separation if the officer is no longer in the service, or information about the most recent year of service...
... GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢ The PCR product was cloned into the ... either because its concentrations were below the detection limit or because ofthe lack ofthe l-gulono-1,4-lactone substrate in these cells l-Gulono-1,4-lactone can be formed by the C1 reduction ... tuberculosis Steady-state parameters ofthe mycobacterial dehydrogenase determined for: (A) the L-gulono-1,4-lactone substrate in the presence of 121 lM cytochrome c; and (B) the cytochrome c substrate...
... Fig Effect of initial Cr(VI) concentration on the rate of Cr(VI) removal efficiency Fig shows the results of effect of initial Cr(VI) concentration on the rate of Cr(VI) Fig shows that, Cr(VI) ... the concentration of Fe0 nanoparticles had effect on the reduction of Cr(VI) When the mass ratio of Fe0 to Cr(VI) was 50:1, 100% removal efficency was achieved pH has important effect on Cr(VI) ... initial Cr(VI) After 20 minutes, the removal is 100% at concentration of 2mg/l and 69.32% at concentration of 5mg/l When treatment time increased then Cr(VI) removal efficiency decreased The proper...
... Manufacture of chemicals and chemical products ISIC 2411: Manufacture of basic inorganic and organic chemicals ISIC 2412: Manufacture of fertilizers and nitrogen compounds ISIC 2413: Manufacture of ... Manufacture of coke, refined petroleum products and nuclear fuel ISIC 231: Manufacture of coke oven products ISIC 232: Manufacture of refined petroleum products ISIC 233: Processing of nuclear ... plastics in primary forms and of synthetic rubber ISIC 2421: Manufacture of pesticides ISIC 2422: Manufacture of paints, varnishes and similar coatings ISIC 2423: Manufacture of pharmaceuticals,...
... SCFs forthe words in the resulting SCFs Recall = Correct SCFs forthe words in the resulting SCFs All SCFs forthe words in the test SCFs I then compare centroid cut-off with confidence cut-off ... frequency cut-off B: centroid cut-off* 0.05 C: centroid cut-off 0.05 D: confidence cut-off 0.05 0.8 0.8 D C B A 0.4 A 0.6 Recall Recall D 0.6 A: frequency cut-off B: centroid cut-off* 0.05 C: centroid ... observe the effects of clustering Figure shows precision and recall ofthe resulting SCFs using centroid cut-off 0.05 and the confidence cut-off 0.05 by varying the threshold forthe confidence values...
... extraction methods For each, in addition to the F-score and classification accuracy, we present the relative error reduction (e.r.) in classification accuracy over the majority-class baseline for ... agreement between the two resources in the form of classification accuracy That is, we calculate the average proportion of (both positive and negative) countability classifications over which the two methods ... plural form, such as goods They can neither be denumerated nor modified by much Many of these nouns, such as clothes, use the plural form even as modifiers (a clothes horse) The word clothes cannot...
... shape off the open circuit characteristic curve is determined by the behaviour ofthe magnetic circuit ofthe generator The magnetic circuit being the path taken by the magnetic flux When the generator ... But the most important factor in acceptance of neologism is the motivation: the term should reflect the characteristic of concept it designates - Eponyms are the words which constructed with the ... the form ofthe term Instead, they result from: Expension: extending the meaning of a term by giving it a new meaning, as in shift fromthe concrete to the abstract or fromthe abstract to the concrete...