protocol for the detection and genotyping of human papillomaviruses using a liquid bead microarray assay

AN INTEGRATED ATOM CHIP FOR THE DETECTION AND MANIPULATION OF COLD ATOMS USING a TWO PHOTON TRANSITION

AN INTEGRATED ATOM CHIP FOR THE DETECTION AND MANIPULATION OF COLD ATOMS USING a TWO PHOTON TRANSITION

Ngày tải lên : 08/09/2015, 15:07
... space, the spot size w(z) will have a minimum value w0 at one place along the beam axis, known as the beam waist At a distance z, for a beam of wavelength λ, along the beam from the beam waist, ... trap is stable only if the magnetic moment of the atom adiabatically follows the direction of the magnetic field In both classical and quantum mechanics, the magnetic moment of atom adiabatically ... neutral atoms and the magnetic field The interaction energy between a neutral atom and a magnetic field is much weaker than the thermal energy of the atom at room temperature Hence the atoms are...
  • 170
  • 846
  • 0
Statistical methods for the detection and analyses of structural variants in the human genome

Statistical methods for the detection and analyses of structural variants in the human genome

Ngày tải lên : 09/09/2015, 10:14
... unmapped read may span the breakpoint of the CNV SR analysis has the advantage of being able to pinpoint the location of the breakpoints Assembly-based AS methods, on the other hand, not align the ... with the 11 rapidly changing technologies Already, there is a great demand for information technology infrastructure and bioinformatics team to analyse the massive amount of data, with speculations ... that the costs associated with down-handling, storing and analysis of the data could be more than the production of the data There is still a need for the development of new statistical/bioinformatics...
  • 171
  • 567
  • 0
RESEARCH ETHICS AND CONSENT ON THE COLLECTION AND USE OF HUMAN BIOLOGICAL MATERIALS a SINGAPORE PERSPECTIVE

RESEARCH ETHICS AND CONSENT ON THE COLLECTION AND USE OF HUMAN BIOLOGICAL MATERIALS a SINGAPORE PERSPECTIVE

Ngày tải lên : 09/09/2015, 11:33
... banking, and that institutions must have transparent and appropriate systems, and standards for the ethical, legal and operational governance of research tissue banking 64 The significance of ... persons or parts thereof for purposes of medical or dental education, research, advancement of medical or dental science, therapy and transplantation, and for other related purposes Any person ... SYSTEMATIC REVIEW APPENDIX 5: NUS-IRB APPROVALS, APPROVED RESEARCH PROTOCOLS OF THE QUANTITATIVE AND QUALITATIVE RESEARCH, PARTICIPANTS INFORMATION SHEET AND CONSENT FORMS APPENDIX 6: STATISTICAL ANALYSIS...
  • 294
  • 426
  • 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

Ngày tải lên : 18/06/2014, 18:20
... GCG ACA CCA GTT G TCA ACC ATG AGG TCA TGG CCA TA CCC CGG GTG AGT TCT TGC TYG A TTC CCC TGG AGA AGT ACT CCT CGA ACT AAA TCC ATA CCT AGC ACAC CAG TGG CGG GAC AAA CCA AC CTC TCC TGG AGA ACT CCT ACT ... CGA GAC GAT GGC MCT CGA ACC G TAT AGA CCC TTG GAT TAG AGC A CAA TGG CGC TAG ABC CAG TGG CG GAC GCC AAC CCA TCT GAT GGG TC GGT GGG GGC GTC TTT AGC C CTC AAT CGC AGC TCC TGT YGT GCA TCG CTG GCG ACA ... and genotypes of GII NoV was obtained from external laboratories (Table 2) This stool panel was applied to the Lightcycler assay and all the genotypes were detectable Detection and quantification...
  • 8
  • 535
  • 1
Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt

Báo cáo hóa học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" ppt

Ngày tải lên : 20/06/2014, 01:20
... GCG ACA CCA GTT G TCA ACC ATG AGG TCA TGG CCA TA CCC CGG GTG AGT TCT TGC TYG A TTC CCC TGG AGA AGT ACT CCT CGA ACT AAA TCC ATA CCT AGC ACAC CAG TGG CGG GAC AAA CCA AC CTC TCC TGG AGA ACT CCT ACT ... CGA GAC GAT GGC MCT CGA ACC G TAT AGA CCC TTG GAT TAG AGC A CAA TGG CGC TAG ABC CAG TGG CG GAC GCC AAC CCA TCT GAT GGG TC GGT GGG GGC GTC TTT AGC C CTC AAT CGC AGC TCC TGT YGT GCA TCG CTG GCG ACA ... and genotypes of GII NoV was obtained from external laboratories (Table 2) This stool panel was applied to the Lightcycler assay and all the genotypes were detectable Detection and quantification...
  • 8
  • 502
  • 0
cáo khoa học: " The European Society of Human Reproduction and Embryology guideline for the diagnosis and treatment of endometriosis: an electronic guideline implementability appraisal" ppsx

cáo khoa học: " The European Society of Human Reproduction and Embryology guideline for the diagnosis and treatment of endometriosis: an electronic guideline implementability appraisal" ppsx

Ngày tải lên : 10/08/2014, 10:23
... and CM appraised the guideline with eGLIA and participated in the telephone conference and the revision of the manuscript RH participated in the design of the study and the revision of the manuscript ... international collaboration and the availability of international guidelines The appraisers were widely distributed geographically However, the eGLIA tool made it easy to collect and analyse the ... (one) Formal validation would need a larger group of appraisers and more guidelines in different health areas For international validation, translations of the instrument and translation protocols...
  • 8
  • 481
  • 0
Báo cáo y học: "The use of 3D surface scanning for the measurement and assessment of the human foot" doc

Báo cáo y học: "The use of 3D surface scanning for the measurement and assessment of the human foot" doc

Ngày tải lên : 10/08/2014, 21:24
... surface area of the foot is another application of 3D scanning This area has been traditionally estimated as percentage of the total body surface area [51], or as a formula based on linear foot ... of the Page of foot scan but they were able to show that, compared to a standard shoe last, the hallux and the 5th metatarsal head both protruded outside of the last shape, both areas which are ... reasons of economy footwear manufacturers tend only to provide a standard width and height associated with each shoe size There is some variation as to the approaches and anatomical landmarks are...
  • 9
  • 613
  • 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Ngày tải lên : 11/08/2014, 15:22
... self-care, usual activities, pain/discomfort and anxiety/depression) and a rating of ‘own general health’ by means of a visual analogue ‘thermometer’ scale The EQ5D has shown a good validity and ... supervising the nursing staff and recreational therapist more intensively in their execution of the day structure program and behavioral management strategy This support takes place in a regular staff ... after the diagnosis, the day structure program and behavioral management strategy should be incorporated in regular care The psychologist supervises the recreational therapist and nursing staff...
  • 7
  • 484
  • 0
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Ngày tải lên : 26/11/2015, 09:54
... TATGGATCCA^CTAGTTATGTAAATACAAACACAGAAAACCAA SpeI P3 downstream fw P4 GGGTTCCTGC^GGCCGCCTACTACTAATTGGCCAAAGTTTAA downstream HA rv GA NotI P5 Sca3 fw AGCACTTCCATATTTTAAAGTAATCTG P6 Sca3 rv TGCTCCTTAATCCAGGGAAA P7 ADK ... TTGCAGATGATTTTGCACCT P8 ADK rv GACCCCTTTGGGGTATCTGT P9 Neo fw GCTTGGGTGGAGAGGCTATT P10 Neo rv GCGATACCGTAAAGCACGAG P11 QuikChange fw GCAGCAGGGGGACCTGTCAGGACAGAGTT P12 QuikChange rv AACTCTGTCCTGACAGGTCCCCCTGCTGC ... population with normalized biochemical characteristics For the site-specific exchange of the pathogenic allele of ataxin-3 against its wildtype variant an approach using the ability of adeno-associated...
  • 135
  • 365
  • 0
Tài liệu Guidelines for the Prevention and Treatment of Opportunistic Infections Among HIV-Exposed and HIV-Infected Children pdf

Tài liệu Guidelines for the Prevention and Treatment of Opportunistic Infections Among HIV-Exposed and HIV-Infected Children pdf

Ngày tải lên : 12/02/2014, 12:20
... (PIDS), and the American Academy of Pediatrics (AAP) The recommendations are rated by a letter that indicates the strength of the recommendation and a Roman numeral that indicates the quality of the ... night sweats, anorexia and weight loss, abdominal pain, nausea, vomiting, and diarrhea Diagnosis Bartonella spp are small, gram-negative bacilli In cases of bacillary angiomatosis and bacillary peliosis, ... disease and a central venous catheter is the most common clinical manifestation of candidemia Renal candidiasis presents with candiduria and ultrasonographically demonstrated renal parenchymal lesions,...
  • 177
  • 675
  • 0
Tài liệu STRATEGY FOR THE MANAGEMENT AND DISPOSAL OF USED NUCLEAR FUEL AND HIGH-LEVEL RADIOACTIVE WASTE ppt

Tài liệu STRATEGY FOR THE MANAGEMENT AND DISPOSAL OF USED NUCLEAR FUEL AND HIGH-LEVEL RADIOACTIVE WASTE ppt

Ngày tải lên : 21/02/2014, 21:20
... Left Blank  Strategy for the Management and Disposal of Used Nuclear Fuel and High-Level Radioactive Waste INTRODUCTION AND SUMMARY The Strategy for the Management and Disposal of Used Nuclear Fuel ... Strategy, which translates many of the BRC’s principles into an actionable framework within which the Administration and Congress can build a national program for the management and disposal of ... ensure that the reactor owners and power   Strategy for the Management and Disposal of Used Nuclear Fuel and High-Level Radioactive Waste generators pay the full cost of the disposal of their...
  • 18
  • 584
  • 1
Perspectives of Chief Ethics and Compliance Officers on the Detection and Prevention of Corporate Misdeeds ppt

Perspectives of Chief Ethics and Compliance Officers on the Detection and Prevention of Corporate Misdeeds ppt

Ngày tải lên : 06/03/2014, 22:20
... organizations Evaluate the drawbacks, as well as the advantages, of mandatory compliance programs Designate an official in charge Establish credible program assessment Conclusion As the foregoing ... director of human resources and internal auditor In the critical area of compliance and ethics, an essential supporter to the board is the chief ethics and compliance officer (CECO), who acts as an agent ... including the handling of actual or apparent conflicts -of- interest between personal and professional relationships fair, accurate and timely disclosure and compliance with laws and regulations.” In addition,...
  • 61
  • 421
  • 0
2008-2013 Action Plan for the Global Strategy for the Prevention and Control of Noncommunicable Diseases docx

2008-2013 Action Plan for the Global Strategy for the Prevention and Control of Noncommunicable Diseases docx

Ngày tải lên : 07/03/2014, 04:20
... progress made in implementation of national strategies and plans 26 Action Plan 39 Action for the Secretariat A Develop and maintain an information system to collect, analyse and disseminate data and ... neurological diseases, and diseases causing blindness and deafness Many of these conditions are the subjects of other WHO strategies, action plans and technical guidance and are therefore not ... and the clear mandate to lead the development and implementation of the global strategy for the prevention and control of noncommunicable diseases and thereby to create a better environment for...
  • 48
  • 652
  • 0
Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc

Guidance for the Selection and Use of Personal Protective Equipment (PPE) in Healthcare Settings doc

Ngày tải lên : 08/03/2014, 13:20
... your head and the lower set at the base of your neck If a mask has elastic head bands, separate the two bands, hold the mask in one hand and the bands in the other Place and hold the mask over ... mouth, and chin, then stretch the bands over your head and secure them comfortably as shown; one band on the upper back of your head, the other below the ears at the base of the neck Adjust the mask ... soap and water or use an alcohol-based hand rub * Ensure that hand hygiene facilities are available at the point needed, e.g., sink or alcohol-based hand rub PPE Use in Healthcare Settings Hand...
  • 49
  • 644
  • 0
GUIDELINES FOR THE ISSUANCE AND MANAGEMENT OF EXTENDED VALIDATION CERTIFICATES doc

GUIDELINES FOR THE ISSUANCE AND MANAGEMENT OF EXTENDED VALIDATION CERTIFICATES doc

Ngày tải lên : 16/03/2014, 00:20
... scenario Period of coverage AICPA standards Management’s assertion Unqualified report CICA standards Management’s assertion Unqualified report International standards Management’s assertion Unqualified ... in accordance with standards for assurance engagements established by the Canadian Institute of Chartered Accountants (CICA) and, accordingly, included (1) obtaining an understanding of ABC-CA’s ... the name and title of the Contract Signer and the Certificate Approver, as applicable and verifying that the Contract Signer and the Certificate Approver are agents representing the Applicant; •...
  • 32
  • 425
  • 0
Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma docx

Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma docx

Ngày tải lên : 17/03/2014, 15:20
... Mary Tierney, M.D Project Manager xviii August 28, 2007 Acronyms and Abbreviations August 28, 2007 ACRONYMS AND ABBREVIATIONS AAI A artemisiifolia ABG ABPA ACE ACIP ACT AHRQ ALT Amb a AQLQ ATAQ ... PATHOPHYSIOLOGY AND PATHOGENESIS, AND NATURAL HISTORY FOR ASTHMA MANAGEMENT Airway inflammation is a major factor in the pathogenesis and pathophysiology of asthma The importance of inflammation to central ... Stoloff has served on the Speakers’ Bureaus of Alcon, Altana, AstraZeneca, Genentech, GlaxoSmithKline, Novartis, Pfizer, Sanofi-Aventis, and Schering; and as a consultant for Alcon, Altana, AstraZeneca,...
  • 440
  • 728
  • 0
Manhood Of Humanity The Science and Art of Human Engineering potx

Manhood Of Humanity The Science and Art of Human Engineering potx

Ngày tải lên : 22/03/2014, 23:20
... in accordance with one law and one rate of advancement and in others in accordance with a very different law and rate; it is [pg 016 ]a fact, a fact of observation and sad experience, a fact attested ... regarding and treating human beings as animals, as mere binders of space, and we may look forward to an ethics, a jurisprudence and economics, a governance a science and art of human life and society—based ... how immoral they are The conception of man as a mixture of animal and supernatural has for ages kept human beings under the deadly spell of the suggestion that, animal selfishness and animal greediness...
  • 192
  • 383
  • 0
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Ngày tải lên : 23/03/2014, 07:20
... electrophoresis [31] as a band with an apparent molecular mass of 25.4 kDa, whereas the apparent molecular mass of the double mutant K137,141E was 30.4 kDa The calculated molecular mass of human wild-type ... mutations of the b5–b7 loop of human HSP22 A S Kasakov et al A B Fig Comparison of the structure of human HSP22 and other sHsp (A) Ribbon diagram of T aestivum Hsp16.9 monomer (protein databank ... (equivalent to K137 of human HSP22) and R108 (equivalent to K141 of human HSP22) are shown in purple and grey, respectively (B) Alignment of human HSP22 with human aB-crystallin and HSP27 and M jannaschii...
  • 15
  • 431
  • 0
API - 2510A - Fire-Protection Considerations for the Design and Operation of Liquefied Petroleum Gas (LPG) Storage Facilities

API - 2510A - Fire-Protection Considerations for the Design and Operation of Liquefied Petroleum Gas (LPG) Storage Facilities

Ngày tải lên : 27/03/2014, 14:07
... facilities, and to handle our raw materials and products in a manner that protects the environment, and the safety and health of our employees and the public ¥ To make safety, health and environmental ... department, rescue/ ambulance, and other critical service organizations c Name and address of facility managers and backup contacts d The facility emergency Incident Commander and structure of the ... ßame contact Therefore, transferring liquid from a tank that is involved in a Þre may not be advantageous and may signiÞcantly increase the risk of a vessel rupture and rapid escalation of the...
  • 44
  • 2.8K
  • 0

Xem thêm