preparation of leishman apos s stain for g banding

Đề tài "Annals of Mathematics Lehmer’s problem for polynomials with odd coefficients " pptx

Đề tài "Annals of Mathematics Lehmer’s problem for polynomials with odd coefficients " pptx

Ngày tải lên : 15/03/2014, 09:20
... + log , 2n resolving a conjecture of Schinzel and Zassenhaus [21] for this class of polynomials More generally, we solve the problems of Lehmer and Schinzel and Zassenhaus for the class of polynomials ... bounds by designing some more specialized searches We describe two such searches 4.2 Hill-climbing Our first method employs a modified hill-climbing strategy to search for good auxiliary polynomials ... hill-climbing method would omit the resetting of bk−1 to at the end of Step and would terminate as soon as none of the adjustments of Steps or improves the bound By adding this assignment, we need not stop...
  • 21
  • 405
  • 0
The Expedition to Borneo of H.M.S. Dido For the Suppression of Piracy pptx

The Expedition to Borneo of H.M.S. Dido For the Suppression of Piracy pptx

Ngày tải lên : 29/03/2014, 22:20
... Fowls and goats seem the only other means of subsistence of these people The geological features of the country are easily described Vast masses of granite rock are scattered along the coast; for ... himself that the rajah 's heart would dilate in his bosom at the sight of us His dress consisted of trowsers of green cloth, a dark green velvet jacket, and his sarong round his waist, thrown gracefully ... though a passage may exist, it would not be advisable for a vessel to try it These two small islands possess all the characteristic beauties of the clime Formed of brown granite, with a speck of...
  • 262
  • 400
  • 0
Semi-suspension technology for preparation of tetrabasic lead sulfate pastes for lead-acid batteries potx

Semi-suspension technology for preparation of tetrabasic lead sulfate pastes for lead-acid batteries potx

Ngày tải lên : 05/07/2014, 21:20
... representation of the structure of PAM Fig 10 Summary of the test results for batteries with positive plates produced using the semi-suspension technology of paste preparation using H2SO4/LO ratios: 4, ... mass were subjected to SEM examinations Fig 13(a) and (b) shows SEM micrographs of the cured paste at two magni®cations, and Fig 14 presents SEM photos of the active mass The SEM micrographs show ... presence of large and small 4BS crystals in the cured paste The small crystals often form bridges between the large 4BS crystals The photos evidence also that the semi-suspension technology of...
  • 12
  • 330
  • 0
Báo cáo toán học: "A generalization of Simion-Schmidt’s bijection for restricted permutations" doc

Báo cáo toán học: "A generalization of Simion-Schmidt’s bijection for restricted permutations" doc

Ngày tải lên : 07/08/2014, 07:21
... permutation statistics counting the number of these pairs have the same distribution over the symmetric group In Section 3, a bijection on Sn will be established which respects these statistics In particular, ... As discussed in the proof of Proposition 2, the equality of the diagram squares of rank at most m − for π and σ = Φm (π) means that σi = πi for all i for which there exist at most m − integers ... whose set of diagram squares of rank at most m − equals D1 , and which has as many occurrences (i1 , , im−1 , im ) of Bm -patterns as there are squares (im−1 , ∗) in D2 Before analysing this...
  • 9
  • 342
  • 0
Báo cáo khoa học: "Results of emergency Hartmann''''s operation for obstructive or perforated left-sided colorectal cancer" ppt

Báo cáo khoa học: "Results of emergency Hartmann''''s operation for obstructive or perforated left-sided colorectal cancer" ppt

Ngày tải lên : 09/08/2014, 07:21
... between the two stages of the procedures allows for identification of good risk patients for stoma closure; patients with stage II tumours; patients with stage III cancers who subsequently underwent ... simultaneous analysis of more than populations, statistical differences were assessed by an extension of Gehan 's generalized Wilcoxon test, Peto and Peto 's generalized Wilcoxon test and the log-rank test ... vs rectum); mode of presentation (obstructive vs perforated); TNM stage; and mode of dissemination for metastatic cancers (peritoneal vs liver) 3) Modalities of HP (first stage); type of resection...
  • 5
  • 301
  • 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Ngày tải lên : 26/01/2016, 09:27
... first total synthesis of (±)-heptemerone G (2) and in a synthesis of the (±)-guanacastepene precursor Key features of the synthesis include an efficient new synthetic sequence for annulation of ... intermediate as beautiful crystals (mp 145–146 °C, hexane), after struggling through several stages with unstable oily intermediates The keto group in keto-ester could be reduced selectively using several ... intermediate were designed to serve as bridgeheads for forming ring C via the keto-ester Further transformations of into and will require diastereoselective reduction of the keto group (C-5) and...
  • 3
  • 547
  • 0
Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11

Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11

Ngày tải lên : 07/11/2012, 14:36
... discussion The Law has been translated into English by several translators An assessment of the English version of this law is thus desirable 2 Significance of the study The results of this study ... UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES DEPARTMENT OF GRADUATE STUDIES LƯƠNG TỐ LAN APPLICATION OF HOUSE S MODEL FOR TRANSLATION QUALITY ASSESSMENT IN ASSESSING THE ENGLISH VERSION OF THE ... addressees the permissions or rights granted and obligations imposed on them In doing this, the addresser is also clarifying his obligations or commitments to ensure the addressees’ rights This is...
  • 86
  • 894
  • 5
The Use of Selected Medicinal Herbs for Chemoprevention and Treatment of Cancer, Parkinson’s Disease, Heart Disease, and Depression

The Use of Selected Medicinal Herbs for Chemoprevention and Treatment of Cancer, Parkinson’s Disease, Heart Disease, and Depression

Ngày tải lên : 25/10/2013, 05:20
... minimum of bias and confounding Systematic reviews summarize the existing evidence from groups of RCTs Assessing the methodologic quality of primary studies refers to aspects of study design, performance, ... disease (also known as Parkinson disease or PD) is a degenerative disorder of the central nervous system that often impairs the sufferer s motor skills and speech Parkinson s disease belongs ... stimulants” (Japanese studies show it stimulates feeding of silkworm larvae; studies with neurological disorders (Parkinson s, ALS, MS) show mixed results) 11 Use of Selected Medicinal Herbs for Chemoprevention...
  • 57
  • 683
  • 0
A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

Ngày tải lên : 29/01/2014, 00:23
... # # # # # * % % ) #0 ) # # ; "" # $% """ % &' () ' ;< * &'F A E G &'&0 A &'40 # &'( E G* &'&0 * # A % &'&) E < % &H() A % %4FF ) G % &'&) A ) %4FF ) ; , &&F ;< ;< # H * ; < ; ;< # # , # ! # * ... ;< " # # ;< # D D %4FF@ 4) # K G8 ;< # ; % &&& ::) ;< * # * # $ $ ;< ;< B; B ;< - - # ;< F ! %; 4FFF) B - ;< # # B; - B - # # # B - %4FF ) # $ ;< B - / % ;< / ;< G &&&) ;< * ;< # # 5L5 % & ' ... ?! B # ?- * * OD * % ; * ) # % * ) M * 4@ "3 "3" = # *
  • 85
  • 645
  • 5
Tài liệu The Significance of Privatization and Commercialization Trends for Women’s Health ppt

Tài liệu The Significance of Privatization and Commercialization Trends for Women’s Health ppt

Ngày tải lên : 13/02/2014, 06:20
... distillation systems “…any loosening of government controls, such as regulatory and spending functions…contracting-out of public services to private providers, as well as to other government agencies…public/private ... communities across the country are assessing whether their current water and wastewater systems are being run as effectively and efficiently as possible, or if new forms of governance are necessary ... running the wastewater system, Professional Services Group (PSG), had one executive convicted of bribery charges along with a member of the New Orleans Sewerage and Water Board Such problems caused...
  • 23
  • 641
  • 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Ngày tải lên : 18/02/2014, 00:20
... income of small business owners This is slightly lower than the immigrant share of small business owners, reflecting the slightly smaller average size of immigrant businesses by both income of owners ... half of small business owners with grocery stores (49 percent) [Figure 7.] Many of these are smaller businesses, yet it is striking how much many of the types of businesses on this list—restaurants, ... that of immigrants The biggest contrast is that just percent of U .S. -born business owners have less than a high school degree, whereas 15 percent of foreign-born business owners have less than...
  • 37
  • 436
  • 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Ngày tải lên : 18/02/2014, 13:20
... according to the manufacturer s guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG ... GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ ... cm)1 Assessment of aggregation using thioflavin T binding and electron microscopy The kinetics of fibril formation was determined using a continuous ThT assay [49] Solutions of Ab isolated by SEC...
  • 16
  • 691
  • 0
Tài liệu Champions for Children State of the World’s Mothers 2011 docx

Tài liệu Champions for Children State of the World’s Mothers 2011 docx

Ngày tải lên : 18/02/2014, 15:20
... percentage of GNI Measured this way, United States is among the least generous of countries, with only 0.2 percent of its GNI going toward foreign assistance The most generous countries – Denmark, ... it has added three years to the average length of schooling for girls Ghana also earns consistently high marks on government effectiveness, political stability, civil freedoms and fighting corruption ... about right But the reality is that foreign aid spending is less than six-tenths of percent of the U .S budget We should spend more, not less, to save children s lives Hard economic decisions are...
  • 42
  • 466
  • 0
Overview of Trastuzumab’s Utility for Gastric Cancer pdf

Overview of Trastuzumab’s Utility for Gastric Cancer pdf

Ngày tải lên : 06/03/2014, 02:21
... over-expressing cancer cells Intracellular Mechanisms: Inhibits intracellular signaling pathways, phosphoinositide 3-kinase (PI3K) signaling such as Has anti-angiogenesis effect through decreasing vascular ... phase II studies Molecular targeting agents are being tested in this setting Targeted Therapy for GC Although there are benefits of palliative chemotherapy, the prognosis of advanced GC is still ... both groups Subgroup analysis (site of tumor, performance status, fluoropyrimidine used, histology, age, region, prior gastrectomy and number of metastatic sites) for survival favored trastuzumab...
  • 6
  • 474
  • 0
IMPLICATIONS OF INDIAN SUPREME COURT’S INNOVATIONS FOR ENVIRONMENTAL JURISPRUDENCE potx

IMPLICATIONS OF INDIAN SUPREME COURT’S INNOVATIONS FOR ENVIRONMENTAL JURISPRUDENCE potx

Ngày tải lên : 06/03/2014, 23:20
... country s forest lands in the hands of the same bureaucracy against whose mismanagement the original PIL was filed This has seriously impacted millions of forest dwellers’ customary as well as legal ... It started in 1996 as a case seeking directions from the apex Court for stopping felling of trees in Nilgiris forest and to regulate indiscriminate cutting of timbers in the Nilgiris Forest The ... includes: prisoners’ rights, child labour, inmates of various asylums, ensuring the rights of the poor to education, to shelter and other essential amenities, sexual harassment of women at working...
  • 23
  • 697
  • 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf

Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf

Ngày tải lên : 07/03/2014, 00:20
... Instruments) Statistical analysis Given experimental groups were tested for statistical significant differences using Student s t-test and sigmaplot 9.0 (Systat Software Inc., Chicago, IL, USA) ... GIRK1 subunit serving as PKA substrate (s) , as well as to assess its possible role in G- protein activation of the channel PKA phosphorylation of GIRK1 Fig Back-phosphorylation of GIRK1, expressed ... as well as on basal and agonist induced GIRK1 ⁄ GIRK4 (and also homooligomeric GIRK1F13 7S) currents had been described previously [18] To assess the role of the S ⁄ Ts in the regulation of GIRK1...
  • 9
  • 403
  • 0
Syllabus for Examination for Issue of Commercial Pilot’s Licence and Instrument Rating - Aeroplanes doc

Syllabus for Examination for Issue of Commercial Pilot’s Licence and Instrument Rating - Aeroplanes doc

Ngày tải lên : 07/03/2014, 11:20
... carriage of inadmissible passengers, deportees, or persons in custody stowage of baggage and cargo passengers seating security of passenger cabin and galley (s) smoking on board take-off conditions ... compasses detailed knowledge of the use of these compasses serviceability tests advantages and disadvantages of the remote indicating compasses adjustment and compensation of direct reading magnetic ... urgency procedures - f) 3.3 Distress (definition – frequencies – watch of distress frequencies – distress signal – distress message) Urgency (definition – frequencies – urgency signal – urgency...
  • 64
  • 420
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Ngày tải lên : 16/03/2014, 01:20
... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC ... TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA ... TAAAGGATCCCTTGTCATCGTCATCCTTGT AGTCAACACTATTTGAGTTTGACATTTGGC GAGAGAATTCGGGGGACCGTCAGTCTTCCT CTTCCCCC TTCCGAATTCTCATTTACCCGGAGACAGGG CCCCGCGGCCGCTGACACCGATTATTTAAA TTTTGAGCTCGGAGCCATAATGACAGCAGT TTTTGTCGACATGGCGCAACACGATGAAGC...
  • 9
  • 444
  • 0
Báo cáo khoa học: "A System for Real-time Twitter Sentiment Analysis of 2012 U.S" pdf

Báo cáo khoa học: "A System for Real-time Twitter Sentiment Analysis of 2012 U.S" pdf

Ngày tải lên : 16/03/2014, 20:20
... so we can adjust our system to handle higher volume of data by adding more servers and by distributing processing tasks Twitter traffic often balloons during big events (e .g televised debates ... The system we present here, along with the dashboards displaying analysis results with drill-down ability, is precisely aimed at generating real-time insights as events unfold Beyond the sheer scale ... politics by posting messages and ‘re-tweeting’ others’ messages It played a significant role in political events worldwide, such as the Arab Spring Movement and the Moldovian protests in 2009 In response...
  • 6
  • 534
  • 0

Xem thêm