objective by the end of the lesson students will be able to specific information about the english classes and decide a suitable one for themselves

Giáo án Anh văn lớp 7 : Tên bài dạy : People and places. Lesson 3: B1 - 2. I.Ojectives : -After the lesson Ss will be able to know more docx

Giáo án Anh văn lớp 7 : Tên bài dạy : People and places. Lesson 3: B1 - 2. I.Ojectives : -After the lesson Ss will be able to know more docx

Ngày tải lên : 06/08/2014, 15:22
... -Ask Ss retell the name of some countries in the south-east Asia -Work in pairs to discuss and write the answers on the BB Thai land - Laos - Cambodia - Singapore - Indonesia Malaysia ... *Practice - Play the tape again and then read the text to the exercise True- False - Give the correct answers a) False ( Liz knows nothing about General Giap.) b) False ( The People Army of Vietnam ... pairs) *Production -Ask Ss to retell some things about the General Nguyen Van Giap -Work in pairs to discuss -Speak aloud before the class Consolidation: -Ask Ss to retell the main content of...
  • 4
  • 654
  • 1
Unit 3: At home.Period 17: Lesson 4: ReadI. Objectives: - After the lesson, Ss will be able to pptx

Unit 3: At home.Period 17: Lesson 4: ReadI. Objectives: - After the lesson, Ss will be able to pptx

Ngày tải lên : 08/08/2014, 02:20
... Ask Ss to give their answers by both only and in writing - Give answers: a Because children often try to eat and drink them b Because the kitchen is a dangerous place c Because playing with one ... Reading the text - Ss read the text and check their prediction - Ask Ss to correct if the statements are false b, Comprehension questions: - Ask Ss to work in pairs to find out the answers of the ... Slap the board - Ask Ss to read the statements and guess which is true, which is false - Give T/F statements prediction basing on the part in textbook - Give feedback * While- reading: a Reading...
  • 4
  • 345
  • 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Ngày tải lên : 20/06/2014, 01:20
... CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC ... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA PB2 PB2/6U PB2/85 PB2/34 ... mu AGCAGUAGCAAGAGGAUUUUUA AGCAGUAGCAAGAGGAUUUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUAUCUUUUUCACAUUCUUAUUUACAUCGCUUGAUGC A GCCCUUUGUGAGGCUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACAUCUUUUA AGCAGUAGCAAGAGGAUUUUUAGUUAGACUUA...
  • 11
  • 427
  • 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Ngày tải lên : 21/02/2014, 01:21
... in the presence of an unlabeled antisense c-myc RNA probe generated by transcription of the plasmid linearized with BamHI Samples were then incubated with a combination of RNase A and T1 and ... vector, containing a 788-base pair fragment amplified from the human genomic GAPDH gene [20] GAPDH mRNA was utilized as a constant mRNA for control Statistical analysis The statistical analysis of ... plasminogen activator stimulates the Ras/ Extracellular signal-regulated kinase (ERK) signaling pathway and MCF-7 cell migration by a mechanism that requires focal adhesion kinase Src, and Shc Rapid...
  • 10
  • 703
  • 0
Colloquial language used in speaking classes by the English major sudents of Foreign Language Faculty - Thai Nguyen University= Ngôn ngữ thông tục được sử dụng

Colloquial language used in speaking classes by the English major sudents of Foreign Language Faculty - Thai Nguyen University= Ngôn ngữ thông tục được sử dụng

Ngày tải lên : 28/03/2015, 09:36
... ellipsis and slang Therefore, in regard to the meaning, the term „colloquial‟, „informal‟, „casual‟ and „conversational‟ are exchangeably used with the same meaning and „colloquial‟ can be replaced by ... that is often made by many native speakers and that marks another feature of its syntax This feature can be explained by the fact that native speakers tend to simplify the structures to make their ... including phrasal verbs, are very common, especially in spoken English because they tend to be colloquial in tone and are a particular feature of informal spoken discourse (Anna Siyanova and Norbert...
  • 59
  • 608
  • 1
the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations

the method of investment appraisal which may be applied to evaluated and rank potential investment opportunities and their relative merits and limitations

Ngày tải lên : 17/02/2014, 13:02
... knowledge base that gives a company a competitive advantage, and is one of the best reasons to acquire a company • International alternative A company may have an extremely difficult time creating ... share, because it allows them to have advantage in price competitive The acquisition of a large competitor is a reasonable way to quickly attain significant market share • Production capacity The ... merits and limitation Moreover, the nature of gearing and potential effected of high gearing on perceived risk and cost of capital I-Analysis of the reasons behind takeovers and the methods by which...
  • 17
  • 575
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Ngày tải lên : 18/02/2014, 02:20
... and of assistance The use of law can force a behavior that is desirable to the target but is not viable because of pressure to conform to a different standard In this case, the law can provide an ... face with peers Ability to behave appropriately can be enhanced when the target is forced to the right thing It may be more comfortable to behave and be able to blame tile law than it is to behave ... externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management...
  • 14
  • 780
  • 0
A Brief History of the English Language and Literature, Vol. 2 doc

A Brief History of the English Language and Literature, Vol. 2 doc

Ngày tải lên : 17/03/2014, 02:20
... Tapioca Tobacco Tomahawk Tomato Wigwam ARABIC (The word al means the Thus alcohol = the spirit.) Admiral (Milton writes ammiral) Alcohol Alcove Alembic Algebra Alkali Amber Arrack Arsenal Artichoke ... +ear+ and the language of the +eye+; between the language of the +mouth+ and the language of the +dictionary+; between the +moving+ vocabulary of the market and the street, and the +fixed+ vocabulary ... +Indo-European Family+ of languages That is to say, the main part or substance of it can be traced back to the race which inhabited the high table-lands that lie to the back of the western end of the...
  • 127
  • 956
  • 0
Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx

Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx

Ngày tải lên : 30/03/2014, 21:20
... appropriate metadata together with machine-processable information about associated annotations and interrelations among the annotation layers; and (2) a segmentation of the primary data into minimal ... Tools The ANC project provides an API for GrAF annotations that can be used to access and manipulate GrAF annotations directly from Java programs and render GrAF annotations in a format suitable for ... internal tools and methods for automatically transducing other annotation formats to GrAF and for rapid adaptation of previously unseen formats Contributions may be emailed to anc@cs.vassar.edu...
  • 6
  • 374
  • 0
OUTBREAKS BY THE NUMBERS: FRUITS AND VEGETABLES 1990-2005 potx

OUTBREAKS BY THE NUMBERS: FRUITS AND VEGETABLES 1990-2005 potx

Ngày tải lên : 31/03/2014, 18:20
... hazard analysis for various food commodities, such as meat, seafood, and juice It can also be used for produce, a commodity that causes high numbers of outbreaks and illnesses In the past year alone, ... Outbreaks in the CSPI database are grouped according to regulatory agency, and placed within one of thirteen food categories Each category is then subdivided into food types The database is updated ... Points (HACCP) based program to reduce the risk of microbial contamination, using the Seafood HACCP program as a model Mandatory seafood HACCP utilized a preventative control program for seafood...
  • 15
  • 330
  • 0
the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities

the chemical laboratory its design and operation a practical guide for planners of industrial, medical, or educational facilities

Ngày tải lên : 31/05/2014, 01:37
... digestion and distillation apparatus was installed against a wall and the hot air was drawn off overhead The heat radiating from 12 flasks and heaters, however, made the workers on the other side ofthe ... to the action, or laboratory workers will have to a fair amount of hiking As a rule, analytical balances are placed on separate tables, which should be large enough to also hold a desiccator for ... discussed in Chapter A partial check list of operations for an industrial chemical laboratory is shown in Table The format of a formal list will vary considerably from one laboratory to another, but...
  • 173
  • 561
  • 0
báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx

báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx

Ngày tải lên : 19/06/2014, 22:20
... commercially available enzyme linked immunosorbent assays (ELISAs; Cayman Chemical, San Diego CA USA) Nitrite assay Cell culture medium was assayed for NO2- by the Griess assay as described [8] Samples ... Molecular Dynamics) Within each sample, the density of each apoptosis-associated mRNA band was normalized to the sum of the L32 + GAPDH bands Eicosanoid assays PGE2 and LTB4 were measured in cell culture ... neuroinflammation in the ALS context, and to create a tool for the study of neuroinflammatory signal transduction, primary cortical astrocytes were cultured from neonatal mice bearing G9 3A- SOD1 mutations...
  • 9
  • 436
  • 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

Ngày tải lên : 20/06/2014, 08:20
... of various collaborative and integrative efforts at the healthcare delivery level in urban and rural areas have been carried out or are ongoing In Rwanda, integration of TB and HIV services at ... Nontraditional Healthcare Providers A critically important issue to both TB and HIV programs is the availability of adequately trained healthcare workers who will be able to provide the breadth of care ... International epidemiologic Databases to Evaluate AIDS (IeDEA) study,[13] the Consortium to Respond Effectively to the AIDS/TB Epidemic (CREATE),[14] and the Zambia and South Africa Tuberculosis and AIDS...
  • 5
  • 469
  • 0
Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt

Báo cáo y học: "The STRS (shortness of breath, tremulousness, racing heart, and sweating): A brief checklist for acute distress with panic-like autonomic indicators; development and factor structure" ppt

Ngày tải lên : 08/08/2014, 20:23
... research has examined the diagnostic and prognostic value of any sign except for tachycardia The lack of a validated measure that utilizes multiple discrete indicators of acute autonomic activation ... cortical and one primarily non-cortical (acute autonomic activation) The distinctness of the factors suggests that the four indicators of acute autonomic activation tapped by the STRS constitute a ... interpretable factor structure of the STRS confirms the adequacy of the two theoretical latent variables: 1) PTSD diagnostic criterion A, and 2) peritraumatic acute autonomic activation Several sample...
  • 8
  • 491
  • 0
báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx

báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx

Ngày tải lên : 11/08/2014, 00:22
... repeat CT scan of the abdomen and pelvis revealed leakage into the abdominal cavity (Figure 6) Urgent re-exploration of the abdominal cavity revealed a moderate amount of contrast material and ... prognostic factors include advanced age, late stage Page of disease, and a poor performance status, as well as delay and contraindication of chemotherapy The prognosis of synchronous primary lymphoma in ... indicating expulsion into the peritoneal cavity Hematoxylin and eosin stain, magnification 20 × Figure A computed tomography (CT) scan of the abdomen and pelvis showing loculated extravasation of...
  • 5
  • 305
  • 0
báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

Ngày tải lên : 11/08/2014, 23:22
... guides a total of 12 endosseous Camlog® implants were accurately positioned in the mandible and the maxilla according to the predefined planning that was made up of DVT scan and a wax up Again bone ... restauration was placed (figure 5) Discussion The main basic criteria for restauration of the edentulous maxilla and mandible are adequate bone mass and ortholalveolar form [6] This can be achieved by augmentation ... to achieve optimal position and angulation of the inserted implants [16-18] A similar variant of the maxillary sandwich osteotomy for the rehabilitation of the severely atrophied maxilla is the...
  • 7
  • 375
  • 0
MANUAL FOR USE BY THE MARITIME MOBILE AND MARITIME MOBILE SATELLITE SERVICES VOL 1

MANUAL FOR USE BY THE MARITIME MOBILE AND MARITIME MOBILE SATELLITE SERVICES VOL 1

Ngày tải lên : 26/04/2016, 22:25
... combination of the above, as may be approved by the flag administration In sea areas A3 and A4 , the availability of equipment is ensured by using a combination of at least two of the above, as may ... SART, the requirement to carry the International Code of Signals and Volume III of the International Aeronautical and Maritime Search and Rescue (IAMSAR) Manual, and the obligation for the master ... Maritime Manual FIGURE NAVAREAs/METAREAs for promulgating maritime safety information by radio showing the area coordinators for navigational warnings and meteorological information XVIII Canada I...
  • 134
  • 679
  • 0
MANUAL FOR USE BY THE MARITIME MOBILE AND MARITIME MOBILE SATELLITE SERVICES VOL 2

MANUAL FOR USE BY THE MARITIME MOBILE AND MARITIME MOBILE SATELLITE SERVICES VOL 2

Ngày tải lên : 26/04/2016, 22:29
... aeronautical station: A land station in the aeronautical mobile service In certain instances, an aeronautical station may be located, for example, on board ship or on a platform at sea 1.82 aeronautical ... designated by standard symbols, e.g type of modulation of the main carrier, modulating signal, type of information to be transmitted, and also, if appropriate, any additional signal characteristics ... primarily intended for the exchange of information in the form of speech (CS 1017) _ 1.117.1 A graphic document records information in a permanent form and is capable of being filed and...
  • 624
  • 887
  • 0

Xem thêm