multi scale gis data driven method for early assessment of wetlands impacted by transportation c

Báo cáo khoa học: Data-driven docking for the study of biomolecular complexes pptx

Ngày tải lên : 30/03/2014, 15:20

... E2A–HPra CSP Atx1–Ccc2 domain CSP HR1b–Rac1 CSP FceRIa–IgE Ce2 CSP FceRI–peptide CSP, mutagenesis, NOE LpxA–acyl carrier protein CSP, RDC, mutagenesis Protein–carbohydrates Tri,hexa saccharide–antibody ... data (CSP, chemical shift perturbation; PC, pseudocontact shifts; SAT, saturation transfer) Complex Protein–protein Cyt c cyt f Cyt c cyt c peroxidase Plastocyanin–cyt f Myoglobin–cyt b5 Information ... ternary complex of cytochrome f and cytochrome c: identiﬁcation of a second binding site and competition for plastocyanin binding Chembiochem 3, 526–533 Worrall JAR, Liu YJ, Crowley PB, Nocek JM, Hoffman...

20
489
0

ASTM D6079 11 Standard Test Method for Evaluating Lubricity of Diesel Fuels by the HighFrequency Reciprocating Rig (HFRR)

Ngày tải lên : 20/10/2014, 17:18

... temperature, friction force, electrical contact potential, and test duration, with an electronic data acquisition and control system 6.4 Microscope, with Digital Camera7,8capable of 100× magnification, ... test apparatus performance and accuracy at least every 20 tests by testing each reference fluid in accordance with this section Perform one test with each reference fluid If the WSD for either fluid ... Practice D4306 8.3 New sample containers are preferred, but if not available, the Containers for Lubricity Testing section of Practice D4306 gives guidance on suitable cleaning procedures for...

8
1.1K
2

apress pro.dynamic..net.4.0.applications.data-driven.programming.for.the..net.framework

Ngày tải lên : 06/08/2013, 17:29

... CodeCreate Class class CodeCreate { CodeCompileUnit oCodeCompileUnit; CodeTypeDeclaration oCodeTypeDeclaration; public CodeCreate() { oCodeCompileUnit = new CodeCompileUnit(); } public void CreateNamespaceAndClass(string ... all_cons_columns cc ON c. constraint_name = cc.constraint_name WHERE cc.owner = 'SCOTT' AND c. status = 'ENABLED' ORDER BY cc.table_name, cc.position; Figure 1-6 Oracle constraint metadata You can ... CodeNamespace object’s Types collection The CodeNamespace object, in turn, is added to the NameSpaces collection of the CodeCompileUnit object Thus, you wind up with a code hierarchy of CodeCompileUnit...

265
597
0

Báo cáo khoa học: "Data-Driven Strategies for an Automated Dialogue System" potx

Ngày tải lên : 23/03/2014, 19:20

... returned: Backchannel, Expression, Accept Reject Reject-part Accept Expression Top four cosine scores 0.7 0.6 0.5 0.4 0.3 0.2 0.1 Reject Accept Expression Reject-part Confidence scores Categories ... Expression and Accept If the dialogue manager is looking for either Accept or Reject, it can ignore Backchannel and Expression in order to detect the correct classification In the case of certainly ... terms by frequency Yield: one “document vector” for each task Compare queries and documents: Create “query vectors.” Obtain a cosine similarity score for each query/document pair Yield: cosine scores/routing...

8
336
0

báo cáo khoa học: " Classification of unknown primary tumors with a data-driven method based on a large microarray reference database" ppsx

Ngày tải lên : 11/08/2014, 12:21

... part of it In fact, if we were to accept esophagus, gastric and colorectal as correct predictions for a cancer being of gastrointestinal origin, the total classification accuracy of gastric cancer ... http://genomemedicine.com/content/3/9/63 Page of 12 Table Accuracies per cancer Cancer Total correct Total samples Percent correct Sensitivity Specificity Bladder cancer 11 63.6% 64% 100% Breast cancer 11 ... similarity score Score > 0.01 50% of samples, 97% accuracy Score > 0.05 69% of samples, 89% accuracy Figure A graph of the accuracy of the method as a function of the similarity score of the best...

12
391
0

METHOD FOR THE INVERSION OF RESISTIVITY SOUNDING AND PSEUDOSECTION DATA

Ngày tải lên : 06/08/2015, 00:01

... a significant problem, particularly for the 2-D inversion of data on microcomputers The calculations for the examples shown in this paper were performed on an IBM-PC compatible microcomputer ... 1989) Other methods of modifying the multiplication factor, for example by using the ratio of the change in the model layer resistivity to the change in the logarithmic difference of the corresponding ... The number of rectangular blocks is the same as the number of data points The horizontal location of the center of each block is placed at the midpoint of the array used to measure the corresponding...

12
314
0

INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx

Ngày tải lên : 07/03/2014, 16:20

... exclusion 21 21 21 Number of accepted samples 105 105 104 Accuracy (specificity), % 100 — — Accuracy (sensitivity), % — 98,1 99 Accordance, % 100 96,2 98,1 Concordance, % 100 96,2 98,1 Table C. 3 ... laboratories Number of laboratories retained after exclusion 25 Number of accepted samples 125 Accuracy (specificity), % Accuracy (sensitivity), % 94,4 Accordance, % 88,8 Concordance, % 26 — 89,1 ... microorganisms which form typical or less typical colonies on solid selective media and which display the biochemical and serological characteristics described when tests are carried out in accordance...

34
690
0

Báo cáo khoa học: Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis ppt

Ngày tải lên : 16/03/2014, 22:20

... CTAGTTTTTGTAATCGGCTGCAGCGCAGCCG Oligo encompassing AmyQ H-region, complementary CGGCGCACGCAGCCGCGGCCGCCA with h-ala-fwd h-leu-fwd AGCTTGCTGCTTCTCCTTTTATGCCTGCTGTTACTCCTGC Oligo encompassing AmyQ H-region, complementary ... CGCGAATTCTAATATGATTCAAAAACGAAAGCGGA Ampliﬁcation primer for construction of truncated AmyQ variants for synthesis of nascent chains amyQ95 GCCGGATCCTTCTCCTAAATCATACAA Ampliﬁcation primer for construction of truncated ... upstream of H-region) TTTTTGAATCATATGTC Oligo encompassing AmyQ H-region, complementary h-ala-fwd AGCTTGGCGGCCGCGGCTGCGTGCGCCGCGGCT GCGCTGCAGCCGATTACAAAAA with h-ala-rev h-ala-rev CTAGTTTTTGTAATCGGCTGCAGCGCAGCCG...

14
282
0

Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

Ngày tải lên : 17/03/2014, 00:20

... impractical encoding problem to a collection of smaller ones The cutting expresses the original partial order as a tree of components, each of which corresponds to a set programming instance Components ... set for any other successor of y Other constraints disappear by the simpliﬁcations described earlier Furthermore, ULs occur frequently in the partial orders we consider in practice; and by increasing ... division into components creates a collection of set programming instances with a wide range of sizes and difﬁculty; we examine each instance and choose appropriate techniques for each one Table...

10
410
0

Serum Biomarkers for Early Detection of Gynecologic Cancers ppt

Ngày tải lên : 22/03/2014, 11:20

... the early detection of cervical cancer The squamous cell carcinoma antigen, SCC, is the most commonly used serum marker for squamous cell cervical carcinoma, which makes up 85–90% of all cervical ... of cervical cancer patients Additionally, increased serum CYFRA 21-1 was shown to precede the clinical detection of recurrence of the disease [12] Adenocarcinoma accounts for 10–15% of cervical ... squamous cell carcinoma of the cervix Gynecol Oncol 1994, 52, 63–68 Ferdeghini, M.; Gadducci, A.; Annicchiarico, C. ; Prontera, C. ; Malagnino, G.; Castellani, C. ; Facchini, V.; Bianchi, R Serum CYFRA...

16
670
1

Báo cáo khoa học: "a Method for Automatic Evaluation of Machine Translation" pot

Ngày tải lên : 23/03/2014, 20:20

... precision Modiﬁed n-gram precision is computed similarly for any n: all candidate n-gram counts and their corresponding maximum reference counts are collected The candidate counts are clipped by ... matches sentence by sentence Next, we add the clipped n-gram counts for all the candidate sentences and divide by the number of candidate n-grams in the test corpus to compute a modiﬁed precision ... on a Chinese sentence subset extracted at random from our 500 sentence test corpus We paired each source sentence with each of its translations, for a total of 250 pairs of Chinese source and...

8
336
0

Standard Test Method for Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)

Ngày tải lên : 26/03/2014, 21:55

... following classifications: Class A, Non-air entrained cements for use in concrete, such as sold under Specifications C1 50, C5 95, and C1 157 Class B, Air-entrained cements for use in concrete, such as ... qualification requirements of this section The consolidation method consists of a speci c procedure, equipment and consolidation device, as selected and used in a consistent manner by a speci c laboratory ... of Mortar: 10.2.1 Mechanically mix in accordance with the procedure given in Practice C3 05 10.3 Determination of Flow: 10.3.1 Determine flow in accordance with procedure given in Test Method C1 437...

10
851
0

Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

Ngày tải lên : 30/03/2014, 21:20

... Dirichlet distribution for this simplest case, and it can be analytically calculated as follows p(φ|D) = Dir(φ|{αk + c( k)}), (6) where c( k) is the frequency of choice k in data D For example, c( k) ... nouns according to the number of unique co-occurring contexts and the contexts according to the number of unique cooccurring nouns, and then we selected the top one million nouns and 100,000 contexts ... we sort the contexts in descending order according to c( wi , fk ) and retrieve the top-L contexts.5 For each selected context, we sort the words in descending order according to c( wi , fk ) and...

10
472
0

a novel method for the synthesis of titania nanotubes using

Ngày tải lên : 05/05/2014, 15:26

... electrolytic surface) and reveals a higher current density for the sonoelectrochemical method compared with anodization using magnetic stirring This indicates that the sonoelectrochemical method ... of bubbles near the solid surface [20] Collapse of transient bubbles causes a jet of liquid to impinge on the surface [20] At a microscopic scale, impingement of a liquid jet on the surface could ... extent of carbon doping by this method (62%) exceeds that in an earlier report on carbon incorporation through acetylene cracking (13%) [9] 3.4 Photoelectrochemical generation of hydrogen by water...

8
634
0

a novel method for the synthesis of cao nanoparticle

Ngày tải lên : 06/05/2014, 08:55

... respectively Figure FTIR spectra of CaO NPs/Polyvinylpyrrolidone (PVP): a) before and b) after the reaction with 2CEPS + S Cl S Cl- Sulfonium 2-CEPS S Cl H O S O Ca O Ca O Ca S HEPS OH O Ca O Ca ct ... of the nanoparticles [32] interaction of 2-chloroethyl phenyl sulfide on the CaO nanoparticles surface Temperature Procedure reaction of the 2-CEPS with CaO program for GC: The carrier gas was ... produced which were out using Field Emission Scanning Electron left for 24 h at 60 oC ±10 0C to be dried The Microscope (SEM, LEO-1530VP) X-ray dried precursors were calcinated at 300 oC diffraction...

12
705
0

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

Ngày tải lên : 06/05/2014, 13:26

... Photoluminescence of Assembly-Controlled ZnO Architectures by Aqueous Chemical Growth, J Phys Chem C 113 (2009) 1052-1059 [28] S Singh, K C Barickb, D Bahadur, Shape-controlled hierarchical ZnO architectures: ... active sites of the ZnO photocatalyst [46] Since an appropriate amount of oxygen vacancies can entrap electrons from the semiconductor, the holes can diffuse to the surface of the semiconductor ... been characterized by X-ray powder diffraction (XRD), field-emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), and scanning electron microscopy (SEM) The optical...

26
551
0

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

Ngày tải lên : 20/06/2014, 04:20

... temperatures (>50 C) to generate uniformly acellular cancellous bone Methods Cancellous Bone Harvest and Treatment Cancellous bone was obtained from the iliac crest of Swiss Alpine sheep, which were euthanized ... fact that there is so much cell death at the periphery induced during the cutting process, we did not analyze this region to remove any effect of preparation artifact Macroscopical analysis of ... able to ionize (remove electrons) atoms, and destroy chemical compounds by the formation of radicals i.e reactive oxygen species Radiation induced DNA damage caused by X-ray exposure ranges from...

4
403
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

Ngày tải lên : 20/06/2014, 04:20

... informed consent of parents of patients prior being included into the study and was authorized by the local ethical committee The study was performed in accordance with the Ethical standards of ... a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each for motion of the ankle and foot, position of the heel ... incorrect casting technique, improper tenotomy, under-corrected deformity, ill-fitting splints, lack of understanding and poor compliance of patients’ parents due to poor socio-economy can all affect...

7
531
0

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

Ngày tải lên : 20/06/2014, 07:20

... informed consent of parents of patients prior being included into the study and was authorized by the local ethical committee The study was performed in accordance with the Ethical standards of ... a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each for motion of the ankle and foot, position of the heel ... incorrect casting technique, improper tenotomy, under-corrected deformity, ill-fitting splints, lack of understanding and poor compliance of patients’ parents due to poor socio-economy can all affect...

7
802
0

báo cáo hóa học:" Psychometric evaluation of a visual analog scale for the assessment of anxiety" pdf

Ngày tải lên : 20/06/2014, 16:20

... Social Func- Table 4: MIDs - Distribution of Mean Change Scores for the GA-VAS PGIC - Mean Change at Week (In-clinic) PGIC - Mean Change at Week (In-clinic) CGIC - Mean Change at Week (In-clinic) ... Acknowledgements We thank Cheryl Coon of RTI Health Solutions, who provided technical assistance in conducting some psychometric analyses Pfizer Inc funded the data collection and analysis for ... SC: Development of a new type of global quality of life scale, and comparison of performance and preference for 12 global scales Qual Life Res 1996, 5:469-480 Lingjaerde O, Foreland AR: Direct...

8
385
0