matlab a fundamental tool for scientific computing and engineering applications volume

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 1 ppt

Ngày tải lên : 29/06/2014, 09:20
... Fanjason Ramahaleomiarantsoa, Eric Jean Roy Sambatra, Nicolas Hộraud and Jean Marie Razafimahenina Chapter Dynamic and Quasi-Static Simulation of a Novel Compliant MEMS Force Amplifier by Matlab/ Simulink ... Transformer Using Matlab 219 Adel Aktaibi and M Azizur Rahman Chapter 11 PH Control Using MATLAB 243 Mostefa Ghassoul Chapter 12 An Advanced Transmission Line and Cable Model in Matlab for the ... MATLAB A Fundamental Tool for Scientific Computing and Engineering Applications Volume Note: It may be necessary to convert data to suitable matrix form (e.g rough data are in the form of a...
  • 534
  • 691
  • 0
MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

MATLAB – A FUNDAMENTAL TOOL FOR SCIENTIFIC COMPUTING AND ENGINEERING APPLICATIONS – VOLUME 2 potx

Ngày tải lên : 29/06/2014, 09:20
... application and Matlab workspace, using “PutWorkspaceData()” and “GetWorkspaceData()” interface methods: 14 MATLABA Fundamental Tool for Scientific Computing and Engineering ApplicationsVolume ... Software for Design and Analysis of Electrical Machines 161 Gaizka Almandoz, Gaizka Ugalde, Javier Poza and Ana Julia Escalada Section Telecommunication-Communication Systems 185 Chapter MATLAB as ... Prokop, Walid Hassairi, Moncef Bousselmi, Mohamed Abid, Carlos Valderrama, Moulay Tahar Lamchich, Nora Lachguer, Gaizka Almandoz, Gaizka Ugalde, Javier Poza, Ana Julia Escalada, Oriol Font-Bach, Antonio...
  • 324
  • 788
  • 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt

Ngày tải lên : 11/08/2014, 05:22
... integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national or regional level ... Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto Grilli Italy: Center for the Evaluation ... project It is a software program that packages information on the design and evaluation of evidence-based QI interventions into an integrated, easily accessible, and practical tool In this paper, we...
  • 7
  • 429
  • 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Ngày tải lên : 26/10/2012, 09:48
... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 1-14 Armstrong AJ, Garrett-Mayer E, Ou Yang YC, Carducci MA, Tannock I, de WR, and Eisenberger M Prostate-specific antigen and pain surrogacy analysis in metastatic hormone-refractory prostate cancer...
  • 10
  • 408
  • 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Ngày tải lên : 31/10/2012, 14:59
... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...
  • 11
  • 715
  • 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Ngày tải lên : 03/04/2013, 21:06
... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... bitter and more intense in currant flavor and in overall flavor, and stronger in after-taste than the sample with a regular aroma concentration The heightened aroma concentration caused a slight ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was...
  • 10
  • 599
  • 1
modeling with data tools and techniques for scientific computing oct 2008

modeling with data tools and techniques for scientific computing oct 2008

Ngày tải lên : 11/06/2014, 13:32
... next layer of abstraction provides specialized tools for dealing with data sets: databases and a query language for organizing data Chapter presents a new syntax for talking to a database, Structured ... false, and otherwise it is true The standard operations for comparison and Boolean algebra all appear in somewhat familiar form: C ONDITIONS ( a > b) ( a < b) ( a >= b) ( a
  • 471
  • 450
  • 0
báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx

báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx

Ngày tải lên : 19/06/2014, 10:20
... Ladouceur M, Barbeau H: A treadmill apparatus and harness support for evaluation and rehabilitation of gait Arch Phys Med Rehabil 1995, 76:772-778 Kamel HK, Iqbal MA, Mogallapu R, Maas D, Hoffmann RG: ... and balance in a wide range of categories of patients The system allows natural mediolateral APAs to occur across a wide range of gravity-like loads, an important balance related stimulus that ... varied continuously and the Bambi compressor can provide airflow simultaneously to the air bearings and the pneumatic actuator The system can easily be moved and handled by one person and is as...
  • 7
  • 475
  • 0
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

Ngày tải lên : 09/08/2014, 10:22
... thermal imaging of the wrist and MCP, normal adult wrists and hands from controls were imaged on separate days Three thermal scans were obtained at each session and the HDI was calculated for each ... participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel ... participated in study design, data acquisition, processing, analysis, and in preparation of the manuscript JE participated in data acquisition and analysis CKK participated in study design and...
  • 9
  • 344
  • 0
báo cáo khoa học: " The Rx for Change database: a first-in-class tool for optimal prescribing and medicines use" ppt

báo cáo khoa học: " The Rx for Change database: a first-in-class tool for optimal prescribing and medicines use" ppt

Ngày tải lên : 10/08/2014, 10:23
... summaries intervention characteristics, and outcomes from each review using a standardised data extraction form and a consensus process This ensures a consistent summary format for each review and ... the accuracy of the information Analysis and synthesis We analyse, summarise, and report separately the results of all relevant comparisons within each systematic review using quantitative and ... applicability, and quality Within a year of its launch, it had accumulated more than 25,000 page views With increasing awareness of the database and its ongoing updates, we anticipate that this...
  • 9
  • 245
  • 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

Ngày tải lên : 13/08/2014, 08:21
... of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, IN, USA) performed all assays The PC activity assay was performed on a ... they had a baseline PC measure Day PC was classified as end of infusion If day measurement was not available, last observation carried forward values were used for classification These data were ... from ≥1 for renal SOFA to ≥4 for cardiovascular and respiratory SOFA Page of 11 (page number not for citation purposes) Critical Care Vol 12 No Shorr et al Table PROWESS and ENHANCE patient baseline...
  • 11
  • 343
  • 0
Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx

Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx

Ngày tải lên : 14/08/2014, 14:21
... [14] In addition, MGD has adopted the Mouse Embryo Anatomy Nomenclature Database [15] and the Anatomical Dictionary for the Adult Mouse [16] for annotating data that include anatomical attributes, ... systematic nomenclature Mech Dev 1998, 74:111-120 Hayamizu TF, Magan M, Corradi JP, Kadin JA, Ringwald M: The Anatomical Dictionary for the Adult Mouse: a tool for annotating and integrating data ... vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 o vascular dilation was associated with an increased endothelial proliferation rate o in addition to the dilation,...
  • 9
  • 264
  • 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

Ngày tải lên : 14/08/2014, 16:21
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
  • 11
  • 467
  • 0
Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt

Tài liệu Cyber Forensics—A Field Manual for Collecting, Examining, and Preserving Evidence of Computer Crimes ppt

Ngày tải lên : 18/01/2014, 06:20
... information are advised and encouraged to confirm specific claims for product performance as necessary and appropriate The legal/financial materials and information that are available for reference ... legal/financial counsel as may be appropriate for any matters to which the legal/financial materials and information may pertain Web sites included in this manual are intended to provide current and accurate ... Dedication Erienne, Kristina, and Andy Michael Jordan said it best, thus, what more can I say… I approached practices the same way I approached games You can't turn it on and off like a faucet...
  • 346
  • 1.5K
  • 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf

Ngày tải lên : 15/02/2014, 01:20
... Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratasereactivating factor in ADP-bound and nucleotide-free forms ... respectively, and the a and b subunits of the reactivase are abbreviated as aR and bR, respectively, molar ratios of aD, bD, cD, aR and bR in bands i and vi were determined to be about : : : : and : : : ... Bando R, Hieda N & Toraya T (2004) Identification of a reactivating factor for adenosylcobalamin-dependent ethanolamine ammonia lyase J Bacteriol 186, 6845–6854 Baker JJ & Stadiman TC (1982) Amino...
  • 13
  • 620
  • 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx

Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx

Ngày tải lên : 16/02/2014, 22:20
... tubular apparatus with sharp curves, and for coating newly-made glass apparatus with a layer of soot to prevent too rapid cooling, and its usually associated result—cracking Fig 12.—Glass blower's ... MICROSCOPICAL EXAMINATION OF BACTERIA AND OTHER MICRO-FUNGI 69 Apparatus and Reagents used in Ordinary Microscopical Examination, 69—Methods of Examination, 74 VI STAINING METHODS 90 Bacteria Stains, ... only at supplementing the usually scanty details of technique, and at instructing the student how to fit up and adapt apparatus for his daily work, and how to carry out thoroughly and systematically...
  • 666
  • 511
  • 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Ngày tải lên : 19/02/2014, 16:20
... degradation (–ajsajs) and a second influence through its autocatalytic feedback (+ajsbjs) through the same reaction, vs The latter influences cancel each other, again as all stoichiometries are ... not have steady states on its border, all phase trajectories lead inward Steady states on the border are readily identified ([21] and an example below) That am be positive and (i < m) be negative ... they are not branched and correspond to any step between two substances in graphs such as Graph (1), i.e any path that involves a single chemical reaction One actual chemical reaction may effect a...
  • 11
  • 638
  • 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Ngày tải lên : 20/02/2014, 19:20
... reparandum information gave a false alarm, the alternative of not skipping the reparandum is still available For each utterance in the input, the parser needs to find an interpretation that starts ... utterances, with no systematic allowance for speech repairs and editing terms Such a treatment cannot adequately deal with dialogs involving more than one human (as appear in machine translation ... over that term to allow utterances to be formed around it This metarule (and our other metarules) can be viewed declaratively as specifying allowable patterns of phrase breakage and interleaving...
  • 8
  • 486
  • 0
A New Vision for Adolescent Sexual and Reproductive Health pot

A New Vision for Adolescent Sexual and Reproductive Health pot

Ngày tải lên : 05/03/2014, 17:20
... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... European levels without fundamental changes in adult social in adult social norms norms regarding access to health information and to reproductive regarding access to health services health information...
  • 7
  • 662
  • 0

Xem thêm