list you display only the sets of data that meet a certain set of search conditions called criteria the autofilter feature enables you to specify those search conditions from the list

Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

Ngày tải lên : 14/08/2014, 17:22

... the annotation features from WormBase that were used to annotate wCNEs Additional data file contains the sequences of the 2,084 wCNEs Additional data file is a table with the coordinates of the ... files The following additional data are available with the online version of this paper Additional data file is a figure showing the distribution of wCNEs along each chromosome Additional data file ... 6% and 3% above the genome averages [23,24] A gradual G+C enrichment followed by a sharp AT-rich peak at the CNE boundaries marks the transition of base composition from the flanking DNA to the...

14
257
0

Báo cáo hóa học: " Research Article On the Sets of Regularity of Solutions for a Class of Degenerate Nonlinear Elliptic Fourth-Order Equations with L1 Data" doc

Ngày tải lên : 22/06/2014, 19:20

... [2] A Kovalevsky and F Nicolosi, “On the sets of boundedness of solutions for a class of degenerate nonlinear elliptic fourth-order equations with L1 -data, ” Fundamentalnaya I Prikladnaya Matematika, ... operator (see, e.g., [1]), bounded on the sets G ⊂ Ω where the behavior of weights and of the data of the problem is regular enough (see [2]) In our paper, following the approach of [3], we establish ... where σ > and f ∈ L1 (Ω) The assumed conditions and known results of the theory of monotone operators allow us to prove existence of generalized solutions of the Dirichlet problem associated to our...

15
291
0

.Thank you for trying Solid Converter PDF. The trial version of this product only converts 10% of ppsx

Ngày tải lên : 24/07/2014, 01:20

... Thank you for trying Solid Converter PDF The trial version of this product only converts 10% of your document, with a 10 page maximum For this conversion, Solid Converter PDF converted of pages ... For this conversion, Solid Converter PDF converted of pages Please register Solid Converter PDF at http://www.solidpdf.com/buy.htm to remove this restriction ...

2
315
0

Tài liệu Limit the Data Displayed in a Bound List Box doc

Ngày tải lên : 21/01/2014, 12:20

... the parameter of the OleDBDataAdapter1, which was created by using the ? in the Select statement of the data adapter Then Dataset1 is cleared of its data with the Clear method Finally, DataSet1 ... data based off the value in txtCustLimit, using the data adapter Listing 1.2 frmHowTo1_2.vb: Submitting a Parameter to a DataAdapter and Filling the Dataset Private Sub btnLoadList_Click(ByVal ... Me.OleDbDataAdapter1.Fill(Me.DataSet1) End Sub Note There is one big difference here between an OleDbDataAdapter and a SqlDataAdapter Whereas the OleDbDataAdapter takes a ? to specify a parameter within the Select statement,...

4
323
0

Total Parking Management Parking is only the start of your journey pptx

Ngày tải lên : 17/03/2014, 20:20

... tremendous amount of data everything from paid parking transactions to violation transactions But parking agencies struggle in their attempt to synthesize this data and adjust their operation or ... delivery accordingly With our hosted application, we manage parking data for large and small programs globally We apply advanced business intelligence tools to mine the data for trends, variances, and ... Parking Programs Demand Management Data drives parking operations–at least it should Every parking operation generates a tremendous amount of data every day, but it’s difficult to analyze parking...

8
414
0

Changing only the aesthetic features of a product can affect its apparent usability pptx

Ngày tải lên : 23/03/2014, 13:20

... was the same as in Experiment except that participants rated the aesthetics and usability of each of model, then used them, then rated them again for both aesthetics and usability The order of ... 2 Andrew Monk and Kira Lelos usability and ratings of beauty They had 156 students rate 26 layout drawings for a bank ATM Averaging over participants and correlating across layouts they obtained ... demonstration of the effect of a manipulation of usability on aesthetic ratings, there is a strong case that Product Features influence aspect of Apparent Product other than those they are obviously...

13
347
0

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Ngày tải lên : 23/03/2014, 13:20

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

11
679
0

what the irs doesn’t want you to know a cpa reveals the tricks of the trade

Ngày tải lên : 01/06/2014, 10:56

... shortfalls of the IRS so that the scales of justice are tipped in the taxpayers’ favor I have decided to make this information available so that you, the average taxpayer, can be armed with the same ... his area, he satisﬁed that need, although the agent admitted that he didn’t think there was any real proof that the taxpayer even owed the IRS money After a 20year battle, the case was settled to ... taxpayers about their rights and options regarding tax compliance is already part of the new IRS agenda To the IRS employee, the image of us, the taxpayers, as the bad guys and them as the tough...

419
369
0

Báo cáo hóa học: " Characterizations of the solution sets of pseudoinvex programs and variational inequalities" pot

Ngày tải lên : 21/06/2014, 01:20

... nondifferentiable pseudoconvex optimization problems and applied them to obtain the characterizations of solution sets of Stampacchia variational inequalities and Minty variational inequalities In this paper, ... Characterizations of the solution sets of pseudoinvex programs and variational inequalities Journal of Inequalities and Applications 2011 2011:32 Submit your manuscript to a journal and beneﬁt from: Convenient ... this article, XY presented the ideas of this article, HL participated in some study of this article All authors read and approved the final manuscript Competing interests The authors declare that...

13
228
0

Báo cáo lâm nghiệp: "Can 13C stable isotope record of Norway spruce tree rings display the effect of environmental conditions" pot

Ngày tải lên : 07/08/2014, 03:22

... study was to enlarge the data set and to validate the finding that the tree physiological activity was negatively affected by atmospheric depositions and soil acidification in this area The research ... may have caused especially foliage damage (Sutinen et al 1998), thereby affecting carbon fixation The relatively quick recovery can be due to the assimilatory apparatus regeneration An increase ... research was carried out in a forest stand located in the catchment of the Čertovo Lake in the Bohemian Forest Protected Landscape Area This area was exposed to heavy atmospheric pollution in the last...

7
413
0

Báo cáo toán học: "Sets of Points Determining Only Acute Angles and Some Related Colouring Problems" pot

Ngày tải lên : 07/08/2014, 13:21

... cubic acute d -sets of cardinality n to make a cubic acute 3d -set of cardinality n2 Theorem 4.2 κ(3d) ≥ κ(d)2 Proof: Let S = {v , v , , vn−1 } be a cubic acute d -set of cardinality n = κ(d), and ... 26, the results u of a computer program, based on the ‘probabilistic construction’ but using sets of points close to the surface of the d-sphere, provide the largest known acute d -sets An acute ... 7 -set of cardinality 14 and an acute 8 -set of cardinality 16 are displayed For 27 ≤ d ≤ 62, the largest known acute d -set is cubic Finally, for d ≥ 63, theorem 3.1 provides the best (probabilistic)...

24
341
0

Báo cáo khoa học: " Does Intensity Modulated Radiation Therapy (IMRT) prevent additional toxicity of treating the pelvic lymph nodes compared to treatment of the prostate only?" ppt

Ngày tải lên : 09/08/2014, 09:22

... Hahn S, Thomas CR Jr.: An Update of the Phase III Trial Comparing Whole Pelvic to Prostate Only Radiotherapy and Neoadjuvant to Adjuvant Total Androgen Suppression: Updated Analysis of RTOG 9413, ... escalated treatment of the prostate [39,40] or with long term hormonal therapy [41] Nevertheless, data from this study indicate that the IMRT technique enables dose escalation to the prostate and ... increased by escalation of the dose to PTV-LAG (Table 7) Based on tolerance data I, higher treatment doses to the PTV-LAG increased the risk of small bowel toxicity, whereas no risk of small bowel...

12
386
0

Báo cáo y học: " Avian myeoloblastosis virus (AMV): only one side of the coin" ppsx

Ngày tải lên : 13/08/2014, 05:20

... that many of them ignored the molecular basis for AMV and MAV association and did not realize that AMV was not producing RT Although most of the data reviewed here has been published many years ... the MAV-1 and MAV-2 proviral genomes identified MAV-1 as the natural helper of AMV [16] and established that AMV derived from MAV [19] The AMV proviral genome that had also been cloned from peripheral ... with AMV and a helper virus [11] The AMV strains that are used and commercially available, are derived from the orignal BAI strain A purified from chicken leukemic plasma [12] Leukemic plasma containing...

5
221
0

Báo cáo y học: "The burden of sepsis-associated mortality in the United States from 1999 to 2005: an analysis of multiple-cause-of-death data" pptx

Ngày tải lên : 13/08/2014, 15:22

... vulnerable to sampling bias However, MCOD data has many limitations characteristic of other administrative datasets We cannot directly assess the accuracy of the data Misclassification of sepsis-related ... [20] The comparable rate ratio curves of blacks and American Indians/Alaska Natives indicate a similar early onset of vulnerability for sepsis-related death The occurrence of parallel patterns of ... stratified their analysis of sepsis according to race [4,18-20], there is a paucity of data on sepsis-associated mortality rates in Hispanics, American Indians/ Alaska Natives and Asians Earlier...

8
352
0

Báo cáo y học: "Feed the ICU patient ‘gastric’ first, and go post-pyloric only in case of failure" pptx

Ngày tải lên : 13/08/2014, 20:21

... Despite these problems, the authors conclude that ‘early post-pyloric feeding offers no advantage over early gastric feeding’: we agree that this is certainly true in the general ICU population, ... Berger and Soguel Critical Care 2010, 14:123 http://ccforum.com/content/14/1/123 prompted them to analyse patients adjusted for severity and to analyse by intent -to- treat due to the 14 patients ... fed according to random assignment (10 failures in tube placement and failures in gastric feeding) Not surprisingly, the nutritional efficiency differences in favour of the gastric route disappear...

2
188
0

Báo cáo y học: "Choosing the right path: enhancement of biologically relevant sets of genes or proteins using pathway structure" ppt

Ngày tải lên : 14/08/2014, 21:20

... section on a particular estimation of P-values and additional tables of results (Additional data file 1); a figure of the network of pathways in the KEGG pathway database [44] (Additional data file ... genes that participate in a pathway in the KEGG pathway database [44] The list of genes used is provided in Table S5 in Additional data file The SEPEA analysis was used to test whether there is an ... benefits of using pathway network information Additional results from analysis of these data with SEPEA_NT1, SEPEA_NT3, GSEA and maxmean are provided in Additional data file [path:xla03022] Basal transcription...

15
251
0

Luận văn thạc sĩ kĩ thuật viễn thông: Khám phá sự kiện thú vị trong phim chỉ sử dụng tín hiệu âm thanh Detection of interesting events in movies using only the audio signal

Ngày tải lên : 13/11/2014, 05:52

... step, the audio was saved as a *.aud file The next step is to strip the scale factors in audio file Scale factors in audio movie gave a clear sight about the audio amplitude because the scale factor ... and various kinds of environmental sounds, is an important type of media, and also a significant part of audiovisual data However, since there are more and more digital audio databases in place ... 12 samples from each of 32 subbands A group of 12 samples gets a bit-allocation and, if this is non-zero, a scalefactor Scalefactors are weights that scale groups of 12 samples such that they...

57
341
0

the list what the top fitness models don t want you to know

Ngày tải lên : 31/10/2016, 10:13

... breaking them down, as the content of the actual food Take the stairs! Avoid elevators throughout the day Take the stairs when you can The more you can increase your heart rate throughout the day, ... start first with the food in your stomach that you have just swallowed After that is digested and used, it will then start pulling from the glycogen stored in your muscles Basically, a sugar called ... successfully targeting the fat like it could The Best exercises for a great ass! It’s important to know that the exercises and machines that allow you to lift the greatest amount of weight are the same...

33
520
6