learning from practice gis as a tool in planning sustainable development natural and cultural heritage

Báo cáo khoa học: " Geographical Information System (GIS) as a Tool in Surveillance and Monitoring of Animal Diseases" potx

Ngày tải lên : 12/08/2014, 15:20

... string of such co-ordinates A polygon is a closed line The grid-based format of data is captured as information of each quadratic cell in a screen and could be looked at as a photo of the area GIS ... because this is not yet a standard tool in the available GIS- packages The visualisation of the disease rates on digital maps can be misleading because the eye tends to interpret point patterns as ... the case farm and all farms at risk within a speciﬁed area of the outbreak Buffer zones can be drawn around those farms as shown in Fig and with a link to tables of the addresses of the farms at...

7
341
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for ampliﬁcation of pyk The resulting PCR products, ... close to (Clas % and Clas % 0) as can be inferred from the primary data However, it is interesting that a slight reduction in las activity resulted in a very strong decrease in growth rate and glycolytic ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were ampliﬁed The PCR products...

12
616
0

Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf

Ngày tải lên : 20/02/2014, 23:20

... island and cell columns, is formed which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase ... (primer A and C, not shown) was abundantly present in JAr and Jeg3 cells while only negligible amounts became apparent in BeWo cells In parallel (using primers A and C) a faint 540 bp band (indicative ... IgG and ECL development [30] Reverse-transcriptase-polymerase chain reaction Total RNA from choriocarcinoma cell lines was isolated by using RNeasy kit (Qiagen, Vienna, Austria) Three micrograms...

12
470
0

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Ngày tải lên : 22/03/2014, 12:20

... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... different measures are shown in Table 7. Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... D.R. Tilley, H. Badrinarayanan, R. Rosati, and J. Son, Constructed wetlands as recirculation filters in large‐scale shrimp aquaculture, Aquacultural Engineering 26 (2002) 81. [12] T. L. Saaty, ...

13
487
0

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Ngày tải lên : 22/03/2014, 17:20

... hematopoietic compartment using a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral ... cell anemia carrying the human mutant variant of the b-globin gene (bS) that is responsible for the disease Fibroblasts from a diseased animal were reprogrammed into iPSCs, and the sickle cell anemia ... Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the ﬁeld of regenerative medicine...

12
550
0

báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt

Ngày tải lên : 20/06/2014, 15:20

... contextual and cultural coherence, several inventories designed to measure spirituality ask for specific and locally valid religious beliefs and practices (i.e church attendance and praying) and/ or assume ... statistical analysis and drafted the manuscript TO participated to conceive and design the study assisted in statistical analysis and helped to draft the manuscript PFM participated in the design and ... value in measuring SpR attitudes and engagement of patients coping with life-threatening illness, and in the measurement of distinct aspects of QoL An advantage of our instruments is the clear-cut...

11
425
0

Báo cáo khoa học: "Near infrared analysis as a tool for rapid screening of some major wood characteristics in a eucalyptus breeding program" ppsx

Ngày tải lên : 08/08/2014, 14:20

... in plant breeding), values of and upward are suitable for quality control analysis, and values of above are excellent, and can be used in any analytical situation RESULTS The RMS values obtained ... structures in lignins by cleavage of arylglycerol-β-aryl ether bonds As a single method, thioacidolyse has a definite advantage in that it may be used to characterize unambiguously typical and prominent ... (SEP) We thus obtained a calibration file containing 67 samples and a validation file containing 20 samples LK lignin contents and S/G ratio values for the validation samples were in line with the...

12
316
0

Báo cáo lâm nghiệp: "Diagnosing plant water status as a tool for quantifying water stress on a regional basis in Mediterranean drylands" pdf

Ngày tải lên : 09/08/2014, 04:20

... growing and water availability was likely high after winter rains Total precipitation during March, April and May 1998 at site H was about 130 mm and air temperatures were between 15 and 25 °C In ... performed in September 1998, with the aim of estimating the maximum annual impact of water stress in areas at different levels of landscape degradation a Istanbul Ankara Bursa Izmir Antalya Adana c ... recorded in O oleaster at sites H and D1 i.e between 89 and 92% In contrast, O oleaster plants growing in sites D2 and D3 had RWC’s as low as 70 to 72% A progressive decrease in RWC was recorded in...

13
292
0

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Ngày tải lên : 11/08/2014, 00:23

... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical ... published in the British Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...

3
381
0

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

Ngày tải lên : 11/08/2014, 11:21

... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... and animals [5] and is involved in multiple signal transduction pathways, which are fundamental for many intercellular and intracellular interactions [6,7] Calcium plays an essential role in pollen-pistil ... Trewavas AJ: Imaging and measurement of cytosolic free calcium in plant and fungal cells J Microsc 1992, 166:57-86 26 Webb AAR, McAinsh MR, Taylor JE, Hetherington AM: Calcium ions as intracellular...

12
529
0

Báo cáo y học: " Sputum neutrophils as a biomarker in COPD: findings from the ECLIPSE study" pdf

Ngày tải lên : 12/08/2014, 11:22

... interpretation, and drafted the manuscript LE was the lead for statistical analysis RT was involved in study design and data interpretation SR was involved in study design and data interpretation All authors ... measurements Bland Altman plots for sputum percentage and numbers/ ml at baseline and year are shown in Figure For percentages, the mean change was a 3.5% increase at year compared to baseline, with ... Screening and Year Mean of Screening and Year 60 40 20 -20 -40 -60 20 40 60 80 100 120 Mean of Screening and Year Figure Bland Altman plots of the mean measurements at baseline and year (x-axis) and...

12
379
0

Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

Ngày tải lên : 13/08/2014, 09:21

... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... combination of session and condition Each condition was measured in different sessions In simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and ... Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from...

8
304
0

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Ngày tải lên : 03/04/2013, 21:06

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... further investigation, since there are ambiguous results and evidence for and against on that matter Acknowledgements The authors thank practical trainees Linda van Mierlo and Pascalle Weijzen from...

10
599
1

Tài liệu Learning Networks as a Means for Work Organization Development pptx

Ngày tải lên : 24/01/2014, 00:20

... organization development which utilizes learning networks as a means for disseminating and generating knowledge of new practices, and examines opportunities for this approach in Finland by looking ... the paper examines learning networks as a model for interaction and cooperation at four different levels Towards a New Approach in Work Organization Development Bases for Innovation-Promoting ... Lohja Area Environmental Cluster), a vertical (The VAVE Network) and an infrastructure-creating network (The TEL LAPLAND Network) Case I – The Lohja Area Environmental Cluster The Lohja area is an...

17
441
0

Tài liệu Báo cáo khoa học: Bacterial-induced hepoxilin A3 secretion as a pro-inﬂammatory mediator pptx

Ngày tải lên : 19/02/2014, 02:20

... signal transduction cascade that recruits an ADP-ribosylation factor guanine nucleotide exchange factor (such as ARNO) to the apical plasma membrane ARNO facilitates ADP-ribosylation factor activation ... disease Because HXA3 may play an important step underlying the pathophysiology of in ammatory diseases, such as in ammatory bowel disease, the investigation of human 12-LOX genes at mucosal surfaces, ... Protein kinase Calpha-dependent increase in Ca2+-independent phospholipase A2 in membranes and arachidonic acid liberation in zymosan-stimulated macrophage-like P388D1 cells Biochem Pharmacol 63,...

6
524
0

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Ngày tải lên : 19/02/2014, 12:20

... measurements The VH domains in camelid heavy chain antibodies are most similar to the classical VH3 family and as such bind protein A with micromolar afﬁnity Furthermore, the protein A binding ... that can be rapidly explored using a phage selection Design of a heavy chain antibody scaffold A conceptually similar approach was employed by Bond et al in the design of a camelid heavy chain ... that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also discuss experiments addressing...

7
502
0

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Ngày tải lên : 21/02/2014, 03:20

... ﬁnal model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... Data analysis All spectra were treated with in- house software working in a MATLAB environment (MATLAB 6, Mathworks Inc., Natick, USA) Spectra were separated in a training set constituted of 48 samples ... including several areas in lipid and in nucleic acid regions, and one area associated with proteins (amide II) Training set spectra were used for model building in LDA The model was tested with...

6
555
0

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Ngày tải lên : 16/03/2014, 06:20

... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... the prodomain, the common naturally occurring A5 3V variation that has no signiﬁcant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia ... shots and masses were externally calibrated with All -in- 1 Protein Standards (Ciphergen Biosystems Inc.) All data were normalized for total ion current and peak areas calculated using the indirect...

14
454
0

microsimulation as a tool for the evaluation of public policies potx

Ngày tải lên : 19/03/2014, 00:20

359
408
0