... response inthe asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain inthe asthmatic airway during a DI is taken up by increased ... that, if healthy non-asthmatic, nonallergic subjects nothing more than to voluntarily refrain from DIs but otherwise maintain normal tidal volume, minute ventilation and functional residual capacity, ... cytoskeleton are surely important factors, but how they interact and details about underlying mechanisms remain unclear Muscle shortening velocity also seems to be an important factor [4,25,26] In addition,...
... population to maintain biodiversity; in others a laissez faire approach may lead to degradation It is undoubtedly the case that elephants feeding on plants may affect other species inthe same habitats ... natural habitat over vast areas, isolating and fragmenting the remaining patches More so in South Africa than in neighbouring African countries, protected areas are increasingly becoming islands ... is said that these authors state that population management is “nearly always avoidable…” The original reference said that culling is nearly always avoidable, and they discuss a range of other...
... diurnal changes in tree water storage depend on a relatively small pool of easily available water in extensible tissues, seasonal changes in water content are related tothe total amount of extractable ... dark is critical owing to uncertainties of thermoelectric methods in determining the zero line of sapflux, the values of E dark are reasonable in relation to estimations of easily available water ... during May Water uptake of trees during spring could be referred to refilling of storage capacities [54, 55] In spring after rainy days up to 20 April, initial sapflow started with increasing...
... are found in Area I and the fourth is Area IV The farms where scrapie has been diagnosed from the year 2000 (incl.) are located in Area II (16 farms), Area VI (11 farms) and in Area III (2 farms) ... in Table indicated that the median Fe concentration was 136 mg kg-1 in Area I and it was inthe range 171-217 mg kg-1 intheother areas The mean Fe concentration was significantly lower in Area ... units for classification into scrapie categories and are, therefore, the basic random units and repeated samples on a farm are subsampling Regional variations or trends within Areas are inthe model...
... interlaced with the another group of thread and formed lock stitch • One set of thread is called is needle thread and another set of thread is called bobbin thread Lockstitch utilizing a rotating ... 2nd stitch the needle and the sewing thread are inthe top position, preparing for next stitch • In this situation thread take up lever goes to its maximum position and fabric has advanced one ... threads through the fabric and reached to its lowest position • Again needle moves up a bit and stops for a while At that time thread take up lever also moves downwards and a loop is formed due to...
... South African Amateur Athletics Board SAAAC – South African Amateur Athletics Congress SAAAU – South African Amateur Athletics Union SAASA – South Africa Amateur Swimming Association SAASCO – ... evident that SAASU’s inancial and material involvement had ulterior motives After the staging of SANASA’s irst and second national championships, an attempt was made to ‘hijack’ SANASA by SAASU To get ... white SAASU ASASA had at that stage already initiated talks with SAASU; this was a tactical move in response tothe growing power of the NSC The NSC began taking a keen interest inthe process Although...
... for screening and imaging modalities A major challenge, however, is the availability of assays that are analytically and clinically valid and useful Other considerations include the availability ... Targeted Therapies in Current and Emerging Clinical Trials The standard treatment for EOC is conventional cytotoxic chemotherapy of platinum and taxanes, which has remained essentially unchanged ... synthesized information from the meeting, and facilitated inthe design and writing of the manuscript All authors read and approved the final manuscript Competing interests The authors declare...
... can be routed incorrectly into an interbay management panel In another example, proper cable Clearly defined cable routing paths routing reduces cable pile-up in troughs and raceways and enables ... an increased workload for reconfigurations and maintenance Meeting the challenge of increasing profits inthe face of fewer capital and operating resources to manage this steadily growing and ... is a design philosophy combined with highly functional products for terminating, patching, accessing, and managing cables Creating a foundation of connectivity for thephysicallayer facilitates...
... from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase expressing ... polyclonal anti-(b-galactosidase) Ig (ICN Pharmaceuticals inc., Costa Mesa, CA, USA) CA, USA) were performed according tothe Stratagene protocols Drosophila CK 2a and CK2btes recombinant proteins ... bound to protein -A Sepharose after washing Positions of CK2btes– b-galactosidase or b-galactosidase alone are indicated tothe right and show the results of precipitation Antibodies against CK2a...
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... oligomerization domain (i.e b sheets and 8, the AAA domain helix and the C-terminal helix) However, the majority of these proteins are likely to be other meiotic clade AAA ATPases and have the AAA domain helix ... sequence in modulating the function of the SRH The C-terminal region of human VPS4B contains the b domain (b strands and 8), the final helix of the AAA domain (a helix 10) and the C-terminal helix (a...
... activity in promoting quality of life in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access tothe data was granted by Statistics Canada based ... activity was specified as a mediator of this relationship The Pratt-Index (d) [25] was used to partition the R-square so as to determine the relative importance of the variables explaining the HUI3 ... estimates were compared to those based on full information maximum likelihood estimation (FIML) (available inthe Mplus 4.2 [30] software package) by using all available data to assess whether the...
... understanding of ADJECTIVES and PREPOSITIONS afraid of angry at aware of capable of careless about familiar with fond of happy about interested in jealous of made of married to proud of similar to ... would be a good idea to eliminate these words altogether, but we must be especially careful not to use them in formal, academic prose • She met up with the new coach inthe hallway • The book ... about think about trust in work for worry about A combination of verb and preposition is called a phrasal verb The word that is joined tothe verb is then called a particle Please refer tothe brief...
... times a week Inthe summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned tothe date of particular ... trees and herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate ... from the assessed stand, the amount of precipitation, air temperature and radiation were monitored inthe open area To evaluate phenological data for the characterized period, arithmetic mean, maximum...
... Several parts of the proofs are computer aided, both for searching the strong words (the main concept inthe proofs) as well as for checking their compatibilities We have included the Mathematica ... for the search of strong words We refer to Lothaire [6] for elementary definitions in combinatorics on words Let A = {a, b, c} be a ternary alphabet, and B = {0, 1} a binary alphabet For a binary ... 0100011001 Table 1: The first 30 short strong words Using Mathematica (version 7.01.0), one can calculate σ(w) and the ratio σ(w)/|w| using functions Sigma and SigmaRatio defined as Sigma[Str_]:= StringLength[Str]Length[StringPosition[Str,x...
... used to amplify full-length cDNAs: ACR9, 5’-TGTTGTT GATTCATTGGCTC-3’ and 5’-AGTAGTAGATGAATATATTG-3’; ACR10, 5’-ATAGGAGGAACAACACAAAC-3’ and 5’-TTACTATGAAACCCACACAG-3’; ACR11, 5’-AAAAGGATCCATGGCTATGGCCTCT ... Arabidopsis genomic DNA by PCR using the primers 5’-CACCTCTAGACACTCAAAAATCGGAATTAA-3’ and 5’-AACAAAG CTTATCTCTTGAGTCTGACTCAA-3’ The PCR product was cloned into the pCR2.1-TOPO vector (TOPO TA ... conceivable that the ACT domains of the ACR11 and ACR12 proteins may serve as amino acid binding domains Upon binding to specific amino acids, the ACR11 and ACR12 proteins may regulate the activities...
... TypA, LepA and EF-G share an additional three domains (Domains II, III and V) [39,40] EF-G contains a unique domain IV whereas LepA and TypA each have a unique C-terminal domain (CTD) The overall ... contains a unique domain, which might mediate factor specific interactions with the ribosome and facilitate different roles in translation Inthe case of SVR3/AtcpTypA, the C-terminal domain may ... putative chloroplast TypA translation elongation factor The translation product of SVR3 is predicted to contain 676 amino acids (~74.4 kDa), and it bears high similarity tothe E coli translation...
... large, the impact of jamming signal might be devastating because a jamming node could cause another node to send jamming signal While the work discussed above are able to mitigate the MAC unfairness ... gets the packet would set tothe same back-off value as inthe packet Another problem of BEB is the rapid change and large variation of back-off value To mitigate the oscillation of back-off value, ... capture Figure 3.1: Topologies that can result in link layer unfairness The arrows indicate the directions of the data flows, the bold lines indicate the captured links, and the dashed lines indicate...
... Language (SL) and Target Language (TL) Therefore, to transmit the meaning of these words into the TL ina comprehensive manner poses a challenging task for translators, particularly inthe audiovisual ... Universitat Autonoma de Barcelona, Spain, where I presented a conference paper entitled The Translators’ Subjectivity in News Translation: US President Obama in China and Taiwan as a Case Study” ... that pragmatic theory can provide inthe translator’s decision making process This model will take up a neutral and unbiased stance in evaluating and measuring different speech act effects of the...
... Functional-Notional Approach Inthe 1970s teachers of the Functional-Notional Approach stopped teaching grammar and started teaching more practical phrases and vocabulary for everyday life and social situations ... Approximately half the teachers surveyed have access toa cassette player at school, one quarter toa DVD/CD player and one-fifth toa computer Access to materials for preparing visual aids (cards, ... Students learn both by repeating thewords given to them and by making up their own wordsto fit the situation Example: The teacher asks students to play the role of A and B, ask and answer about their...
... VIET NAM NATIONAL UNIVERSITY, HANOI COLLEGE OF FOREIGN LANGUAGES POST GRADUATE STUDIES DEPARTMENT TRẦN QUỐC VIỆT A STUDY ON THE TECHNIQUES FOR THE IMPROVEMENT TOTHE TEACHING OF ORAL SKILLS IN LIGHT ... COMMUNICATIVE ENGLISH LANGUAGE TEACHING FOR JUNIOR HIGH SCHOOL TEACHERS IN QUẢNG NGÃI PROVINCE (NGHIÊN CỨU CÁC THỦ THUẬT NÂNG CAO VIỆC DẠY KỸ NĂNG NGHE NÓI TIẾNG ANH THEO ĐƯỜNG HƯỚNG GIAO TIẾP ... TIẾNG ANH THEO ĐƯỜNG HƯỚNG GIAO TIẾP CHO GIÁO VIÊN TRUNG HỌC CƠ SỞ TẠI TỈNH QUẢNG NGÃI) M .A. THESIS HA NOI-2007 ...