essay on a theory of judicial adjudication in the context of legal and constitutional pluralism

Word Grammar New Perspectives on a Theory of Language Structure. docx

Ngày tải lên : 27/06/2014, 16:20

... Summary and Conclusion Word Grammar Surface Structures and HPSG Order Domains Takafumi Maekawa Introduction A Word Grammar Approach An Approach in Constructional HPSG: Ginzburg and Sag 2000 A Linearization ... the Constructional HPSG approach, and the Linearization HPSG analysis Maekawa, a HPSG linguist, argues that the approaches within WG and the Constructional HPSG have some problems in dealing with ... place of the word, the idea that language is a network, the role of default inheritance, the clear separation of syntax and semantics, the integration of sentence and utterance structure The theory...

251
554
0

Báo cáo y học: " In vitro activities of novel 4-HPR derivatives on a panel of rhabdoid and other tumor cell lines" docx

Ngày tải lên : 13/08/2014, 18:21

... that facilitate combining radiotherapy and chemotherapy in a single agent In this study we examined the activity of 4-HPR derivatives that we synthesized in the laboratory and tested their activity ... diagnostic and therapeutic agents for RTs Additionally, the ability of the derivatives to significantly decrease the survival of glioma and breast cancer cell lines indicates that they may be of ... down-modulate Cyclin D1 at lower concentrations in MON cells showing that the chemical alterations made in the derivatives not alter their ability to inhibit Cyclin D1 Inhibition of glioma and breast...

32
337
0

Báo cáo khoa học: "A Theory of Parallelism and the Case of VP Ellipsis" pot

Ngày tải lên : 24/03/2014, 03:21

... addition to straightforward examples of parallelism like the above, there are also contrasts, exemplifications, and generalizations, which are defined in a similar manner The interpretation of a ... object the m a n ' s weight is acting on is the ladder, and hence that the man is on the ladder The third pair of arguments are both downward directions The final pair of arguments, x~ and x2, are ... Examples 2, and Because clauses and are VP-elliptical, we must establish a parallelism between each of Missing Readings with Multiple Pronouns them and clause In addition, the contrast relaDahl (1974)...

8
361
0

Báo cáo toán học: "A note on a problem of Hilliker and Straus" pps

Ngày tải lên : 07/08/2014, 15:22

... where A is such that every element of A + A has at least two representations, and B is an arbitrary subset of Zp The main result of this section can be stated as follows Theorem If A ⊆ Zp and ... ∈ A + A has at least two diﬀerent representations a + a , a, a ∈ A Finally, we give a lower bound for the size of a set A ⊆ Zp such that every element t ∈ A + A has at least K ≥ representations ... and, since the cardinality of T is at most l( |A| − 1) + 1, f (α, p) + = |A| ≥ ¯ log p + 1, l log 2k completing the proof of Theorem Since l ≤ k as an immediate consequence of Theorem we get the...

8
338
0

Báo cáo toán học: "On a Conjecture of Frankl and F¨redi u" doc

Ngày tải lên : 08/08/2014, 14:22

... discussions with Eva Czabarka, Ida Kantor, Gyula O.H Katona, Nathan Lemons, Bal´zs Patk´s, a o L´szl´ Sz´kely, and Jacques Verstra¨te The author thanks the NSF for funding her and a o e e IPAM for ... deﬁnitions see [10] Hence, we can view Conjecture 1.1 as a weakening of Stanton and Mullin’s conjecture Another weakening of Stanton and Mullin’s conjecture is Conjecture 1.5, which is due to Hall ... have a contradiction for k ≥ 10 since ǫ ≥ 1/3 For the remaining values of k, we refer the reader to the appendix We have shown that if F ⊂ X is a non-trivial 3-intersecting family of size m and...

16
223
0

Báo cáo y học: "Development of a theory of implementation and integration: Normalization Process Theory" ppsx

Ngày tải lên : 11/08/2014, 05:21

... an explanation of the form and significance of the causal and relational mechanisms at work in cases or classes of the phenomena defined by the theory, and should propose their relation to other ... that seek to explain how innovations are internalized; and theories of the relationships between individual attitudes and intentions and behavioural outcomes [11] The explanatory focus of the theory, ... merited formal testing This consisted of two main pieces of work, quantitative data analysis and research synthesis Qualitative data analysis We integrated the NPM in qualitative data analysis in three...

9
441
0

báo cáo khoa học: " Development of a theory of implementation and integration: Normalization Process Theory pdf

Ngày tải lên : 11/08/2014, 16:20

... an explanation of the form and significance of the causal and relational mechanisms at work in cases or classes of the phenomena defined by the theory, and should propose their relation to other ... that seek to explain how innovations are internalized; and theories of the relationships between individual attitudes and intentions and behavioural outcomes [11] The explanatory focus of the theory, ... merited formal testing This consisted of two main pieces of work, quantitative data analysis and research synthesis Qualitative data analysis We integrated the NPM in qualitative data analysis in three...

9
374
0

báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx

Ngày tải lên : 12/08/2014, 05:20

... with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), with capitals indicating ERS1 sequence and parentheses indicating T-DNA left border sequence This mutation was named ers1-3 ... insertion, and ETR1-3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5' CAAGCATCCATAACTCGATCCAAATTC 3') for amplification of a product 3' to the site of the T-DNA insertion After 25 cycles, the ... ethylene binding site, and a GAF domain of unknown function in their N-terminal halves [7-10] The subfamily receptors ETR1 and ERS1 have a highly conserved histidine kinase domain containing all the...

15
393
0

A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC

Ngày tải lên : 07/09/2013, 13:06

... Acquisition in classroom, it would look more into the contextual factors rather than the social and linguistic ones One contextual factor that has an influence on second language acquisition in classroom ... role in discipline and motivation maintenance 1.5 Definition of Second Language Acquisition Since the early childhood of second language teaching, language acquisition has been a subject of interest ... acquisition to explain second language acquisition Definitions of Second Language Acquisition are in a million, most of which refer to researches on the way that people can acquire another language...

41
886
12

Tài liệu A baseline study on psychosocial support of orphans and vulnerable children in two villages in Botswana docx

Ngày tải lên : 15/02/2014, 19:20

... is the main hub of economic activities The major economic activities in Palapye are mining and quarrying, manufacturing (including repair of machinery and equipment), construction, wholesale and ... had passed away over six years ago and eight reported that their father had passed away in the last 12 months No responses were obtained on the causes of death of fathers Background information ... Community (SADC) region (the University of Botswana and the Botswana Harvard Partnership in Botswana, the National Institute of Health Research, and the Biomedical Research & Training Institute’s...

60
464
0

Tài liệu THE THEORY OF MONEY AND CREDIT - New edition, enlarged with an essay on Monetary Reconstruction docx

Ngày tải lên : 16/02/2014, 03:20

... or of obtaining bread in exchange for clothes in the market From the point of view of the person making the valuation, the calculation whether a certain act of production would justify a certain ... general categories of the pure theory of value: and his emphasis in the course of this assimilation on the relation between uncertainty and the size of the cash holding and the dependence of certain ... from a definitive and unchangeable gold parity has made the value of money a plaything of politics To-day we see considerations of the value of money driving all other considerations into the background...

500
2.3K
0

Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Ngày tải lên : 18/02/2014, 00:20

... and other internationally applicable standards, including OSCE commitments E Conclusions and Recommendations The analysis of the data and information provided by the participating States on Internet ... findings based 1) on the review and presentation of major international legal provisions related to the subject; 2) on the examination and assessment of the efficiency, the advantages and disadvantages ... effectiveness of state laws, and lack of harmonization at the international level a number of states have started to block access to websites and social media platforms that allegedly contain illegal content...

238
2.7K
0

Information Contagion and Inter-Bank Correlation in a Theory of Systemic Risk potx

Ngày tải lên : 15/03/2014, 09:20

... and Mullineaux, 1987) as the formative reason for the commercial-bank clearinghouses in the U.S., and eventually for the Federal Reserve Chari and Jagannathan (1988), Jacklin and Bhattacharya ... Information Contagion and Inter-Bank Correlation in a Theory of Systemic Risk Abstract Two aspects of systemic risk, the risk that banks fail together, are modeled and their interaction examined: ... [15] Dasgupta, A (2000) “Financial Contagion through Capital Connections: A Model of the Origin and Spread of Banking Panics,” Working Paper, London School of Economics [16] De Bandt, O and P Hartmann...

49
401
0

ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot

Ngày tải lên : 15/03/2014, 16:20

... "weak sustainability") The index is normalized so that an index of one indicates that the increase in man-made capital is offset exactly by the depreciation of the nation's natural assets An index ... method Other sources of environmental degradation are valued based on the cost of preventing the degradation Data on standard national accounts come from the official national accounts of the United ... "weak" and "strong" sustainability Pearce suggests focusing on savings rates and argues that sustainability in the weak sense means that the value of savings must at least equal the depreciation...

58
698
0

A baseline study on psychosocial support of orphans and vulnerable children in two villages in Botswan doc

Ngày tải lên : 23/03/2014, 09:20

... is the main hub of economic activities The major economic activities in Palapye are mining and quarrying, manufacturing (including repair of machinery and equipment), construction, wholesale and ... had passed away over six years ago and eight reported that their father had passed away in the last 12 months No responses were obtained on the causes of death of fathers Background information ... Community (SADC) region (the University of Botswana and the Botswana Harvard Partnership in Botswana, the National Institute of Health Research, and the Biomedical Research & Training Institute’s...

60
440
0

An Essay Toward a History of Shakespeare in Norway doc

Ngày tải lên : 23/03/2014, 17:20

... entered into the soul of Macbeth and Lady Macbeth, of Antony and Cleopatra, of Coriolanus, and he has found underneath all that is weak and sinful and diseased, a certain nobility and grandeur He can ... its archaisms, Landsmaal is a living language and it has, therefore, unlike the Karathevusa of Greece, the possibility of growth The translations of Madhus and Aasen and Eggen have made notable ... Shakespeareana is a dull, unprofitable one a series of articles on the Baconian theory appearing irregularly in the monthly magazine, Kringsjaa The first article appeared in the second volume (1894) and is...

78
497
0

vital democracy a theory of democracy in action jun 2010

Ngày tải lên : 10/06/2014, 21:32

... must impose the same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Library of Congress Control Number ... local, national, and international, the vital juices are leaking away ’ And Jonathan – look at him scowling – has different ideas about it than you do, Harry, and Diana disagrees with Selma; ... of active expressions on the one hand and ideational foundations of democracy on the other – guides the in- depth analysis of the four models in the middle part of the book Finally, Part III draws...

256
307
0

a theory of virtue excellence in being for the good dec 2006

Ngày tải lên : 11/06/2014, 05:28

... this same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords Private ... choosing, and acting in relation to them as those that are approved by practical reason That is the point on which I am, as I said, skeptical The conception of practical reason or practical rationality ... can be said of the students in my graduate seminars on virtue at Yale in the spring of 2000 and the fall of 2001, and at Oxford in the fall of 2004 As the preceding narrative may suggest, the number...

264
227
0

Báo cáo toán học: "A short proof of a theorem of Kano and Yu on factors in regular graphs" pot

Ngày tải lên : 07/08/2014, 13:21

... containing e and a 1-factor avoiding e, then G has a k-factor containing e and a k-factor avoiding e for every k ∈ {1, 2, , r − 1} Proof Let F and Fe be two 1-factors of G containing e and ... has a 1-factor containing e and a 1-factor avoiding e According to Theorem 3, G has a k-factor containing e and a k-factor avoiding e for every k ∈ {1, 2, 3} However, Corollary by Kano and Yu does ... the edges ux, vx, wy, zy, three parallel edges between u and v, three parallel edges between w and z and two parallel edges e and e connecting x and y Then G is a 4-regular graph, and G has a...

2
320
0