ecg abnormality among residents in arseniasis endemic and non endemic areas of southwestern taiwan a study of gene gene and gene environment interactions

Báo cáo y học: "Genetic polymorphisms in PTPN22, PADI-4, and CTLA-4 and risk for rheumatoid arthritis in two longitudinal cohort studies: evidence of gene-environment interactions with heavy cigarette smoking" potx

Ngày tải lên : 09/08/2014, 10:23

... analysis and interpretation of data, manuscript preparation, and statistical analysis S-CC was responsible for analysis and interpretation of data, manuscript preparation, and statistical analysis ... IDV was responsible for analysis and interpretation of data, manuscript preparation, and statistical analysis RP was responsible for study design, analysis and interpretation of data, and manuscript ... Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: Functional haplotypes of PADI4, encoding...

12
336
0

báo cáo hóa học: " Correlations among improvements in urgency urinary incontinence, health-related quality of life, and perception of bladder-related problems in incontinent subjects with overactive bladder treated with tolterodine or placebo" docx

Ngày tải lên : 18/06/2014, 19:20

... interpretation of data, and the drafting and revising of the manuscript PvK was involved in collecting the data JTW conducted the data analysis All authors have read and approved the final manuscript ... were analyzed using ANCOVA with baseline value as a covariate Mean changes in KHQ scores from baseline to week 12 were analyzed for the current study using ANCOVA with baseline value as a covariate ... improvement Statistical analysis Median percentage changes in UUI episodes per week were analyzed using a rank analysis of covariance (ANCOVA) with baseline value as a covariate; mean changes in UUI...

6
466
0

Extreme Values in Finance, Telecommunications, and the Environment pptx

Ngày tải lên : 08/03/2014, 19:20

... Environment, Insurance, and Finance Richard L Smith University of North Carolina Contents 1.1 Motivating examples 1.1.1 Snowfall in North Carolina 1.1.2 Insurance risk of a large company 1.1.3 Value at ... Raleigh-Durham airport, sometime during the month of January, in any given year? A representative data set was compiled from the publicly available data base of the U.S National Climatic Data ... features are entirely typical of insurance data Further information about the data can be gained from Figure 1.1, which shows (a) a scatterplot of the individual claims against time note that claims...

397
3.6K
0

Comparision between background concentration of arsenic in urban and non urban areas of florida

Ngày tải lên : 15/03/2014, 23:22

... discernible in urban areas than in non- urban areas (Fig 2) There is a greater possibility of finding contaminated areas in urban environments due to greater human disturbance than in non- urban areas (Fig ... arsenic in soils from urban and non- urban areas In general, arsenic concentrations in urban areas were higher than those in non- urban areas Arsenic concentrations varied significantly with land-use ... Miami (ns240), and non- urban areas (ns448) in Florida centrations in non- urban areas surrounding the two cities and land-use categories analyzed within the two urban areas The distributions of...

10
650
0

Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

Ngày tải lên : 16/03/2014, 19:20

... Neuropathological hallmarks of HD at postmortem include dramatic loss of neurons and associated molecular markers in the striatum and cerebral cortex (although other brain areas can also be affected) and the ... After a decade of work, an international team identiﬁed the mutation causing HD: an expanded CAG repeat in the gene encoding a protein that came to be known as huntingtin [5] Normal individuals ... important in HD, AD and PD, but also in a range of other neurodegenerative disorders, including non- Alzheimer dementias, motor neuron disease and spinocerebellar ataxias Genetic and environmental...

15
504
0

Báo cáo khoa học: Functional role of fumarate site Glu59 involved in allosteric regulation and subunit–subunit interaction of human mitochondrial NAD(P)+-dependent malic enzyme pptx

Ngày tải lên : 23/03/2014, 06:20

... experiments were 5Â-GGACTTCTACCTCCCAAAATA GACACACAAGATATTCAAGCC-3Â for E59D, 5Â-GGAC TTCTACCTCCCAAAATACAGACACAAGATATTCAA GCC-3Â for E59Q, and 5Â-GGACTTCTACCTCCCAAAA TACTGACACAAGATATTCAAGCC-3Â for E59L ... human m-NAD-ME (A) Homotetramer of human m-NAD-ME (Proein Data Bank code: 1PJ3) (B) Fumaratebinding site of m-NAD-ME The corresponding amino acids in the fumarate-binding site, Arg67, Arg91 and ... that Arg67 and Arg91 are the ligands for fumarate binding The side chains of Arg91 and Arg67 form salt bridges with the carboxylate group of fumarate (Fig 1B) Site-directed mutagenesis and kinetic...

12
360
0

Light in Engineering, Architecture and the Environment pdf

Ngày tải lên : 30/03/2014, 04:21

... standard and dynamic scenario (Relux data) Standard Scenario Calculation algorithm used Height of evaluation surface Height of luminaire plane Maintenance factor Total luminous flux of all lamps ... selected area was calculated, analyzed and finally, the proposed street lighting plan is suggested Results and analysis 4.1 Space syntax analysis An axial map of an old urban area of Jesi was produced ... Bertram The University of New South USA Spain A Aldama IMTA, Mexico C Alessandri Universita di Ferrara, Italy D Almorza Gomar University of Cadiz, Spain B Alzahabi Kettering University, USA J A...

273
425
1

Light in Engineering, Architecture and the Environment pot

Ngày tải lên : 28/06/2014, 17:20

... standard and dynamic scenario (Relux data) Standard Scenario Calculation algorithm used Height of evaluation surface Height of luminaire plane Maintenance factor Total luminous flux of all lamps ... selected area was calculated, analyzed and finally, the proposed street lighting plan is suggested Results and analysis 4.1 Space syntax analysis An axial map of an old urban area of Jesi was produced ... Bertram The University of New South USA Spain A Aldama IMTA, Mexico C Alessandri Universita di Ferrara, Italy D Almorza Gomar University of Cadiz, Spain B Alzahabi Kettering University, USA J A...

273
317
0

Coordinated movement of multiple robots in an unknown and cluttered environment

Ngày tải lên : 03/10/2015, 21:57

... while maintaining in groups that have no leaders or hierarchy, in order words, these groups display the attribute of homogeneity Matari et al (2003), Yamashita and Asama (2003) Gerkey and Matari ... organize and coordinate among themselves that results in the amazing efficiency in their search for food (Camazine et al, 2001; Bonabeau and Théraulaz, 2000; Sudd, 1987) Camazine et al (2001) has ... the information they have retrieve A good example of manifestation of such a system can be found in a colony of ants that is searching and collecting their food 26 (Camazine et al, 2001; Bonabeau...

129
99
0

báo cáo khoa học: " Simulating gene-environment interactions in complex human diseases" pdf

Ngày tải lên : 11/08/2014, 12:20

... and (d) an additive model Each curve represents the relationship between disease risk (y-axis) and an environmental factor (x-axis) for individuals with a particular genotype (AA, Aa or aa) at ... multiple genetic and environmental factors, the number of epidemioogical features of the disease and individual l genetic and environmental factors will be far less than the number of model parameters ... Sucheston L, Zhang A, Brazeau D, Freudenheim JL, Ambrosone C, Ramanathan M: AMBIENCE: a novel approach and efficient algorithm for identifying informative genetic and environmental associations with...

4
156
0

Báo cáo y học: " A model of gene-gene and gene-environment interactions and its implications for targeting environmental " doc

Ngày tải lên : 13/08/2014, 16:21

... and family studies and data on the importance of environmental factors in determining a trait However, analysis of twin data is usually limited by the assumptions made in the classical twin study ... Mrelge may be written as: Additional File Gene- gene and gene- environment interaction model Contains the Visual Basic macro (Twincal), input and output datasheets and charts used to calculate the ... indicates that the risk of lung cancer is dominated by smoking in this population and the variance has at most a small genetic component Unlike the breast cancer example, γmax and γmin are always...

24
603
0

Domestic Water Pollution among Local Communities in Nigeria ----Causes and Consequences pot

Ngày tải lên : 06/03/2014, 23:20

... runoff, and leachate from irrigated lands may transport sediment, nutrients, salts, and other materials Finally, improper grazing practices in riparian, as well as upland areas, can also cause ... equipment harm and kill aquatic life and animals and cause health problems when they get into drinking water Bacteria and parasites from animal waste can get into drinking water which can cause illness ... lack of adequate sewage and waste disposal make many localities, potential health hazard areas for their inhabitants Sanitary and sewage systems are poor, and where they exist, poorly managed...

12
497
0

Inconsistent fertility motivations and contraceptive use behaviors among women in Honduras ppt

Ngày tải lên : 14/03/2014, 16:20

... manuscript JB participated in data coding, analysis, and writing JL participated in data collection and contributed to paper development All authors read and approved the final manuscript 17 Acknowledgements ... from a panel study that examined contraceptive continuation among users of reversible female contraceptive methods in four major urban areas of Honduras: Tegucigalpa, San Pedro Sula, Santa Rosa ... problem, a small problem, or a big problem, this study permits a greater understanding of motivations to avoid a pregnancy among users and non- users of contraception Finally, an additional strength of...

10
364
0

Deprivation and vulnerability among elderly in India potx

Ngày tải lên : 22/03/2014, 13:20

... Chhattisgarh Gujarat Haryana Himachal Pradesh Jammu &Kashmir Jharkand Karnataka Kerala Madhya Pradesh Maharashtra Orrissa Punjab Rajasthan Tamil Nadu Uttar Pradesh Uttaranchal West Bengal India RURAL ... by Indian States, 2004 RURAL MALE Andhra Pradesh Assam Bihar Chhattisgarh Gujarat Haryana Himachal Pradesh Jammu &Kashmir Jharkhand Karnataka Kerala Madhya Pradesh Maharashtra Orrissa Punjab Rajasthan ... Pradesh Assam Bihar Chhattisgarh Gujarat Haryana Himachal Pradesh Jammu &Kashmir Jharkhand Karnataka Kerala Madhya Pradesh Maharashtra orrissa punjab Rajasthan Tamil Nadu Uttar Pradesh West Bengal India...

40
445
0

Good Health to All: Reducing Health Inequalities among Children in High- and Low-Income Canadian Families potx

Ngày tải lên : 24/03/2014, 00:20

... that the health inequalities among children in high- and low-income families remain constant as they age, and that parents’ health status plays an important and independent role in explaining ... reduce overlap and duplication among government programs, and it includes both cash and in- kind transfers – see Table Ottawa has taken the lead in financing the program, while the provinces are responsible ... health of both infant to develop or and mother and enhance programs encourage breastfeeding for vulnerable pregnant women At-risk pregnant women and infants In- kind NA NA NA – Information not available...

24
380
0

The impact of fodder trees on milk production and income among smallholder dairy farmers in East Africa and the role of research ppt

Ngày tải lên : 24/03/2014, 04:20

... amounts and a squared term (a quadratic specification); (c) a combination of a binary variable and actual amount; and (d) a combination of a binary variable, the actual amount and a squared term Qualitatively, ... has not been as significant as that of calliandra In Rwanda, calliandra and Leucaena diversifolia, also an exotic, are the most common species In Uganda, these same two species and sesbania are ... day) and a daily supplement (2 kg fresh) of one of the following fodder trees: Mimoca scabrella, Chamaecytisus palmensis, Alnus acuminate, Acacia koa, Acacia Koaia, Acacia melanoxylon, Acacia...

55
546
0

báo cáo sinh học:" Burnout and training satisfaction of medical residents in Greece: will the European Work Time Directive make a difference?" pot

Ngày tải lên : 18/06/2014, 17:20

... competing interests Authors' contributions PM and NCK conceived and coordinated the study and drafted the paper; PM carried out the mathematical analysis; AT, DK, NS, NP and ET collected data and assisted ... Papathanasiou M, Mariolis-Sapsakos T, Marayiannis K, Koutsilieris M: Evaluation of a clinical attachment in Primary Health Care as a component of undergraduate medical education Medical teacher 2008, ... subscales (Spearman rank correlations, KruskalWallis one-way analyses of variance and Mann-Whitney U tests, all P-values > 0.05) Due to Greek hospitals varying in specialties for residency training...

11
380
0

báo cáo hóa học: " Primary Sjögren''''s Syndrome: health experiences and predictors of health quality among patients in the United States" potx

Ngày tải lên : 18/06/2014, 18:20

... PROFAD-SSI domains Figure among of fatigue and and severity Ratings of fatigue and sicca severity on PROFAD-SSI domains among PhysR patients and controls Morbidity related to sicca symptoms was ... dryness and vaginal dryness, all ts > 12.0, all ps < 0.001 Similar data was obtained using the summary PROF, PROFAD and SSI indices Principal component analysis was used to investigate the internal ... European Consensus Criteria for diagnosis gave highly similar information in almost every category including rates of ocular and oral complications, key extra-glandular features such as Raynaud's,...

9
566
0

báo cáo hóa học: " Enterprise size and risk of hospital treated injuries among manual construction workers in Denmark: a study protocol" potx

Ngày tải lên : 20/06/2014, 00:20

... “Craft and related trades workers"; group “Plant and machinery operators and assemblers”, and group “Elementary occupations” OHR-data of each injured individual will be linked to the latest national ... Features - workplace injuries in small and large manufacturing workplaces - an analysis of the risks of fatal and nonfatal injuries, including figures for 1994/5-1995/6 Labour market trends 1999, ... have fewer financial, human and technological resources available for organization and management of safety and health precautions Economic survival and economic competition concerns quite often...

6
361
0

báo cáo hóa học:" A Population-Based and Longitudinal Study of Sexual Behavior and Multidrug-Resistant HIV Among Patients in Clinical Care" pdf

Ngày tải lên : 20/06/2014, 08:20

... unprotected sexual behavior and events: unprotected vaginal, anal, and oral sexual events Methods For the purposes of this study, sexual behavior was defined as penile-vaginal and penile-anal intercourse ... prescribed ARVs at the outset of the study A total of 919 matched data points consisting of both behavioral and virologic data were available Seventyeight patients contributed matched behavioral and ... Rietmeijer C, Douglas J, McCartin C: HIV transmission risk among patients enrolled in a large clinical trial evaluating treatment interruption Program and abstracts of the XV International AIDS Conference;...

8
432
0