... initiative (such as a patient safety taxonomy and data aggregation tool), make certain that all consumers ofthe information understand what they are reading and how to use the information The ... designation from the Insurance Institute of America She is a past president ofthe American Society for Healthcare Risk Management and a member ofthe Maryland Society for Healthcare Risk Management ... of Betsy Lehman was emblematic of this approach In the aftermath ofa catastrophic medication error at Dana Farber Cancer Institute, detailed evaluations were conducted by JCAHO and the Massachusetts...
... mouse cells, mouse Apo B was amplified using the primers 5' CACGTGGGCTCCAGCATT 3'and 5' TCACCAGTCATTTCTGCCTTTG 3' and the TaqMan hydrolysis probe 5'(FAM) CCAATGGTCGGGCACTGCTCAATA (TAMRA) 3' (courtesy ... neo amplification from non-nucleofected U2OS cells Nuclear DNA was harvested and amplified from separate samples, error bars indicate the standard deviation from the average of triplicate samples ... nuclear DNA was isolated from the nuclear fraction ofcell lysates and PCR amplified using neo primers and a neo-specific TaqMan probe The total number of plasmid neo copies was calculated based...
... picture ofa square array of rectangular holes of side ax and a y perforated on a free-standing metallic film of thickness h Parameter d defines the period ofthe array The apertures are illuminated ... microspheres), the optical propertiesof metamaterials made with stacked hole arrays and the guiding of metallic waveguides (and their focusing capabilities when tapered) These systems are thoroughly analyzed ... of Zaragoza, Spain 123 Author Dr Sergio G Rodrigo Departamento de Física de la Materia Condensada Instituto de Ciencia de Materiales de Aragón Universidad de Zaragoza 50009 Zaragoza Spain e-mail:...
... , , otherwise The meaning ofthe existence of tB (i) is similar as in Remark 2.3 Proof of Theorem 1.2 We start with an outline ofthe proof First, we redefine the sequence B by adding k to all ... graphs, o Publications ofthe Math Inst ofthe Hungarian Academy of Sci Ser A (1962), 441–456 [2] P Erd˝s, Problems and results in combinatorial analysis, Combinatorics (Proc Symp o Pure Math., ... some ofthe estimates made above Observe that our main “tool” was the fact that for any l there are integers m ∈ N and i ∈ {0, , k − 1} such that ni (m) ≤ l < ni+1 (m), and consequently that...
... On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may ... ensure that bioassays include animal based, cellular and biochemical systemsA model of vasculogenesis in a SCID mouse was presented as an example Conclusion The potential antiproliferative and immunodulatory ... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation...
... bacteriological laboratory, so far as the glass apparatus is concerned, differs but little from that ofa chemical laboratory, and the cleanliness ofthe apparatus is equally important The glassware comprised ... 21).—These are used forthe collection and analysis ofthe gases liberated from the media during the growth of some varieties of bacteria and may be either plain (a) or graduated (b) A simple form ... Hot air (for the sterilisation of all glassware and of metal apparatus) (b) Moist Heat: Water at 56° C (for the sterilisation of certain albuminous fluids) Water at 100° C (for the sterilisation...
... longer than twice the diameter ofthecell bodies appear within a day, and maximal response is reached in days For direct comparison, the amount of responsiveness was evaluated for all factors at 48 ... (even at high concentrations) alone were able to activate the MAPK pathway MAP kinases and STAT3 are rapidly activated within 10 in response to Hyper-CNTF, the phase of activation lasting for at ... virtually the same concentration as LIF and Hyper-IL-6 needed to achieve half-maximal activity The signaling events of stimulated BAF/3 cells reflected by the activation pattern of STAT3 and MAP...
... as a substrate for localization ofthe labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... that in ovary at stage 1, and remained at a similar value to stage Testes at stage were not analyzed because ofa lack of samples We calculated the amount of zinc bound to MYP in the gonad by multiplying ... on a shaker at °C, the solutions were withdrawn from each cellThe zinc concentration ofthe solutions was measured by ICP-AES The data were analyzed using prism software (GraphPad Software, San...
... on any task, no matter how tedious And finally, the talented team of Donna Nalley and Tracy Hamilton at the SERVE office in Tallahassee did a fantastic job of making the Help! Kit as accurate and ... rural areas of their native countries or the U.S and often have a marginal level of education because they had to begin working at a young age and/or schools were unavailable The vast majority of ... information.) The family is essentially patriarchal, at least to outward appearances The roles of males and females are clearly defined—males are seen as the breadwinners, decision-makers, and...
... remained roughly constant (Table 1) At the same time, the profitability of Italian banks has soared; that of German banks has dropped (Figure 1) The Italian Privatization of Savings Banks1 3.1 The ... and 2002 shows that the savings banks outperformed all other bank groups The performance ofthe cooperative banks was also above average In contrast, the mean ROE at the largest commercial banks ... legally separating the banking business from social or cultural activities These foundations maintained the public mandate ofthe savings banks, such as the advancement ofthe local economy These...
... Linux, and it’s stable and easy to manage Red Hat’s effort shows to particular advantage in the work they’ve done integrating Xen Red Hat has taken Xen and done a fair amount of work to make it a ... Xen offers some advantages to both the system administrator and the home user Xen is a piece of software that enables one machine to behave as if it were many virtual machines Each of these machines ... Preliminary results in “Xen and the Art of Virtualization”—one ofthe seminal Xen papers— indicated performance degradation of less than percent fora standard workload and between 10 and 20 percent...
... ventilation may be required ANALYTICAL BALANCES Analytical balances are among the prima donnas ofthe laboratory, requiring separate and unequal treatment They refuse to cooperate if there is the ... was installed against a wall and the hot air was drawn off overhead The heat radiating from 12 flasks and heaters, however, made the workers on the other side ofthe narrow room very uncomfortable ... scale drawing ofthe laboratory area Fora building in the planning stages, the architect's drawing can be used For an ex- Laboratory Layout 19 isting building, any drawing already available should...
... see the image ofthe galaxy as it was 100 years ago.” The pattern is A B, B–C, C–D The AB/BC rule also works on the mid-scale, with paragraphs In fact, the rule is just another way of making transitions ... Meetings are the most efficient way to connect with a lot of sources The biggest, at least forthe diversity of topics offered, is the annual meeting ofthe American Association forthe Advancement of ... Usually, full tables of contents are also available, as well as full text ofthe articles Nature has its own press access Web portal The American Physical Society offers an open Web page that alerts...
... localized at the surface of Si like a thin film As a result, LRA stage gradually transits to SLA stage The second stage, SLA, is characterized by formation of nanocones on the irradiated surface ofa ... experiment All ofthe authors participated to the analysis ofthe data and wrote the article AMy carried out the sample preparation, the measurements for solid solutions of CdZnTe PO carried out the sample ... nanocavities [17] At the second stage ofthe process, nanocones are formed on the irradiated surface ofthe semiconductors due to plastic deformation ofthe top layer in the same way as in the...
... with the domain, they may not have an accurate first-hand understanding ofthe content Hence, the keywords and meta-data tags appended by the knowledge librarian may be inappropriate and as a result ... conducted in the offices ofthe managers and, in most cases, the managers arranged fora demonstration ofthe system so that we could see the features ofthe KMS implementation The length ofthe interviews ... instance, may not be appropriate For example, with traditional systems, the domain data is structured into a conceptual schema that is translated into a data model The resulting data model rarely...
... observed as a significant change in the electrical resistance depending on whether the magnetization of adjacent ferromagnetic layers are in a parallel or an antiparallel alignment Normally, the overall ... function ofthe number of carbon atoms in the chain The inset shows amount of transferred charge per carbon atom as a function ofthe length ofthe chain in the chain Both of them show an oscillatory ... with Na = 3p + (Na is the number of carbon dimers of AGNR, p is integer) show the smallest gap compared to the other two families The bandgap calculated based on GW approximation shows the same...
... Cao Y, Xiao R, and Cao T Establishment of Autologous Feeders for Human Embryonic Stem Cells Propagation 2nd Meeting of IADR Pan Asian Pacific Federation (PAPF) and the 1st Meeting of IADR Asia/Pacific ... types of human body Therefore, study ofthe cellular and molecular propertiesof hESCs provides information in the culture, differentiation and applications of hESCs A review ofthe current signaling ... research (2) ESCs can differentiate into virtually all thecell types ofthe body, providing a valuable tool for differentiation and generation of broader range ofcell types than other stem cells...
... (McFarlan & Nolan, 1995) assumed a strategic alliance to be the result of an outsourcing arrangement, and argued that the ongoing management of an alliance was the single most important aspect of ... one ofthe ways that “measure the degree to which a capability can be easily communicated and understood.”, and found that the 33 more codifiable and teachable a capability, the high the risk of ... Zahra and George’s article (2002) proposed a reconceptualization of absorptive capacity that contains dimensions/capabilities, which are: acquisition, assimilation, transformation and exploitation...
... fragments and acetyl groups are removed forming acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating ... such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release glucoronic acids, acetyl xylan esterases that hydrolyze acetylester bonds, ferulic acid ... crystallinity of wheat straw cellulose makes it a good substrate for enzymatic saccharification [25] as well as a suitable host polymer for preparation of cellulose derivatives [28] In epidermis cell...