characterizing biomedical concept relationships concept relationships as a pathway for knowledge creation and discovery

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Ngày tải lên : 03/04/2013, 21:06

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than...

10
599
1

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Ngày tải lên : 22/03/2014, 17:20

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the ﬁeld of regenerative medicine...

12
550
0

Báo cáo y học: "The Mammalian Phenotype Ontology as a tool for annotating, analyzing and comparing phenotypic information" potx

Ngày tải lên : 14/08/2014, 14:21

... vascular defects abnormal vasculature o abnormal vascular dilation noted at E8.5 o vascular dilation was associated with an increased endothelial proliferation rate o in addition to the dilation, ... [14] In addition, MGD has adopted the Mouse Embryo Anatomy Nomenclature Database [15] and the Anatomical Dictionary for the Adult Mouse [16] for annotating data that include anatomical attributes, ... serves as the authoritative source for the names and symbols associated with mouse genes, alleles and strains The advantage of applying such nomenclatures has been increasingly recognized as genomes...

9
264
0

broadband as a platform for economic, social and cultural development - lessons from asia - bb as a platform, oecd, 19 nov

Ngày tải lên : 21/08/2014, 15:25

... broadband’s impact was delayed compared with Asia, and the evidence relates to the early years of the 2000s, before the higher speeds and lower prices for broadband became widely available and ... Telecommunication Indicators Database and AT&T 10 Broadband 2002 2007 2008 DRAFT Broadband and economic growth The example of China catching up with the United States, and of other developing Asian nations prospering ... a wider range of devices, and as machines and objects rather than humans become the main users, then broadband will give birth to a wide range of devices and applications, as yet unimagined Again,...

16
269
0

Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

Ngày tải lên : 18/10/2013, 12:15

... the organizational boundaries, leading to increased innovative partnerships and alliances (Nonaka and Takeuchi, 1995) If organizations are to systematically disseminate new knowledge to achieve ... OF A KNOWLEDGE MANAGEMENT AND INNOVATION MODEL As a means of summary, the different aspects of innovation in regard to knowledge management, as discussed in the literature and the research, can ... 1998 Knowledge, creativity and innovation Journal of Knowledge Management 2: 1, 5±13 Handy C 1989 The Age of Unreason HBR Press: Boston, MA Knowledge Management as a Catalyst for Innovation RESEARCH...

9
498
2

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Ngày tải lên : 18/10/2013, 18:15

... Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, and the data rate ... Network Load Balancing provides a greater benefit than round robin DNS entries because Network Load Balancing automatically excludes servers that are unavailable You can enhance the availability for ... scenario and answer the questions Be prepared to discuss your answers with the class Scenario A legal firm specializes in patent and copyright law At each geographic location, legal assistants within...

62
359
0

Module 8: Routing as a Solution for Private Network Connectivity

Ngày tải lên : 18/10/2013, 18:15

... of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... is easier to manage and the router platform can handle the existing traffic RRARTR3 Between Subnets F and H Reason for placing router Specify a static route entry that forwards e-mail messages ... demanddial interfaces Demand-dial authentication can use any authentication protocol supported by Routing and Remote Access, and can be performed by using oneway or two-way authentication One-Way...

50
371
0

Module 10: RADIUS as a Solution for Remote Access

Ngày tải lên : 22/10/2013, 16:15

... with RADSVR1 and RADSVR2 Specify VPN ports for remote access Authenticate RADIUS clients and servers, and encrypt all data Specify RADSVR1 and RADSRV2 for authentication and accounting Allow ... certificates Note As a best practice, specify RADIUS secrets that are at least 16 characters in length and that include upper case letters, lowercase letters, and punctuation 26 Module 10: RADIUS as ... engineers use a Web-based application for maintenance tracking and reporting Customers can place maintenance requests by using another Webbased application that either creates a maintenance request...

50
442
0

Social factors as a basis for treatment

Ngày tải lên : 01/11/2013, 09:20

... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... therefore, which clubhouse elements are effective and which standards are necessary for success 175 Social factors as a basis for treatment Conclusion Social factors can affect the course and ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported...

16
524
0

A contrastive analysis of encouraging as a speech act in english and vietnamese

Ngày tải lên : 26/11/2013, 13:31

... English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, the Vietnamese ... native speakers of English and native speakers of Vietnamese for encouraging as a speech act - To suggest solutions for the English teaching and learning of communication in a foreign language ... in non- targetlike fashion For example, they have a thorough grasp of grammar to form interrogative as a questioning strategy However, they not have the sociopragmatic knowledge to assess when...

13
1.6K
8

Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Ngày tải lên : 21/12/2013, 05:18

... information or explanation on optimizing IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header ... masks and how IP devices determine the portions of an IP address that are used for routing and host addressing • Explain the manual allocation, DHCP manual, DHCP dynamic, and Automatic Private ... used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask Classes with variable length subnet masks (VLSM) Classless Inter-Domain Routing (CIDR) with a specified...

58
439
0

Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Ngày tải lên : 17/01/2014, 08:20

... Client an IP address and configuration information to enable IP communication The DHCP Server maintains a database that includes available and allocated IP addresses for defined subnets and the ... network traffic and IP address release As lease length Network traffic IP addresses release Increases decreases later Decreases increases sooner Note To immediately reclaim DHCP resources, you can configure ... routers for DHCP and BOOTP forwarding A mission-critical Web-based application available on a 24-hours -a- day, 7days -a- week scale No provisions exist for ensuring high availability Isolation of...

48
394
0

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Ngày tải lên : 17/01/2014, 08:20

... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... create the subdomain for WINS under the private namespace For organizations that have the same namespace for private and public name resolution, create the subdomain for WINS at a level beneath ... use as a placeholder for the WINS names Specify that the subdomain contains no entries, except for the WINS and WINS-R records For organizations that have a separate private and public namespace,...

60
373
0

Tài liệu Learning Networks as a Means for Work Organization Development pptx

Ngày tải lên : 24/01/2014, 00:20

... communities are ready and willing to expand their role in an area in which they are forced in a constant search for a satisfying balance between their own scientific norms and standards and the expectations ... innovations from Japan”, Organization Studies, Vol 16, No 6, pp 971-989 Nahapiet, J and Ghoshal, S (1998), “Social capital, intellectual capital and the organizational advantage”, Academy of Management ... purchases and more reliable deliveries The core company has a special VAVE team and each supplier company has a VAVE coordinator External support for the Network’s discussions, training and development...

17
441
0

Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

Ngày tải lên : 24/01/2014, 10:20

... Release, Register, Renew, Release, and Query by Unicast and Query by Unicast traffic then use Lmhosts traffic then use Lmhosts and Broadcasts and Broadcasts WINS Server Unicast reduces broadcasts ... database replication As the length of time for synchronizing redundant WINS databases increases, the probability increases that a WINS server failure will result in the use of an outdated database ... redundancy and load balancing When you use replication, all servers contain the same WINS database information Timely WINS Database Replication Highly available WINS implementation designs call for timely...

45
407
0

Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

Ngày tải lên : 24/01/2014, 10:20

... Introducing NAT Designing a Functional NAT Solution Securing a NAT Solution Enhancing a NAT Design for Availability and Performance An organization has a number of sales representatives that work ... application and an inventory control application The applications are Active Directory– aware applications that store the data for the applications in a SQL Server 7.0 database How could you use NAT ... Routing and Remote Access IP Filters Routing and Remote Access filters restrict traffic at International Organization for Standardization (ISO) layer two and affect all IP traffic received by a NAT...

34
308
0

Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

Ngày tải lên : 13/02/2014, 16:20

... Chair/BNA Mercury Nashville MCA Nashville MCA Nashville Columbia Nashville Warner Bros Jason Aldean Dierks Bentley Alan Jackson Justin Moore Brad Paisley Rascal Flatts Keith Urban Brad Paisley Zac ... a content analysis of the lyrics contained in a sample of representative art songs and opera aria dating back as far as 1597 Arias are usually a melodic segment set within the context of a larger ... Band Brad Paisley Capitol Nashville/Broken Bow Dangling Rope/Capitol Records Nashville Arista Nashville/EMI Nashville Valory Music Group Arista Nashville Lyric Street Capitol Nashville Arista...

27
315
0

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Ngày tải lên : 19/02/2014, 12:20

... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... individual proteins in a pool of folded variants In addition, a rapid method for quantitatively, and simultaneously, characterizing a large number of mutants would greatly aid in understanding...

7
502
0

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Ngày tải lên : 21/02/2014, 03:20

... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training ... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass...

6
555
0

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Ngày tải lên : 06/03/2014, 09:22

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... tat, rev and nef mRNAs [9], which are transported to the cytoplasm for translation of the Tat, Rev and Nef proteins (Fig 2) All the tat mRNAs are spliced at site A3 The rev mRNAs are spliced at ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeﬁciency...

10
434
0