arf1 despite not being a direct hit in our screen arf1 scored close to the threshold a follow up experiment involving rnai mediated knock down of arf1 co

Host viral interactions host factors in coronavirus replication and coronaviral strategies of immune evasion

Ngày tải lên : 09/09/2015, 10:07

... approximately 150-180kDa S protein contains a large N terminal ectodomain, followed by a transmembrane domain and finally a short C terminal endodomain Post-translational cleavage of the ectodomain ... genera: alpha-, beta-, and gammacoronavirus [2] Order Family Sub-family Genus Alphacoronavirus Coronavirinae Betacoronavirus Torovirinae Gammacoronavirus Coronaviridae Nidovirales Arteriviridae ... implicated in coronavirus replication, many others are novel cofactors that have yet to be characterized Among the cellular host factors identified, the role of valosin containing protein (VCP) in...

220
328
0

Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf

Ngày tải lên : 08/03/2014, 10:20

... Fig Binding of the two conserved domains in Ba and PR72 to the A subunit of PP 2A Fragments of rat Ba and human PR72 encompassing ASBD and were tested for binding to GST and GST -A by incubation ... conserved A subunit-binding domains (ASBD and ASBD 2) in human B5 6a, rat Ba, and human PR72, highlighted in gray information for further elucidating the structural basis of interactions in the PP 2A holoenzyme ... due to a high level of nonspeci®c adsorption of the B5 6a polypeptides to the beads, and suboptimal binding in the absence of cotranslation of the A and C subunits The smallest N-terminal fragment...

7
550
0

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

Ngày tải lên : 22/03/2014, 10:20

... Laboratory evaluation included liver biochemistries (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... physical examination, and a complete laboratory evaluation were performed in all patients at the time of first medical evaluation in our institution and repeated at regular intervals thereafter Laboratory...

7
487
0

Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx

Ngày tải lên : 19/06/2014, 08:20

... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon responding to 1763–1770 nt of the complete ... reading frame, changing K130N and introducing an iso- Many efforts have been made in order to clarify the role of viral variants in the pathogenesis of HBV infection; and still there is no final...

10
438
0

báo cáo hóa học:" HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" pdf

Ngày tải lên : 20/06/2014, 04:20

... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon responding to 1763–1770 nt of the complete ... reading frame, changing K130N and introducing an iso- Many efforts have been made in order to clarify the role of viral variants in the pathogenesis of HBV infection; and still there is no final...

10
359
0

báo cáo hóa học:" Impact of recent life events on the health related quality of life of adolescents and youths: the role of gender and life events typologies in a follow-up study" potx

Ngày tải lên : 20/06/2014, 16:20

... to a critical Page of revision of the manuscript and made a substantial contribution to its content, and read and approved the final manuscript Competing interests The authors declare that they ... participated in the conception and design of the study EVO, SRF, GV and JAPV analyzed the data EVO, JMV, MH, MF, LR and JA participated in the drafting of the article All authors contributed to ... 840 of 926 participants at baseline; 91%) Data collection at follow- up took place years after baseline, a period which was considered a sufficient interval to allow for substantive changes in participants’...

9
583
0

Báo cáo khoa học: "Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients a follow-up study" ppsx

Ngày tải lên : 09/08/2014, 09:20

... grading, common toxicity criteria of the US National Cancer Institute) during and after radiotherapy have been classified according to the following scale: grade 0: no skin reaction, grade 1: small ... plot analysis of t(Ba) frequencies in patient groups ordered according to temporal occurence of any side effects of the skin during the period of radiation therapy Box area, 50% of data [lines in ... acquisition and interpretation of data; he has been involved in drafting the manuscript and has contributed to the final version to be published HB has made substantial contributions to the conception and...

8
405
0

báo cáo khoa học: "Long-term follow-up after en bloc resection and reconstruction of a solitary paraganglioma metastasis in the first lumbar vertebral body: a case report" ppt

Ngày tải lên : 11/08/2014, 00:22

... demonstrated a thinly encapsulated neoplasm The diagnosis of a paraganglioma was confirmed by histologic and immunohistologic examinations Because vascular invasion and focal infiltration of the ... pathology The postoperative course was again completely uneventful Page of Because of the marginal resection and the poor response to preoperative chemotherapy, postoperative radiation therapy was added ... retroperitoneal space Paragangliomas arising from carotid bodies appear to have the highest propensity for metastatic spread to the spine [1] The retroperitoneal extra-adrenal paraganglioma is the...

6
323
0

Báo cáo y học: " Change in quality of life and their predictors in the long-term follow-up after group cognitive behavioral therapy for social anxiety disorder: a prospective cohort study" pptx

Ngày tải lên : 11/08/2014, 16:22

... a a a a a a a a a Generalized SAD -0.22* a a a a a a -0.28* a a a a a a a a a a a a a a a a Benzodiazepine use 0.23* a a a a a a a a a a a a a a a a a a a a a a a SPS (total) a a a a a a a a a ... Age: 35 yrs or older a a a a a a 0.41* a a a a a a a a a a a a a a a a a Living situation a a a a -0.32** a a a a a a a a a a a a a a a a a a a Employment a a a a a a a a a a a a -0.30* a a a ... 0.39* a 0.29* a a a a a a a a a 0.49** a a SIAS (total) SCL-90-R depression a a a a a -0.44** a a a a a a a a a a a a a -0.64** a a a a a a a a a -0.46** a a a a a a a a a a a a -0.32* -0.41* a -0.61**...

10
388
0

Báo cáo y học: " Use of dietary supplements in Olympic athletes is decreasing: a follow-up study between 2002 and 2009" doc

Ngày tải lên : 11/08/2014, 23:21

... categorized into subgroups for further analysis The categorization was identical to a Canadian study concerning elite athlete’s medication and dietary supplement use in Atlanta and Sydney Olympic games ... authors reviewed and contributed to the final manuscript All authors have read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: ... statistical analyses carried out was done with adjusting for age In our survey, athletes were asked to name all dietary supplements, all vitamins, minerals and herbal and homeopathic preparations...

8
238
0

Báo cáo y học: "Bone mineral density in partially recovered early onset anorexic patients - a follow-up investigation" docx

Ngày tải lên : 13/08/2014, 18:21

... small sample of anorexic adult patients, Baker et al [55] showed that behavioral factors such as vomiting, nicotine and alcohol intake also may predict a reduction of BMD Amenorrhea in this patient ... also in a subset of patients who maintain menses despite low weight [81] The individual healing process in anorexia nervosa requires a certain sustainability of (behavioral and psychopathological) ... overall physical assessment Laboratory tests In addition to the physical examination, we carried out a laboratory assessment using commercially available tests for the blood count, electrolyte balance,...

11
358
0

Báo cáo y học: "The influence of behavioural and health problems on alcohol and drug use in late adolescence - a follow up study of 2 399 young Norwegians" pptx

Ngày tải lên : 13/08/2014, 18:21

... often Factor analyses revealed two factors with eigenvalue >1 “Having trouble concentrating in class” and “Can not manage to be calm in class” indicating attention problems, and “Arguing with the ... to gender and their drinking status at the entry of the study (Table 3) Girls in the early intoxication group accounted for the major part of the association of early behaviour and health problems ... baseline The variables then were fitted separately in series of univariate models all corrected for age Table Distribution and prevalence of early alcohol intoxication and behavioural and health...

9
343
0

The case for rentierism as a cause forunderdevelopment in malaysia tourism planning from mahathir to the present day

Ngày tải lên : 26/09/2015, 12:48

... ‘marked a Malay coming of age.’80 The Mahathir Years Baker describes Mahathir as having been 'in tune with the younger ascendant capitalist Malays and being 'in the vanguard of a group that was ... By the late 90s Malaysia had joined Thailand and Indonesia in what was considered the second wave of dramatic Asian growth The three countries appeared to be following the success of the Asian ... Malaysiakini’s involvement as follows Eight years ago, the few of us as Malaysiakini set about doing an unenviable task Along the way, we gave Tun Dr Mahathir Mohamad a pain in the neck We gave...

256
556
0

Applying task based approach in teaching english grammar to the 1st year non english majors at ho chi minh university of industry, nghe an branch luận văn thạc sĩ giáo dục học

Ngày tải lên : 18/12/2013, 10:29

... of Grammar There have been various ways of defining grammar - a very common and familiar term in language teaching and learning According to Luu Quy Khuong (2006), in the old days, grammar was ... to serve the aforesaid aims, the research attempts to answer the following questions: What is the reality of the application of the task-based approach in teaching English grammar at HUI? What ... language teaching is teaching learners to communicate fluently, appropriately and spontaneously in the cultural context of the target language Communicative competence, according to Canale and Swain...

100
1.4K
6

Tài liệu Restorative Techniques in Paediatric Dentistry: An Illustrated Guide to the Restoration of Carious Primary Teeth pptx

Ngày tải lên : 16/02/2014, 15:20

147
426
0

Conservative and Aesthetic Emergency Management in Adolescent with Complex Crown-Root Fracture and Simultaneous Oblique Root Fracture in Upper Maxillary Central Incisor: Clinical Outcome after 18 Months Follow-up Period docx

Ngày tải lên : 23/03/2014, 13:20

... 1989) In addition to the immediate consequences after a CRF to the upper maxillary incisors, such as pain and bleeding, delayed complications like alteration in physical and aesthetic appearance, ... quirúrgica ni ortodóncica del fragmento radicular debido a la presencia de fractura radicular oblicua intra-alveolar sin desplazamiento El manejo clínico conservador y de mínima invasión es fundamentado ... principalmente por la alta capacidad de de cicatrización pulpar en dientes permanentes jóvenes, la ausencia de desplazamiento entre los fragmentos de la fractura radicular, y la alta capacidad...

11
423
1

Báo cáo y học: "Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature" ppt

Ngày tải lên : 11/08/2014, 00:23

... of vitamin D Page of appear to be the main causes of osteomalacia [4,5] The occurrence of osteomalacia can also be related to varying degrees of vegetarianism Lacto-vegetarians (vegetarian diet ... sedimentation rate and an auto-antibody screen were all normal Plain film radiography and isotope bone scans showed no abnormality As in the first case, a diagnosis of osteomalacia was made based ... of therapy his serum calcium level, alkaline phosphatase and PTH levels started to normalize and he was able to walk unaided Case The second case is of a 34-year-old woman from India living in...

3
285
0

Báo cáo y học: "The long-term prediction of return to work following serious accidental injuries: A follow up study" docx

Ngày tải lên : 11/08/2014, 15:22

... significance of the primary and secondary appraisal of a stressful situation In the primary appraisal the situation can be judged as harmful, as a threat or as a challenge The same situation can be appraised ... more are generally considered severely injured The Glasgow Coma Scale [15] is an observer-rated scale for the clinical appraisal of the gravity of coma after injury to the skull and brain Patients ... injury, factors not related to the accidental injury gained influence These results are in line with Lazarus’ theories on stress, appraisal and coping [13,23] Lazarus emphasized the significance...

7
299
0

báo cáo khoa học:" A ‘short walk’ is longer before radiotherapy than afterwards: a qualitative study questioning the baseline and follow-up design" potx

Ngày tải lên : 12/08/2014, 01:21

... were conducted on the day the patient had an appointment at the simulator to plan Table Cognitive process models of Tourangeau et al and Rapkin & Schwartz Tourangeau et al - survey answering model ... (a redefinition of the target construct), change in sampling strategy and combinatory algorithm to reprioritization (a change in individual’s values), and change in standards of comparison to ... remained, we labelled the comparison of the content of a cognitive process over time as similar We adopted this conservative approach to protect against a possible negative bias Again, all findings...

12
230
0

Báo cáo y học: "B cell depletion in diffuse progressive systemic sclerosis: safety, skin score modification and IL-6 modulation in an up to thirty-six months follow-up open-label trial" docx

Ngày tải lên : 12/08/2014, 12:20

10
291
0