a joint driver vehicle environment simulation platform for the development and accelerated testing of automotive assistance and automation systems

Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

Ngày tải lên : 14/08/2014, 16:21
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
  • 11
  • 467
  • 0
Báo cáo hóa học: " Research Article Synthetic Stimuli for the Steady-State Verification of Modulation-Based Noise Reduction Systems" docx

Báo cáo hóa học: " Research Article Synthetic Stimuli for the Steady-State Verification of Modulation-Based Noise Reduction Systems" docx

Ngày tải lên : 21/06/2014, 22:20
... similar to the human ear canal Here, we used a so-called 2cc-coupler A digital playback and recording system can play MATLAB-created stimuli via a digital-to-analogue converter (D /A) and the loudspeaker ... which median and averaging operations work, we here propose sorting a certain set of gain values within the subband of interest by their magnitude and then averaging those values that remain after ... signal [12] based on synthetic speech is available for verification of transfer characteristics of telephony equipment In that case, again the speech performance of the system under test is of major...
  • 8
  • 415
  • 0
báo cáo khoa học: " Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.)" pptx

báo cáo khoa học: " Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.)" pptx

Ngày tải lên : 11/08/2014, 11:21
... variability viz., Irano-Afghanistan-USSR region, Palestine-SW Asia, India-China and the Arabian Peninsula, each with its own specific plant characteristics [43] It is an Page of 10 acceptable ... annealing temperature as 60°C, and the optimal primer length as 20 bp PCR primers were developed and an M13 forward (GGAAACAGCTATGACCAT) was added to the 5’ end of one of each primer pair using OliGO ... using genomic DNA as templates among castor bean, Jatropha curcas and Speranskia cantonensis.doc Additional file 2: Table S2: Validation and characterization of polymorphic SSR markers derived...
  • 10
  • 466
  • 0
Tài liệu Practical mod_perl-CHAPTER 8:Choosing a Platform for the Best Performance docx

Tài liệu Practical mod_perl-CHAPTER 8:Choosing a Platform for the Best Performance docx

Ngày tải lên : 26/01/2014, 07:20
... (RAID) An array of physical disks, usually treated by the operating system as one single disk, and often forced to appear that way by the hardware The reason for using RAID is often simply to achieve ... dispatch the requests to the machine that was taken down Load balancing Say that users are given the name of one of your machines, but it cannot stand the heavy load You can use a clustering approach ... probably access it by telnet or ssh most of the time anyway Look for hard disks with the best price/performance ratio Of course, ask around and avoid disks that have a reputation for headcrashes...
  • 10
  • 337
  • 0
Báo cáo y học: "FlyGEM, a full transcriptome array platform for the Drosophila community" docx

Báo cáo y học: "FlyGEM, a full transcriptome array platform for the Drosophila community" docx

Ngày tải lên : 09/08/2014, 20:21
... wide access to both affordable arrays and array data is essential for the Drosophila community A limited number of aliquots of the FlyGEM primers have been made available to regional, national and ... be made as easy as possible Like scientific literature and DNA sequences, the true value of array data is not fully realized until data are available from stable public databases These data should ... variables that could adversely influence the quality of the data generated on the FlyGEM Broadly classified, these would fall into the areas of array design, fabrication, sample handling and...
  • 11
  • 364
  • 0
báo cáo khoa học: " A Viral Platform for Chemical Modification and Multivalent Display" pdf

báo cáo khoa học: " A Viral Platform for Chemical Modification and Multivalent Display" pdf

Ngày tải lên : 11/08/2014, 00:22
... views of a portion of the surface of the viral particle showing the exposure of threonine15 and the pattern of its display Two views of a portion of the surface of the viral particle showing the ... threonine15) are located in the so-called AB-loop, a short β-turn that connects the A and B β-strands of coat protein The other two (aspartic acid114 and glycine115) reside in a loop connecting the two ... producing of wild-type fractions each A Agarose A Agarose gel electrophoresis of the soluble fractions of lysates of E coli cells producing the wild-type (WT) and each of the mutant coat proteins (lanes...
  • 8
  • 326
  • 0
Báo cáo y học: "MetaReg: a platform for modeling, analysis and visualization of biological systems using large-scale experimental data" pptx

Báo cáo y học: "MetaReg: a platform for modeling, analysis and visualization of biological systems using large-scale experimental data" pptx

Ngày tải lên : 14/08/2014, 08:20
... performed the analysis and co-wrote the paper RS conceived and supervised the study and co-wrote the paper Additional data files The following additional data are available with the online version of ... component states, assuming that the system is in steady state Clearly these crucial assumptions are a simplification of the Genome Programming language: Java for the envelope and C++ for the algorithms ... profiles, the experimental treatments under which they were obtained and the data preprocessing, is available in Additional data file Evaluation of the model in accordance with data We applied the...
  • 11
  • 380
  • 0
broadband as a platform for economic, social and cultural development - lessons from asia - bb as a platform, oecd, 19 nov

broadband as a platform for economic, social and cultural development - lessons from asia - bb as a platform, oecd, 19 nov

Ngày tải lên : 21/08/2014, 15:25
... Telecommunication Indicators Database and AT&T 10 Broadband 2002 2007 2008 DRAFT Broadband and economic growth The example of China catching up with the United States, and of other developing Asian nations prospering ... broadband focus on what it is not rather than what it is For instance, broadband is NOT narrowband, in that there is general consensus on the low-end cut-off speed for broadband as offering a ... future, as broadband capability becomes embedded in a wider range of devices, and as machines and objects rather than humans become the main users, then broadband will give birth to a wide range of...
  • 16
  • 269
  • 0
Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant

Ngày tải lên : 01/08/2016, 09:29
... mass flows) and the gasifying air temperature at the inlet of the reactor (changing the opening of the bypass valve of the air preheater) As stated above, the thermodynamic data of each stream ... fan), the thermal power of each heat exchanger, the aperture of the control valve of the air preheater The comparison of the experimental data and the results of the simulations, that have been ... internal surface of the refractory layer of the gasifier (K/W) equivalent thermal resistance of the radiative heat exchange between the cover surface of the external thermal insulation of the gasifier...
  • 12
  • 221
  • 0
A STUDY ON GROUPWORKS  a TECHNIQUE USED IN TEACHING SPEAKING SKILL FOR THE 2ND –YEAR ENGLISH MAJOR STUDENTS AT HPU

A STUDY ON GROUPWORKS a TECHNIQUE USED IN TEACHING SPEAKING SKILL FOR THE 2ND –YEAR ENGLISH MAJOR STUDENTS AT HPU

Ngày tải lên : 11/12/2013, 23:51
... grammar, lexis, and style 2.2 The Importance of Teaching Speaking Many students equate being able to speak a language as knowing the language and therefore view learning the language as learning ... preferences and enables a teacher to collect a large amount of information relatively quickly” Another advantage of this tool is that the collected data are relatively easy to summarize and report as all ... Analysis of the research There, the analysis of the research uses the descriptive analysis Based on this method there has some advantages and weakness Some of the advantages of using teaching speaking...
  • 97
  • 1.2K
  • 4
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

Ngày tải lên : 03/01/2014, 19:44
... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... therefore in this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...
  • 8
  • 517
  • 1
Tài liệu Analysing different technology pathways for the pulp and paper industry in a European energy systems perspective doc

Tài liệu Analysing different technology pathways for the pulp and paper industry in a European energy systems perspective doc

Ngày tải lên : 22/02/2014, 09:20
... VII and IX the majority of the papers, Papers I-III, V, VII and IX, are based on data for a model mill depicting a typical Scandinavian kraft pulp mill Paper IV, on the other hand, is based ... market parameters are varied separately, often called onefactor-at -a- time analysis Such an approach can be a suitable, simple, option for an analysis where the varied factors are independent of ... on kraft pulp as a basis for the comparison Thus, the energy and wood raw material use for paper based on kraft pulp is set to (100%) and the energy and wood raw material use for paper based...
  • 124
  • 648
  • 0
Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot

Ngày tải lên : 05/03/2014, 14:20
... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... evaluation and a strategic university planning For the implementation, a Web-based DSS is based on ISO 9000 factors for the evaluation and strategic planning for a case study of Vietnam National ... International Organization for Standardization for Quality Management and Quality Assurance [2,7] The ISO 9000 series cover a broad scope of quality system elements and consist of five standards:...
  • 12
  • 541
  • 0
Ethical Journalism A Handbook of Values and Practices for the News and Editorial Departments pdf

Ethical Journalism A Handbook of Values and Practices for the News and Editorial Departments pdf

Ngày tải lên : 06/03/2014, 11:20
... careful about the use of their names and that of the newspaper in materials promoting the appearances As a courtesy, they should let their department head know about their plans to appear 102 ... axiomatic standards of behavior governing our dealing with colleagues and going about our work The Rules are available from the office of the associate managing editor for news administration Together ... Normally they are also free to take advantage of conventional corporate discounts that the Times Company has offered to share with all employees (for example, corporate car rental rates) And staff...
  • 57
  • 942
  • 0
Every Woman Matters: A Report on Accessing Primary Health Care for Black Women and Women of Colour in Ontario pptx

Every Woman Matters: A Report on Accessing Primary Health Care for Black Women and Women of Colour in Ontario pptx

Ngày tải lên : 14/03/2014, 12:20
... African Caribbean, African Canadian and other women of African ancestry The term “Women of Colour” refers to South Asian or Latin American women and women of South Asian or Latin American ancestry ... Facilitators of Health Care Access Barriers and Facilitators for Homeless and Underhoused Women Barriers and Facilitators for Women Living with Physical Disability Barriers and Facilitators for Lesbian and ... Heritage Canada, The Health Quality Council, Interagency Coalition on AIDS and Development, Public Health Agency of Canada, The Community Health Centre Non-insured Task Force and The Canadian Women’s...
  • 90
  • 502
  • 0
Caring for the Elderly and Holding Down a Job: How Are Women Coping in Japan? potx

Caring for the Elderly and Holding Down a Job: How Are Women Coping in Japan? potx

Ngày tải lên : 14/03/2014, 20:20
... has a signifi- and income; whether the household is have no difficulty in performing any of cant effect on a married daughter or in a rural or urban area; and whether the 14 activities of daily ... as a parent ter or daughter-in-law’s participation in younger woman, the health status of grows older may be based on a general the work force, but mainly when these the elderly person, and all ... work force altogether cost of hospitalization, some of which cy measures to curb the escalating costs And finally, the tradition that mar- falls on the family of medical care for the elderly New...
  • 4
  • 452
  • 0
Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf

Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf

Ngày tải lên : 17/03/2014, 00:20
... Japanese, and it is impossible to list all the candidates Our analysis shows that beyond the 10th candidate, almost all the probabilities of the candidates in both steps drop below 0.01 Therefore ... generate top-10 results for both steps to approximate the Equation 3.3 P (Aj |S) (3) j=1 The meaning of this formula is that the probability of all the remaining candidates is smaller than the ... overturn the top candidate The mathematical proof is provided in Appendix A The stop condition here has no approximation nor pre-defined assumption, and it is a no-loss fast decoding algorithm Rapid development...
  • 6
  • 419
  • 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt

Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt

Ngày tải lên : 24/03/2014, 05:21
... approach to the problem is to store in a data base a list of all the declined forms for every lemma of the language, as well as their morphologic, syntactic and semantic characteristics The size of ... is the name of the "class of endings" associated with every lemma A class of endings is the set of all the endings related to a given class of words For example, each of the regular verbs of the ... structured as tables of a relational data base l the morphologic and semantic characteristics of the word, but not its syntactic cathegory: for example, the easa (house) can be altered in casina (little...
  • 6
  • 378
  • 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Ngày tải lên : 31/03/2014, 23:20
... residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity reaction ... a- sarcin against ribosomes might differ in some details from that against dinucleotides [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of ... at 220 nm in the range of 25 –85 8C; the temperature was continuously changed at a rate of 0.5 8C:min21 The temperature values at the midpoint of the thermal transition (Tm) were calculated assuming...
  • 7
  • 434
  • 0
solutions for the development of bank marketing towards individual customers in vietnam prosperity joint stock commercial bank vpbank

solutions for the development of bank marketing towards individual customers in vietnam prosperity joint stock commercial bank vpbank

Ngày tải lên : 23/04/2014, 16:41
... Banking  Academy   LIST OF ABBREVIATIONS ACB Asia Commercial Bank Agribank Vietnam Bank for Agriculture and Rural Development Eximbank Vietnam Export Import Commercial Joint Stock Bank ATM Automated ... collection and analysis of numerical data and statistics To find an appropriate strategy for VPBank, the thesis will also analyze competitive advantages using SWOT model Data is collected from secondary ... website is an effective tool to meet the information needs of the customer at any time and anywhere The interface and layout of the website are logically arranged and attractive with the VPBank’s...
  • 59
  • 846
  • 2

Xem thêm