a black sheep in the second first family the legend of noah and his sons

báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx

Ngày tải lên : 21/06/2014, 20:20

... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diﬀusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications,...

16
438
0

a basic course in the theory of interest and derivatives markets

Ngày tải lên : 05/11/2014, 13:29

... rate of interest in is the ratio of the amount of interest earned during the period to the amount of principal invested at the beginning of the period Note that i1 = i = a( 1) − and for any accumulation ... not used in calculations for the following periods In this case, the amount value A, the principal P, the period of investment t, and the annual interest rate i are related by the formula A = P ... $100 into a savings account paying 6% simple interest for years Peter deposits $100 now with the same bank and at the same simple interest rate At the end of the year, he withdraws his balance and...

745
1K
0

Báo cáo khoa học: "A longitudinal study on the occurrence of Cryptosporidium and Giardia in dogs during their first year of life" docx

Ngày tải lên : 12/08/2014, 18:22

... and Giardia in dogs related to average age All samples from individual dogs Intensity of infectiona Intensity of infectiona Giardia Number of samples Average age (days) Dual infections Giarda ... with a calibrated eyepiece graticule to ensure that they were within the size range given for Cryptosporidium and Giardia A portion of the original faecal sample was also examined by a standard ... oocysts per gram when grams of faecal material are examined Statistical analyses Statistical tests included χ2 and Fishers' Exact test for analyzing × contingency tables, odds ratio calculations, ttest...

10
507
1

Focus - A simplicity manifesto in the Age of Distraction

Ngày tải lên : 05/01/2014, 15:25

... struggles we face these days, from being productive and achieving our goals, to getting healthy and fit in the face of fast food and inactivity, to finding simplicity and peace amidst chaos and confusion ... as they are now Ringing phones are one thing, but email notifications, Twitter and Facebook messages, an array of browser tabs open, and mobile devices that are always on and always beeping are ... an email or chatting In fact, it’s almost impossible to these things and create at the same time Sure, you can switch back and forth, so that you’re creating and engaging in any of these activities...

121
552
1

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Ngày tải lên : 14/02/2014, 19:20

... Department of Biotechnology (Govt of India) for partial ﬁnancial support The authors thank Dinesh Kumar for recording the scanning electron micrographs and Shivcharan Prasad and Pinakin Makwana for ... line) and 200 lM ( , dashed line) of neurotoxins • 100 lm At this concentration, MPP+ showed only a marginal increase in the lag time for aggregation of a- synuclein, as observed in this case At ... urea Effect of dopamine on MPTP and MPP+ induced changes in kinetics of the aggregation of a- synuclein a- Synuclein was incubated in the presence of 100 lm MPTP, along with 50 lm dopamine Aliquots...

11
754
0

Báo cáo "Developing a bilateral input-output table in the case of Thailand and Vietnam: Methodology and applications " doc

Ngày tải lên : 22/03/2014, 13:20

... particular industry In essence, there are two types of linkages, namely, backward linkages and forward linkages A backward linkage is a measure of the relative importance of an industry as a ... and the remaining 18.9% by Vietnam’s final demand Of the total labor income of US$57.2 billion, 70.1% was induced by Thailand’s final demand and 29.9% by Vietnam’s final demand, while 89.9% of ... generated in both economies was induced by Thailand’s final demand and the remaining 25.4% was induced by Vietnam’s final demand The above findings intuitively suggest that, comparatively, Vietnam’s...

13
562
0

Research " A DISERTATION SUMMITTED TO THE SCHOOL OF EDUCAITON AND THE COMITEE ON GRADUATE STUDIES OF STANFORD IN PARTIAL FUFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY " doc

Ngày tải lên : 23/03/2014, 05:22

159
484
0

Báo cáo khoa học: Predicting the substrate speciﬁcity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Ngày tải lên : 28/03/2014, 23:20

... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...

11
661
0

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Ngày tải lên : 30/03/2014, 04:20

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...

13
344
0

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Ngày tải lên : 31/03/2014, 01:20

... containing 0.01% H2O2 (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The ... was added as indicated in Fig and the cells incubated further for h after which the cell supernatant was taken for cytokine assay Incubation of the cells with IFN-c alone did not change TNF -a ... identiﬁcation After drying the plates, lipids were lightly stained with I2 vapor and their positions marked Once the I2 had evaporated, individual lipid bands were scraped into scintillation vials and...

7
322
0

a systematic review of the research literature on the use of phonics in the teaching of reading and spelling

Ngày tải lên : 02/06/2014, 09:22

... as calculated by the reviewers (mean of word recognition and word attack measures; also mean of comprehension measures, mean of spelling measures, and synthetic versus analytic, where applicable), ...  Table 3: Details of instructional time and of instruction received by the intervention groups, cont Author, date Information about what other literacy instruction participants were receiving, ...  Table 2: Quality assessment of the included RCTs Author, date Reporting of method of allocation  Sample size justification  Intention to teach analysis  Blinded assessment of outcome...

85
570
0

Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

Ngày tải lên : 07/08/2014, 03:22

... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... The earlier beginning of this stage can be explained by the fast onset of high spring temperatures in 2006 and by very mild winter and extraordinarily warm spring in 2007 The beginning of leaf ... Minďáš 1998; Škvarenina et al 2006) European larch The budbreak of larch in the stand was noted first the 89th day in 2007 at the sum of temperatures above 5°C 24.1°C and at the sum of temperatures...

12
386
0

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

Ngày tải lên : 09/08/2014, 01:23

... can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in animal models and initial data ... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research ... factors at various stages of disease, and thus may serve as a sophisticated tool with which to study the relevance of individual chemokines and chemokine receptors in vivo Despite the availability...

5
460
0

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

Ngày tải lên : 09/08/2014, 01:24

... had a follow up of more than 36 months There were 59 infiltrating ductal carcinomas (not otherwise specified and variants) and infiltrating lobular carcinomas The infiltrating ductal carcinoma ... carcinomas [9] But the labelling index of cyclin D1 correlated with the pathological stage of the disease in invasive lobular carcinomas but not in invasive ductal carcinomas Another study evaluated ... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association...

9
423
0

Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx

Ngày tải lên : 09/08/2014, 06:22

... destruction Although a number of molecular pathways have been identified that contribute to the stable activation of RASFs, the precise cause and nature of this activation, as well as its relevance and ... research on the interaction of RA-IgG and RASFs as well as other recent data, however, may change the picture It has been reported by Huizinga and colleagues that in a cohort of patients with ... consequences, are matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and...

3
222
0

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Ngày tải lên : 09/08/2014, 08:22

... weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was ... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... Veterinary Sciences, Adelaide and the University of Adelaide Animal work and handling were complied with the National Health and Research Council (Australia) Code of Practice for Animal Care in...

8
335
0

Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps

Ngày tải lên : 09/08/2014, 10:20

... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal ... statistical analysis and writing of the manuscript SN is responsible for the physical aspects of IMRT planning and treatment of the children HB is responsible for the anaesthesia management of ... years ago as part of multimodality treatment of an acute lymphoblastic leukaemia About four years later he presented with an anaplastic astrocytoma and therefore received external beam radiation...

10
523
0

Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

Ngày tải lên : 09/08/2014, 10:20

... FAM – AGG GGT CCT GGC TGC CTT CCT CTT C – TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA ... for each passage, and cumulative population doublings were calculated At each passage, an aliquot of approximately × 106 cells was taken for analysis of MTL, and regression analysis and Spearman ... areas: the NP, inner AF (IAF), and outer AF (OAF) Regions situated at the junction of IAF and OAF or of NP and IAF were not included in the analysis Within each area, five fields of view were analysed...

12
617
0

báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

Ngày tải lên : 09/08/2014, 22:22

... as against cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of ... 100 fetal calf serum, p 100 phytohemaglutinin M (Difco), 100 LU of penicillin and 100 mg/ml of streptomycin The metaphases were conventionally stained in Giemsa and 15 analysed for each animal III ... of the segregational patterns of germ cells in chimeric cattle have concerned with the possibility or otherwise of the survival and function of germ cells in the gonads of bulls and freemartin...

5
319
0

báo cáo khoa học: "Comparison of determinants of research knowledge utilization by practitioners and administrators in the field of child and family social services" pptx

Ngày tải lên : 10/08/2014, 10:22

... collaboration in child and family welfare is far more recent than in the healthcare field, and interventions are based for the most part on the clinical judgment and practical experience of practitioners ... that organizational and individual determinants are involved in research knowledge utilization On an organizational level, compatibility between types of knowledge available and the organization's ... set of variables comprised of organizational elements and other individual user-related elements Exchange mechanisms and collaboration between researchers and professionals may play a determining...

12
372
0