26 of patients in this research have this area in a good status which is also an advantage in frame work rehabilitation

nghiên cứu phục hình hàm khung cho bệnh nhân khuyết hổng xương hàm dưới bản tóm tắt tiếng anh

Ngày tải lên : 03/10/2014, 11:04

... better the abutment This ratio is determined in X-ray of periopex 85 .26% of patients in this research have this area in a good status, which is also an advantage in frame work rehabilitation  The ... mentioned about their advantages and disadvantages by Stewart In comparison with studies of Zlataric, Walid and Graham, it is mainly lattice work saddle  Setting up artificial teeth With the principle ... the men: women rate is 54.5%: 45.5% and this difference did not have any statistical significance This ratio in the research of Carlos and his colleagues on 102 patients with head-andneck section...

24
426
0

Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"

Ngày tải lên : 26/10/2012, 08:57

... OmpA of C pneumoniae was employed The outer (oCP1 – 5’ TTACAAGCCTTGCCTGTAGG 3’, oCP2 – 5’ GCGA TCCCAAATGTTTAAGGC 3’) and nested (iCPC - 5’ TTATTAATTGATGGTACAATA 3’, iCPD - 5’ ATCTACGGCAGTAGTATAGTT ... pathogenesis and clinical manifestations of atherosclerosis The finding of C pneumoniae in serum of ACS patients does not establish causality for the pathogen in development of atherosclerosis ... discovery, diagnosis and treatment Springer-Verlag 2007 Yi-Wei T, Subramaniam S, Haijing L, et al Qualitative and Quantitative Detection of Chlamydophila pneumoniae DNA in Cerebrospinal Fluid from...

10
782
0

Báo cáo hóa học: " Phase I clinical trial of the vaccination for the patients with metastatic melanoma using gp100derived epitope peptide " pot

Ngày tải lên : 18/06/2014, 16:20

... six HLA -A* 2402-positive patients with stage IV melanoma initially enrolled in this clinical trial are shown in this table All patients had relatively good performance status (PS) and had previously ... capable of initiating immune responses against the melanoma Thus the further development of this agent to be used as an immunogenic antigen in vaccine related therapies against melanoma is warranted ... Medical School, Tochigi, Japan), and Ms Setsuko Nakayama, Ms Asuka Asami and Ms Ruriko Miyake for their expert technical assistance (Department of Surgery and Bioengineering, Advanced Clinical Research...

12
396
0

báo cáo khoa học: "Analysis of the recurrence risk factors for the patients with hepatocellular carcinoma meeting University of California San Francisco criteria after curative hepatectomy" pot

Ngày tải lên : 09/08/2014, 01:24

... carcinoma Lancet 2004, 363:899 Baccarani U, Benzoni E, Adani GL, Avellini C, Lorenzin D, Sainz-Barriga M, Bresadola V, Uzzau A, Risaliti A, Beltrami CA, Bresadola F: Superiority of transplantation ... identify independent factors associated with recurrence For all statistical analysis, P < 0.05 was considered as significant All statistical analysis was carried out using the Statistical Package ... and performed the statistical analysis WC Lee conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final...

6
337
0

Báo cáo hóa học: " The Effect of Single, Binary and Ternary Anions of Chloride, Carbonate and Phosphate on the Release of 2,4-Dichlorophenoxyacetate Intercalated into the Zn–Al-layered Double Hydroxide Nanohybrid" pot

Ngày tải lên : 22/06/2014, 00:20

... micrographs were obtained In the single system release media, it could be observed that carbonate dominated the accumulated release Table Basal spacing and elemental analysis of Zn–Al-LDH (ZAN) and ... PXRD patterns of ZAN and its nanohybrid ZANDI As shown in the ﬁgure, the basal spacing of ZAN, which contains nitrate as the counter anion in the interlayer ˚ was recorded to be 8.9 A The insertion ... 2,4-D (ZANDI) and 2,4-D equivalent to 33.9% loading of 2,4-D in the nanohybrid The summary of elemental analysis is given in Table The surface morphology of ZAN and ZANDI is shown in Fig 3a, b,...

7
459
0

Chapter 082. Infections in Patients with Cancer (Part 2) doc

Ngày tải lên : 07/07/2014, 01:20

... for this purpose Table 82-2 Vaccination of Cancer Patients Receiving Chemotherapy Use in Indicated Patients Vaccine Intensive Chemotherapy Hodgkin's Disease Hematopo ietic Stem Cell Transplantation ... DF-2), a bacterium carried in the mouths of animals (Chaps 140 and e14) Since encapsulated bacteria (Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis) are the organisms ... meningococcal administered conjugated splenectomized patients be Should be to administered to administered splenectomized and patients Should be to splenectomized and patients and patients living in patients...

6
392
0

Creating 3D Game Art for the iPhone with Unity Part 2 docx

Ngày tải lên : 08/08/2014, 13:21

... scope of your project and what you want to accomplish By creating performance scene to test hardware and gaining a thorough understanding of the capabilities and limitations of that hardware, ... will dictate this balance This is why Chapter 1, “Getting to Know the iDevice Hardware and Unity iOS,” was dedicated to the iDevice hardware as understanding what the hardware is capable of and its ... goal, and I established early on that I wanted to spend the bulk of my frametime spent rendering I also decided that I wanted my game to maintain a frame rate of 30 fps With this goal set, I created...

28
339
0

the binding and availability of 2,4,6-trinitrotoluene (tnt) from sand, clay minerals, and soils the effects of aging and the implications for biotreatment

Ngày tải lên : 13/11/2014, 15:42

169
275
0

Báo cáo khoa học: Novel isoenzyme of 2-oxoglutarate dehydrogenase is identiﬁed in brain, but not in heart potx

Ngày tải lên : 23/03/2014, 06:20

... Yamamoto T, Yamada A, Watanabe M, Yoshimura Y, Yamazaki N, Yoshimura Y, Yamauchi T, Kataoka M, Nagata T, Terada H et al (2006) VDAC1, having a shorter N-terminus than VDAC2 but showing the same ... Processing of the spectra was performed by the use of data analysis software package and biotools software from Bruker A peptide mass tolerance of ± Da, a fragment mass tolerance of ± Da and one maximal ... under default parameters In- gel digestion SDS ⁄ PAGE-separated and Coomassie Brilliant Blue-stained protein bands of interest were excised and in- gel digested in an adapted manner according to...

17
389
0

The OpenCV Reference Manual Release 2.4.6.0 potx

Ngày tải lên : 25/03/2014, 12:21

... 2-dimensional arrays That is, if, for example, A is a x N ﬂoating-point matrix and B is an M x integer matrix, you can simply write A. at(k+4) and B.at(2*i+1) instead of A. at(0,k+4) and ... InputArray mask=noArray() ) Parameters value – Assigned scalar converted to the actual array type mask – Operation mask of the same size as *this This is an advanced variant of the Mat::operator=(const ... the same as a: b in Matlab or a b in Python As in Python, start is an inclusive left boundary of the range and end is an exclusive right boundary of the range Such a half-opened interval is usually...

819
6.2K
0

Báo cáo toán học: "The Strongly Regular (40, 12, 2, 4) Graphs" ppsx

Ngày tải lên : 07/08/2014, 06:20

... described as follows Associated with the adjacency matrix of any graph there is a binary integer obtained by concatenating the rows of the upper triangular part of the matrix The standard form of this ... many ways, at least in the beginning, of assigning adjacencies among the non-neighbours An improvement on this idea was obtained by ﬁrst extending each neighbour graph to a larger subgraph, using ... neighbours, and each pair of nonadjacent neighbours has common neighbours In [3] an incomplete enumeration of strongly regular (40, 12, 2, 4) graphs established the existence of at least 27, all of which...

4
269
0

Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx

Ngày tải lên : 11/08/2014, 08:21

... inactivates LPS in vitro and in vivo, and reconstituted HDL is anti-inflammatory in animal and human endotoxemia [50-55] Apolipoproteins themselves appear to be anti-inflammatory and can bind LPS [3,56] ... results of figures 1, 2, 3, 4, 5, 6, and 9, and processing of mice, and was the main author and editor of the manuscript All authors read and approved the final manuscript Acknowledgements This work ... altering their sequence of VCAM-1 and iNOS were measured since they are part of an inflammatory cascade induced by LPS VCAM-1 mediates localization of various inflammatory cells in tissues iNOS,...

11
281
0

báo cáo hóa học: " Clinical implications of gait analysis in the rehabilitation of adult patients with "Prader-Willi" Syndrome: a cross-sectional comparative study ("Prader-Willi" Syndrome vs matched obese patients and healthy subjects)" docx

Ngày tải lên : 19/06/2014, 10:20

... expressed as mean ± SD Statistical analysis was performed by t-test for unpaired data with Bonferroni correction, and using analysis of variance for parametric or nonparametric (Kruskall-Wallis and Mann-Whitney) ... show any change in sagittal plane knee moment [4] As far as obese adult patients are concerned, obese males display a gait pattern similar to healthy subjects but some of the temporal and angular ... treatment of behavioral abnormalities, are the cornerstones of a multidisciplinary PWS patients treatment References De Souza SA, Faintuch J, Valezi AC, Sant' Anna AF, Gama-Rodrigues JJ, de Batista Fonseca...

7
531
0

báo cáo hóa học:" Japanese version of the Dermatology Life Quality Index: validity and reliability in patients with acne" potx

Ngày tải lên : 20/06/2014, 15:20

... based on the two translations, and a single Japanese version was created A translator whose native language was English then translated the Japanese version back into English Based on the back ... public health research foundation Authors' contributions Takahashi N carried out the analysis and interpretation of data, drafted and revised this article Suzukamo Y assumed the coordination and design ... of this study, training interviewers and interpretation of data Nakamura M, Miyachi Y and the Acne QOL Questionnaire Development Team contributed in the design of this study and acquisition of...

7
394
0

báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx

Ngày tải lên : 20/06/2014, 16:20

... exercise treadmill time, CCS = Canadian Cardiovascular Society Angina Classification, SAQ = Seattle Angina Questionnaire, ECS = exertional capacity scale, ASS = anginal stability scale, AFS = anginal ... [14] The dataset was then divided in two by taking a random sample of 60% of the data and separating that data from the remaining 40% to provide an estimation dataset and a validation dataset, respectively ... related to angina: the exertional capacity scale (ECS), anginal stability scale (ASS), anginal frequency scale (AFS), treatment satisfaction scale (TSS) and the disease perception scale (DPS) Each...

13
334
0

Báo cáo y học: "The reliability of toe systolic pressure and the toe brachial index in patients with diabetes" ppsx

Ngày tải lên : 10/08/2014, 21:24

... raw data for the mean ± standard deviation of Toe Systolic Pressures and Toe Brachial Indices according to rater and session Abbreviations ABI: ankle brachial index; ANOVA: analysis of variance; ... of PAOD If any participants had severe peripheral neuropathy or severe PAOD this may have result in irregular patterns of blood flow that could cause Romanos et al Journal of Foot and Ankle Research ... peripheral arterial disease: Transatlantic InterSociety Consensus European Journal of Vascular and Endovascular Surgery 2000, 19(Suppl A) :S1-S250 28 deGraaff JC, Ubbink DT, Legemate DA, deHaan RJ, Jacobs...

8
537
0

báo cáo khoa học:" Sinus lifting before Le Fort I maxillary osteotomy: a suitable method for oral rehabilitation of edentulous patients with skelettal class-III conditions: review of the literature and report of a case" doc

Ngày tải lên : 11/08/2014, 23:22

... guides a total of 12 endosseous Camlog® implants were accurately positioned in the mandible and the maxilla according to the predefined planning that was made up of DVT scan and a wax up Again bone ... The main basic criteria for restauration of the edentulous maxilla and mandible are adequate bone mass and ortholalveolar form [6] This can be achieved by augmentation of the available substrate ... methodological approach of treating a patient with severe mandibular and posterior maxillary alveolar atrophy and skelettal class-III conditions due to cleft palate performing sinus lifting and implant insertion...

7
375
0

Báo cáo y học: "Special considerations in the treatment of patients with bipolar disorder and medical co-morbidities"

Ngày tải lên : 25/10/2012, 10:51

... antiplatelet agents, warfarin or niacin Carbamazepine acts as an inducer of cytochrome 3A4 , which may increase the metabolism of some anticoagulant and cardiovascular medications Olanzapine may induce ... exploration of the antiemetic activity of olanzapine for the relief of nausea in patients with advanced cancer and pain J Pain Symptom Manage 2002, 23: 526- 532 Khojainova N, Santiago-Palma J, Kornick ... antiplatelet agents, warfarin, niacin Induction of CYP 3A4 increases metabolism of some anticoagulant & cardiovascular drugs Increased cardiac risk factors: weight gain, metabolic changes and hyperlipidemia...

10
709
0

Effectiveness of PRECEDE model for health education on changes and level of control of HbA1c, blood pressure, lipids, and body mass index in patients with type 2 diabetes mellitus docx

Ngày tải lên : 05/03/2014, 22:21

... the analysis and interpretation CMM participated in the design and coordinated the research group ECSP, BRS helped in the statistical analysis and drafted the manuscript All authors read and approved ... contributions MASF conceived of the study and participated in its design and perfomed the statistical analysis and drafted the manuscript FJAB, JCAH, CBL drafted the manuscript and made substantial contributions ... knowledge and beliefs about healthy behaviors that wanted to assimilate Final task: To create a list in favour and against to carry out the behavior Enabling factors: Once the patient is motivated...

9
654
1

The management of patients with venous leg ulcers: Audit Protocol ppt

Ngày tải lên : 15/03/2014, 23:20

... quality of care to patients It is hoped that results will be collated nationally in an anonymised form to enable comparative data analysis to take place This will allow individual teams to benchmark ... Unpublished Bachelor of Nursing Dissertation, Swansea Institute Library, Swansea Thomas S, Bandagers and Bandaging 1990 Nursing Standards; Vol 4; No 39; pp46-47 Thompson B A 1993 A management protocol ... The clinical history and physical examination will assist the identiﬁcation of both the underlying cause of leg ulcers and any associated diseases, and will in uence decisions about prognosis,...

30
518
0