Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"
... radioactive implants (brachytherapy) [7]. iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen depri-vation therapy (ADT) that may be performed ... Makita N, Tarumi Y, Kadomatsu K, and Takei Y. Systemic delivery of siRNA specific to tumor mediated by atelocollagen: Combined therapy using siRNA targeting Bcl-xL and cisplatin against prostate ... 49. Powell SN and Bindra RS. Targeting the DNA damage response for cancer therapy. DNA Repair (Amst) 2009; 8: 1153-1165 50. Shimada M and Nakanishi M. DNA damage checkpoints and cancer. J. Mol....
- 10
- 408
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... cleavage was observed even when 100 ngof the mutant variants were assayed. In addition, althoughwild-type a- sarcin degrades polyadenylic acid on a zymo-gram assay, R121K and R121Q did not cleave ... acid and base on the catalysis by a- sarcin [19,20],rendered proteins with no detectable activity against ApA[20]. Cleavage of ApA by a- sarcin is a low-specificityreaction requiring high amounts ... ribonucleaseactivity of a- sarcin has been developed by using thedinucleotide ApA as substrate [18]. Both mutant variantshydrolysed ApA. They displayed a Kmvalue similar tothat of the wild-type protein although...
- 7
- 434
- 0
Báo cáo y học: "Why are some children with early onset of asthma getting better over the years" -aneuploid-prostate-cancer-cells-after-tmz-tmz-bioshuttle-treatment.html#post143974
... successively amended regional quality program for asthma diag-nosis is nowadays shared, but was more lax 15 years ago than today, which introduces a possible bias since many of the NA cases were early ... from a defined affluent geographical area and followed up to the age of 7 and 10 years. The study includes medical record examination and a ‘spectral analysis’ in remaining and non-remaining cases ... be seen as a respiratory maladap-tation to modern lifestyles and to our increasingly artificial habitats and habits; not the least a progres-sive decrease of general physical activity (7,8)....
- 10
- 456
- 0
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"
... care is reasonable skills and care reasonably expected of a practitioner with the same standing. e standard of care is diff erent in cases of diagnosis and treatment, and in cases of giving advice ... competency of healthcare pro-viders and the provision of a reasonable standard of healthcare service are inter-related, and the failure of either one has not only legal but also cost and psycho-logical ... and widely accepted in Australia and New Zealand, the Australasian Society of Ultrasound in Medicine.ConclusionMedical practitioners owe a duty of care, arising from contract and/ or tort laws, to...
- 6
- 714
- 0
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"
... dysfunction1,20. However, in-flammatory reaction against the dead parasite is as-sociated with perilesional edema, which can damage medullar parenchyma and therefore, worsen symp-toms2. ... the results of surgical outcome are mixed. Mohanty16 reported only a 75% satisfactory outcome after surgery and cysticidal treatment. Early diagnosis and treatment can improve the outcome. ... medical therapy alone include avoidance of surgery and treatment of surgically unreachable and multifocal cysticercus2,3,5,7,17. Conclusions In conclusion, we think that intramedullary cys-ticercosis...
- 4
- 592
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy1, Cenk Aypak2, Alpay Azap1, Önder Ergönül3, İsmail Balık1 1. Department of Clinical Microbiology and Infectious Disease, Ankara ... antimicrobial resistance, and cost. Materials and Methods: The data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara. Antimicrobial ... 2003. 12. National Committee for Clinical Laboratory Standards. Per-formance Standards for Antimicrobial Susceptibility Testing. Wayne, PA, USA: 13th Informational Supplement...
- 6
- 692
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health Hunaid Hasan, Tasneem Fatema Hasan Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, ... Journal of Personality and Social Psychology. 1998; 74: 482–93. Author biography Hunaid Hasan is a final year medical student at Mahatma Gandhi Mission’s Medical Col-lege-Maharashtra University ... to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, CTS No. 3910, Near Bombay Mercantile Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email:...
- 12
- 757
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... positive aerobic and anaerobic bacteria and most Gram negative anaerobic species. In contrast, it has a low toxicity for aerobic Gram negative bacteria, somefungi and mammals [2]. Its chemical structure ... similarities with several products from the purcluster of S. alboniger [6]. They were accordingly namedataP3, ataP5, ataP4, ataP10 and ataP7. The two additionalones were named ata12 and ataPKS1 ... suggests thatataP3/pur3, ataP4/pur4, ataP5/pur5, ataP7/pur7 and ataP10/pur10 are responsible for synthesizing the aminonu-cleoside moiety of A2 0 1A and puromycin by S. capreolus and S. alboniger,...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... isoform of the regulatorysubunit of casein kinase 2 inDrosophila melanogasterAlla I. Kalmykova1, Yuri Y. Shevelyov1, Oksana O. Polesskaya1,*, Anna A. Dobritsa1,†,Alexandra G. Evstafieva2, ... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424;AD**, pACT2. Activity values are given as mean values ± standard ... protein -A Sepharose,washed and separated by SDS/PAGE. The immunostainingof Western blot was performed by commercially available,high affinity anti-(b-galactosidase) Ig.Anti-(b-galactosidase)...
- 10
- 464
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... franciscanaOligomerization and thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously ... GCGCGGATCCACCATGGCACTTAACCCATG 459/153(p26-153Xho-as) CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCTp26-CD10 183–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182(P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGTp26-alpha ... observations contradictthe general belief that under ordinary hydration and temperature, cell maintenance entails a constant and substantial free energy flow [51,52]. Anoxic cysts m ayacquire s ufficient...
- 10
- 495
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyena promising tool for the development of electrochemical cellsbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP